Search Blogs

Showing results for "java"

Found 50 results

OOPs in Java - Complete Guide With Simple Examples

OOPs in Java - Complete Guide With Simple Examples

IntroductionObject Oriented Programming — or OOPs — is the foundation of Java. Almost every Java program you will ever write or read is built around OOPs concepts. The good news is these concepts are not complicated at all. They are actually modeled after how we think about real life things.By the end of this article you will understand every core OOPs concept clearly — not just enough to answer interview questions, but enough to actually use them confidently in your code.What Is Object Oriented Programming?Before OOPs, programmers wrote procedural code — a long sequence of instructions executed top to bottom. As programs grew bigger, this became a nightmare to manage. You could not organize related data and behavior together, reuse code cleanly, or model real world things naturally.OOPs solved this by organizing code around objects — just like the real world is organized around things. A car, a person, a bank account — each is a thing with properties and behaviors. OOPs lets you model these things directly in code.Java is a purely object oriented language (almost everything in Java is an object). That is why understanding OOPs is not optional in Java — it is essential.Class — The BlueprintA class is a blueprint or template. It defines what properties and behaviors an object of that type will have. The class itself is not an actual thing — it is just the design.Think of a class like an architectural blueprint of a house. The blueprint is not a house. But from one blueprint you can build many houses.class Car { // properties (what a car HAS) String brand; String color; int speed; // behaviors (what a car DOES) void accelerate() { System.out.println(brand + " is speeding up!"); } void brake() { System.out.println(brand + " is slowing down!"); }}Car is the blueprint. It defines that every car has a brand, color, speed, and can accelerate and brake. No actual car exists yet — this is just the design.Object — The Real ThingAn object is an actual instance created from a class. When you create an object, you are building a real house from the blueprint.public class Main { public static void main(String[] args) { // creating objects from the Car class Car car1 = new Car(); car1.brand = "Toyota"; car1.color = "Red"; car1.speed = 120; Car car2 = new Car(); car2.brand = "BMW"; car2.color = "Black"; car2.speed = 200; car1.accelerate(); // Toyota is speeding up! car2.brake(); // BMW is slowing down! }}car1 and car2 are two different objects from the same Car blueprint. Each has its own data but shares the same structure and behaviors.Constructor — The Object InitializerA constructor is a special method that runs automatically when an object is created. It is used to set initial values.class Car { String brand; String color; int speed; // constructor — same name as class, no return type Car(String brand, String color, int speed) { this.brand = brand; this.color = color; this.speed = speed; } void accelerate() { System.out.println(brand + " is speeding up!"); }}// Now creating objects is cleanerCar car1 = new Car("Toyota", "Red", 120);Car car2 = new Car("BMW", "Black", 200);The this keyword refers to the current object — it distinguishes between the parameter brand and the object's field brand.The Four Pillars of OOPsEverything in OOPs builds on four core concepts. These are what interviewers ask about and what real code is organized around.Pillar 1: Encapsulation — Wrapping and Protecting DataEncapsulation means bundling data (fields) and the methods that work on that data together in one class — and controlling access from outside.Think of a capsule pill. The medicine inside is protected by the outer shell. You do not mess with the medicine directly — you just swallow the capsule.In Java, encapsulation is achieved using access modifiers (private, public) and getters/setters.class BankAccount { private double balance; // private — no direct access from outside private String owner; BankAccount(String owner, double initialBalance) { this.owner = owner; this.balance = initialBalance; } // getter — read the balance public double getBalance() { return balance; } // setter with validation — controlled access public void deposit(double amount) { if (amount > 0) { balance += amount; System.out.println("Deposited: " + amount); } else { System.out.println("Invalid amount!"); } } public void withdraw(double amount) { if (amount > 0 && amount <= balance) { balance -= amount; } else { System.out.println("Insufficient funds!"); } }}BankAccount account = new BankAccount("Alice", 1000);// account.balance = -5000; // ERROR — private, cannot access directlyaccount.deposit(500); // controlled access through methodSystem.out.println(account.getBalance()); // 1500.0Why encapsulation matters: Without it, anyone could set balance = -999999 directly. With it, you control exactly how data can be changed — protecting your object's integrity.Pillar 2: Inheritance — Reusing Code Through Parent-Child RelationshipInheritance allows one class to acquire the properties and behaviors of another class. The child class gets everything the parent has and can add its own things on top.Think of it like genetics. A child inherits traits from their parents but also develops their own unique characteristics.In Java, inheritance uses the extends keyword.// Parent classclass Animal { String name; Animal(String name) { this.name = name; } void eat() { System.out.println(name + " is eating."); } void sleep() { System.out.println(name + " is sleeping."); }}// Child class inherits from Animalclass Dog extends Animal { String breed; Dog(String name, String breed) { super(name); // calls Animal's constructor this.breed = breed; } // Dog's own behavior void bark() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } void meow() { System.out.println(name + " says: Meow!"); }}Dog dog = new Dog("Buddy", "Labrador");dog.eat(); // inherited from Animal — Buddy is eating.dog.sleep(); // inherited from Animal — Buddy is sleeping.dog.bark(); // Dog's own method — Buddy says: Woof!Cat cat = new Cat("Whiskers");cat.eat(); // inherited — Whiskers is eating.cat.meow(); // Cat's own — Whiskers says: Meow!super() calls the parent class constructor. super.methodName() calls a parent class method.Why inheritance matters: You write eat() and sleep() once in Animal and every animal class gets them for free. No repetition, clean organization.Pillar 3: Polymorphism — One Interface, Many FormsPolymorphism means the same method name behaves differently depending on the object calling it. It comes in two flavors.The word itself means "many forms" — same action, different results based on who is doing it.Think of a "speak" command given to different animals. You tell a dog to speak — it barks. You tell a cat to speak — it meows. Same command, different behavior.Method Overriding (Runtime Polymorphism)A child class provides its own version of a method already defined in the parent class.class Animal { String name; Animal(String name) { this.name = name; } void makeSound() { System.out.println(name + " makes a sound."); }}class Dog extends Animal { Dog(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Meow!"); }}class Cow extends Animal { Cow(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Moo!"); }}Animal[] animals = { new Dog("Buddy"), new Cat("Whiskers"), new Cow("Bella")};for (Animal a : animals) { a.makeSound(); // different behavior for each!}// Buddy says: Woof!// Whiskers says: Meow!// Bella says: Moo!Same makeSound() call on an Animal reference — but the actual behavior depends on what the object really is at runtime. That is runtime polymorphism.Method Overloading (Compile-Time Polymorphism)Same method name, different parameters in the same class.class Calculator { int add(int a, int b) { return a + b; } double add(double a, double b) { return a + b; } int add(int a, int b, int c) { return a + b + c; }}Calculator calc = new Calculator();calc.add(2, 3); // calls first method — 5calc.add(2.5, 3.5); // calls second method — 6.0calc.add(1, 2, 3); // calls third method — 6Java decides which version to call at compile time based on the argument types and count.Pillar 4: Abstraction — Hiding Complexity, Showing EssentialsAbstraction means showing only the necessary details to the user and hiding the internal complexity. You expose what something does, not how it does it.Think of driving a car. You know the steering wheel turns the car and the pedal accelerates it. You do not need to know how the engine combustion works internally. The complexity is hidden — only what you need to use is exposed.Java achieves abstraction through abstract classes and interfaces.Abstract ClassAn abstract class cannot be instantiated directly. It can have abstract methods (no body — child must implement) and regular methods (with body).abstract class Shape { String color; Shape(String color) { this.color = color; } // abstract method — no body, child MUST implement abstract double calculateArea(); // regular method — shared behavior void displayColor() { System.out.println("Color: " + color); }}class Circle extends Shape { double radius; Circle(String color, double radius) { super(color); this.radius = radius; } @Override double calculateArea() { return Math.PI * radius * radius; }}class Rectangle extends Shape { double width, height; Rectangle(String color, double width, double height) { super(color); this.width = width; this.height = height; } @Override double calculateArea() { return width * height; }}Shape circle = new Circle("Red", 5);Shape rect = new Rectangle("Blue", 4, 6);circle.displayColor(); // Color: RedSystem.out.println(circle.calculateArea()); // 78.53...System.out.println(rect.calculateArea()); // 24.0InterfaceAn interface is a 100% abstract contract — it only defines what methods a class must have, with no implementation (in older Java). A class can implement multiple interfaces.interface Flyable { void fly(); // every class implementing this MUST define fly()}interface Swimmable { void swim();}class Duck implements Flyable, Swimmable { @Override public void fly() { System.out.println("Duck is flying!"); } @Override public void swim() { System.out.println("Duck is swimming!"); }}Duck duck = new Duck();duck.fly(); // Duck is flying!duck.swim(); // Duck is swimming!Key difference between abstract class and interface:A class can extend only one abstract class but can implement multiple interfaces. Use abstract class when classes share common code. Use interface when you want to define a contract that unrelated classes can follow.Access Modifiers — Quick ReferenceAccess modifiers control who can access your class members:ModifierSame ClassSame PackageSubclassEverywhereprivate✅❌❌❌default✅✅❌❌protected✅✅✅❌public✅✅✅✅General rule — make fields private, make methods public unless there is a reason not to. This is encapsulation in practice.Quick Summary — All OOPs Concepts in One PlaceClass — Blueprint/template that defines structure and behaviorObject — Real instance created from a class using newConstructor — Special method that initializes an object when createdEncapsulation — Bundle data and methods together, control access with private/publicInheritance — Child class gets parent's properties and behaviors using extendsPolymorphism — Same method name behaves differently (overriding = runtime, overloading = compile time)Abstraction — Hide complexity, show only essentials using abstract class or interfaceFAQs — People Also AskQ1. What is the difference between a class and an object in Java? A class is the blueprint — it defines structure but does not exist in memory as a usable thing. An object is a real instance created from that blueprint using new. You can create many objects from one class, just like building many houses from one blueprint.Q2. What is the difference between abstract class and interface in Java? An abstract class can have both abstract (no body) and concrete (with body) methods, and a class can extend only one. An interface traditionally has only abstract methods and a class can implement multiple interfaces. Use abstract class for shared code, interface for defining contracts.Q3. What is the difference between method overriding and overloading? Overriding happens in a parent-child relationship — the child redefines a parent method with the same name and parameters. Overloading happens in the same class — same method name but different parameters. Overriding is resolved at runtime, overloading at compile time.Q4. Why is OOPs important in Java? Java is built entirely around OOPs. Every piece of Java code lives inside a class. OOPs enables code reuse through inheritance, data protection through encapsulation, flexibility through polymorphism, and simplicity through abstraction — all essential for building large, maintainable applications.ConclusionOOPs in Java is not a collection of confusing terms — it is a natural way of thinking about and organizing code. Classes are blueprints, objects are real things, encapsulation protects data, inheritance reuses code, polymorphism provides flexibility, and abstraction hides complexity.Once these four pillars feel natural, you will start seeing them everywhere — in every Java library, every framework, every codebase. That is when Java truly starts to click.

OOPsJavaClassesObjectsInheritancePolymorphismEncapsulationAbstraction
Stack Data Structure in Java: The Complete In-Depth Guide

Stack Data Structure in Java: The Complete In-Depth Guide

1. What Is a Stack?A Stack is a linear data structure that stores elements in a sequential order, but with one strict rule — you can only insert or remove elements from one end, called the top.It is one of the simplest yet most powerful data structures in computer science. Its strength comes from its constraint. Because everything happens at one end, the behavior of a stack is completely predictable.The formal definition: A Stack is a linear data structure that follows the Last In, First Out (LIFO) principle — the element inserted last is the first one to be removed.Here is what a stack looks like visually: ┌──────────┐ │ 50 │ ← TOP (last inserted, first removed) ├──────────┤ │ 40 │ ├──────────┤ │ 30 │ ├──────────┤ │ 20 │ ├──────────┤ │ 10 │ ← BOTTOM (first inserted, last removed) └──────────┘When you push 60 onto this stack, it goes on top. When you pop, 60 comes out first. That is LIFO.2. Real-World AnalogiesBefore writing a single line of code, it helps to see stacks in the real world. These analogies will make the concept permanently stick.A Pile of Plates In a cafeteria, clean plates are stacked on top of each other. You always pick the top plate. You always place a new plate on top. You never reach into the middle. This is a stack.Browser Back Button Every time you visit a new webpage, it gets pushed onto a history stack. When you press the Back button, the browser pops the most recent page off the stack and takes you there. The page you visited first is at the bottom — you only reach it after going back through everything else.Undo Feature in Text Editors When you type in a document and press Ctrl+Z, the most recent action is undone first. That is because every action you perform is pushed onto a stack. Undo simply pops from that stack.Call Stack in Programming When a function calls another function, the current function's state is pushed onto the call stack. When the inner function finishes, it is popped off and execution returns to the outer function. This is the literal stack your programs run on.A Stack of Books Put five books on a table, one on top of another. You can only take the top book without knocking the pile over. That is a stack.3. The LIFO Principle ExplainedLIFO stands for Last In, First Out.It means whatever you put in last is the first thing to come out. This is the exact opposite of a Queue (which is FIFO — First In, First Out).Let us trace through an example step by step:Start: Stack is empty → []Push 10 → [10] (10 is at the top)Push 20 → [10, 20] (20 is at the top)Push 30 → [10, 20, 30] (30 is at the top)Pop → returns 30 (30 was last in, first out) Stack: [10, 20]Pop → returns 20 Stack: [10]Peek → returns 10 (just looks, does not remove) Stack: [10]Pop → returns 10 Stack: [] (stack is now empty)Every single operation happens only at the top. The bottom of the stack is never directly accessible.4. Stack Operations & Time ComplexityA stack supports the following core operations:OperationDescriptionTime Complexitypush(x)Insert element x onto the top of the stackO(1)pop()Remove and return the top elementO(1)peek() / top()Return the top element without removing itO(1)isEmpty()Check if the stack has no elementsO(1)isFull()Check if the stack has reached its capacity (Array only)O(1)size()Return the number of elements in the stackO(1)search(x)Find position of element from top (Java built-in only)O(n)All primary stack operations — push, pop, peek, isEmpty — run in O(1) constant time. This is what makes the stack so efficient. It does not matter whether the stack has 10 elements or 10 million — these operations are always instant.Space complexity for a stack holding n elements is O(n).5. Implementation 1 — Using a Static ArrayThis is the most fundamental way to implement a stack. We use a fixed-size array and a variable called top to track where the top of the stack currently is.How it works:top starts at -1 (stack is empty)On push: increment top, then place the element at arr[top]On pop: return arr[top], then decrement topOn peek: return arr[top] without changing it// StackUsingArray.javapublic class StackUsingArray { private int[] arr; private int top; private int capacity; // Constructor — initialize with a fixed capacity public StackUsingArray(int capacity) { this.capacity = capacity; arr = new int[capacity]; top = -1; } // Push: add element to the top public void push(int value) { if (isFull()) { System.out.println("Stack Overflow! Cannot push " + value); return; } arr[++top] = value; System.out.println("Pushed: " + value); } // Pop: remove and return top element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } return arr[top--]; } // Peek: view the top element without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return arr[top]; } // Check if stack is empty public boolean isEmpty() { return top == -1; } // Check if stack is full public boolean isFull() { return top == capacity - 1; } // Return current size public int size() { return top + 1; } // Display all elements public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = top; i >= 0; i--) { System.out.print(arr[i] + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArray stack = new StackUsingArray(5); stack.push(10); stack.push(20); stack.push(30); stack.push(40); stack.push(50); stack.push(60); // This will trigger Stack Overflow stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 10Pushed: 20Pushed: 30Pushed: 40Pushed: 50Stack Overflow! Cannot push 60Stack (top → bottom): 50 40 30 20 10Peek: 50Pop: 50Pop: 40Stack (top → bottom): 30 20 10Size: 3Key Points about Array Implementation:Fixed size — you must declare capacity upfrontVery fast — direct array index accessStack Overflow is possible if capacity is exceededMemory is pre-allocated even if stack is not full6. Implementation 2 — Using an ArrayListAn ArrayList-based stack removes the fixed-size limitation. The ArrayList grows dynamically, so you never have to worry about stack overflow due to capacity.How it works:The end of the ArrayList acts as the topadd() is used for pushremove(size - 1) is used for popget(size - 1) is used for peek// StackUsingArrayList.javaimport java.util.ArrayList;public class StackUsingArrayList { private ArrayList<Integer> list; // Constructor public StackUsingArrayList() { list = new ArrayList<>(); } // Push: add to the end (which is our top) public void push(int value) { list.add(value); System.out.println("Pushed: " + value); } // Pop: remove and return the last element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int top = list.get(list.size() - 1); list.remove(list.size() - 1); return top; } // Peek: view the last element public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return list.get(list.size() - 1); } // Check if stack is empty public boolean isEmpty() { return list.isEmpty(); } // Return size public int size() { return list.size(); } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = list.size() - 1; i >= 0; i--) { System.out.print(list.get(i) + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArrayList stack = new StackUsingArrayList(); stack.push(5); stack.push(15); stack.push(25); stack.push(35); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Is Empty: " + stack.isEmpty()); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 5Pushed: 15Pushed: 25Pushed: 35Stack (top → bottom): 35 25 15 5Peek: 35Pop: 35Pop: 25Stack (top → bottom): 15 5Is Empty: falseSize: 2Key Points about ArrayList Implementation:Dynamic size — grows automatically as neededNo overflow riskSlight overhead compared to raw array due to ArrayList internalsExcellent for most practical use cases7. Implementation 3 — Using a LinkedListA LinkedList-based stack is the most memory-efficient approach when you do not know the stack size in advance. Each element (node) holds data and a pointer to the next node. The head of the LinkedList acts as the top of the stack.How it works:Each node stores a value and a reference to the node below itPush creates a new node and makes it the new headPop removes the head node and returns its valuePeek returns the head node's value without removing it// StackUsingLinkedList.javapublic class StackUsingLinkedList { // Inner Node class private static class Node { int data; Node next; Node(int data) { this.data = data; this.next = null; } } private Node top; // Head of the linked list = top of stack private int size; // Constructor public StackUsingLinkedList() { top = null; size = 0; } // Push: create new node and link it to top public void push(int value) { Node newNode = new Node(value); newNode.next = top; // new node points to current top top = newNode; // new node becomes the new top size++; System.out.println("Pushed: " + value); } // Pop: remove and return top node's data public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int value = top.data; top = top.next; // move top pointer to next node size--; return value; } // Peek: return top node's data without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return top.data; } // Check if empty public boolean isEmpty() { return top == null; } // Return size public int size() { return size; } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); Node current = top; while (current != null) { System.out.print(current.data + " "); current = current.next; } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingLinkedList stack = new StackUsingLinkedList(); stack.push(100); stack.push(200); stack.push(300); stack.push(400); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 100Pushed: 200Pushed: 300Pushed: 400Stack (top → bottom): 400 300 200 100Peek: 400Pop: 400Pop: 300Stack (top → bottom): 200 100Size: 2Key Points about LinkedList Implementation:Truly dynamic — each node allocated only when neededNo wasted memory from pre-allocationSlightly more memory per element (each node carries a pointer)Ideal for stacks where size is completely unknown8. Java's Built-in Stack ClassJava provides a ready-made Stack class inside java.util. It extends Vector and is thread-safe by default.// JavaBuiltinStack.javaimport java.util.Stack;public class JavaBuiltinStack { public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); // Push elements stack.push(10); stack.push(20); stack.push(30); stack.push(40); System.out.println("Stack: " + stack); // Peek — look at top without removing System.out.println("Peek: " + stack.peek()); // Pop — remove top System.out.println("Pop: " + stack.pop()); System.out.println("After pop: " + stack); // Search — returns 1-based position from top System.out.println("Search 20: position " + stack.search(20)); // isEmpty System.out.println("Is Empty: " + stack.isEmpty()); // Size System.out.println("Size: " + stack.size()); }}```**Output:**```Stack: [10, 20, 30, 40]Peek: 40Pop: 40After pop: [10, 20, 30]Search 20: position 2Is Empty: falseSize: 3Important Note: In modern Java development, it is often recommended to use Deque (specifically ArrayDeque) instead of Stack for better performance, since Stack is synchronized and carries the overhead of Vector.// Using ArrayDeque as a stack (modern preferred approach)import java.util.ArrayDeque;import java.util.Deque;public class ModernStack { public static void main(String[] args) { Deque<Integer> stack = new ArrayDeque<>(); stack.push(10); // pushes to front stack.push(20); stack.push(30); System.out.println("Top: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Stack: " + stack); }}9. Comparison of All ImplementationsFeatureArrayArrayListLinkedListJava StackArrayDequeSizeFixedDynamicDynamicDynamicDynamicStack Overflow RiskYesNoNoNoNoMemory UsagePre-allocatedAuto-growsPer-node overheadAuto-growsAuto-growsPush TimeO(1)O(1) amortizedO(1)O(1)O(1)Pop TimeO(1)O(1)O(1)O(1)O(1)Peek TimeO(1)O(1)O(1)O(1)O(1)Thread SafeNoNoNoYesNoBest ForKnown size, max speedGeneral useUnknown/huge sizeLegacy codeModern Java10. Advantages & DisadvantagesAdvantagesAdvantageExplanationSimple to implementVery few rules and operations to worry aboutO(1) operationsPush, pop, and peek are all constant timeMemory efficientNo extra pointers needed (array-based)Supports recursionThe call stack is itself a stackEasy undo/redoNatural fit for reversible action trackingBacktrackingPerfectly suited for maze, puzzle, and game solvingExpression evaluationPowers compilers and calculatorsDisadvantagesDisadvantageExplanationLimited accessCannot access elements in the middle directlyFixed size (array)Array-based stacks overflow if size is exceededNo random accessYou cannot do stack[2] — only top is accessibleMemory waste (array)Pre-allocated array wastes space if underusedNot suitable for all problemsMany problems need queues, trees, or graphs insteadStack overflow in recursionVery deep recursion can overflow the JVM call stack11. Real-World Use Cases of StackUnderstanding when to use a stack is just as important as knowing how to implement one. Here is where stacks show up in real software:Function Call Management (Call Stack) Every time your Java program calls a method, the JVM pushes that method's frame onto the call stack. When the method returns, the frame is popped. This is why you see "StackOverflowError" when you write infinite recursion.Undo and Redo Operations Text editors, image editors (Photoshop), and IDEs use two stacks — one for undo history and one for redo history. Every action pushes onto the undo stack. Ctrl+Z pops from it and pushes to the redo stack.Browser Navigation Your browser maintains a back-stack and a forward-stack. Visiting a new page pushes to the back-stack. Pressing Back pops from it and pushes to the forward-stack.Expression Evaluation and Conversion Compilers use stacks to evaluate arithmetic expressions and convert between infix, prefix, and postfix notations. For example: 3 + 4 * 2 must be evaluated considering operator precedence — this is done with a stack.Balanced Parentheses Checking Linters, compilers, and IDEs use stacks to check if brackets are balanced: {[()]} is valid, {[(])} is not.Backtracking Algorithms Maze solving, N-Queens, Sudoku solvers, and depth-first search all use stacks (explicitly or via recursion) to backtrack to previous states when a path fails.Syntax Parsing Compilers parse source code using stacks to match opening and closing constructs like if/else, try/catch, { and }.12. Practice Problems with Full SolutionsHere is where things get really interesting. These problems will sharpen your stack intuition and prepare you for coding interviews.Problem 1 — Reverse a String Using a StackDifficulty: EasyProblem: Write a Java program to reverse a string using a Stack.Approach: Push every character of the string onto a stack, then pop them all. Since LIFO reverses the order, the characters come out reversed.// ReverseString.javaimport java.util.Stack;public class ReverseString { public static String reverse(String str) { Stack<Character> stack = new Stack<>(); // Push all characters for (char c : str.toCharArray()) { stack.push(c); } // Pop all characters to build reversed string StringBuilder reversed = new StringBuilder(); while (!stack.isEmpty()) { reversed.append(stack.pop()); } return reversed.toString(); } public static void main(String[] args) { System.out.println(reverse("hello")); // olleh System.out.println(reverse("java")); // avaj System.out.println(reverse("racecar")); // racecar (palindrome) System.out.println(reverse("datastructure")); // erutcurtasatad }}Problem 2 — Check Balanced ParenthesesDifficulty: Easy–MediumProblem: Given a string containing (, ), {, }, [, ], determine if the brackets are balanced.Approach: Push every opening bracket onto the stack. When you see a closing bracket, check if it matches the top of the stack. If it does, pop. If it does not, the string is unbalanced.// BalancedParentheses.javaimport java.util.Stack;public class BalancedParentheses { public static boolean isBalanced(String expr) { Stack<Character> stack = new Stack<>(); for (char c : expr.toCharArray()) { // Push all opening brackets if (c == '(' || c == '{' || c == '[') { stack.push(c); } // For closing brackets, check the top of stack else if (c == ')' || c == '}' || c == ']') { if (stack.isEmpty()) return false; char top = stack.pop(); if (c == ')' && top != '(') return false; if (c == '}' && top != '{') return false; if (c == ']' && top != '[') return false; } } // Stack must be empty at the end for a balanced expression return stack.isEmpty(); } public static void main(String[] args) { System.out.println(isBalanced("{[()]}")); // true System.out.println(isBalanced("{[(])}")); // false System.out.println(isBalanced("((()))")); // true System.out.println(isBalanced("{]")); // false System.out.println(isBalanced("")); // true (empty is balanced) }}Problem 3 — Reverse a Stack (Without Extra Data Structure)Difficulty: Medium–HardProblem: Reverse all elements of a stack using only recursion — no array or extra stack allowed.Approach: This is a classic recursion problem. You need two recursive functions:insertAtBottom(stack, item) — inserts an element at the very bottom of the stackreverseStack(stack) — pops all elements, reverses, and uses insertAtBottom to rebuild// ReverseStack.javaimport java.util.Stack;public class ReverseStack { // Insert an element at the bottom of the stack public static void insertAtBottom(Stack<Integer> stack, int item) { if (stack.isEmpty()) { stack.push(item); return; } int top = stack.pop(); insertAtBottom(stack, item); stack.push(top); } // Reverse the stack using insertAtBottom public static void reverseStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); reverseStack(stack); // reverse the remaining stack insertAtBottom(stack, top); // insert popped element at bottom } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(1); stack.push(2); stack.push(3); stack.push(4); stack.push(5); System.out.println("Before: " + stack); // [1, 2, 3, 4, 5] reverseStack(stack); System.out.println("After: " + stack); // [5, 4, 3, 2, 1] }}Problem 4 — Evaluate a Postfix ExpressionDifficulty: MediumProblem: Evaluate a postfix (Reverse Polish Notation) expression. Example: "2 3 4 * +" should return 14 because it is 2 + (3 * 4).Approach: Scan left to right. If you see a number, push it. If you see an operator, pop two numbers, apply the operator, and push the result.// PostfixEvaluation.javaimport java.util.Stack;public class PostfixEvaluation { public static int evaluate(String expression) { Stack<Integer> stack = new Stack<>(); String[] tokens = expression.split(" "); for (String token : tokens) { // If it's a number, push it if (token.matches("-?\\d+")) { stack.push(Integer.parseInt(token)); } // If it's an operator, pop two and apply else { int b = stack.pop(); // second operand int a = stack.pop(); // first operand switch (token) { case "+": stack.push(a + b); break; case "-": stack.push(a - b); break; case "*": stack.push(a * b); break; case "/": stack.push(a / b); break; } } } return stack.pop(); } public static void main(String[] args) { System.out.println(evaluate("2 3 4 * +")); // 14 → 2 + (3*4) System.out.println(evaluate("5 1 2 + 4 * + 3 -")); // 14 → 5+((1+2)*4)-3 System.out.println(evaluate("3 4 +")); // 7 }}Problem 5 — Next Greater ElementDifficulty: MediumProblem: For each element in an array, find the next greater element to its right. If none exists, output -1.Example: Input: [4, 5, 2, 10, 8] → Output: [5, 10, 10, -1, -1]Approach: Iterate right to left. Maintain a stack of candidates. For each element, pop all stack elements that are smaller than or equal to it — they can never be the answer for any element to the left. The top of the stack (if not empty) is the next greater element.// NextGreaterElement.javaimport java.util.Stack;import java.util.Arrays;public class NextGreaterElement { public static int[] nextGreater(int[] arr) { int n = arr.length; int[] result = new int[n]; Stack<Integer> stack = new Stack<>(); // stores elements, not indices // Traverse from right to left for (int i = n - 1; i >= 0; i--) { // Pop elements smaller than or equal to current while (!stack.isEmpty() && stack.peek() <= arr[i]) { stack.pop(); } // Next greater element result[i] = stack.isEmpty() ? -1 : stack.peek(); // Push current element for future comparisons stack.push(arr[i]); } return result; } public static void main(String[] args) { int[] arr1 = {4, 5, 2, 10, 8}; System.out.println(Arrays.toString(nextGreater(arr1))); // [5, 10, 10, -1, -1] int[] arr2 = {1, 3, 2, 4}; System.out.println(Arrays.toString(nextGreater(arr2))); // [3, 4, 4, -1] int[] arr3 = {5, 4, 3, 2, 1}; System.out.println(Arrays.toString(nextGreater(arr3))); // [-1, -1, -1, -1, -1] }}Problem 6 — Sort a Stack Using RecursionDifficulty: HardProblem: Sort a stack in ascending order (smallest on top) using only recursion — no loops, no extra data structure.// SortStack.javaimport java.util.Stack;public class SortStack { // Insert element in correct sorted position public static void sortedInsert(Stack<Integer> stack, int item) { if (stack.isEmpty() || item > stack.peek()) { stack.push(item); return; } int top = stack.pop(); sortedInsert(stack, item); stack.push(top); } // Sort the stack public static void sortStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); sortStack(stack); // sort remaining sortedInsert(stack, top); // insert top in sorted position } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(34); stack.push(3); stack.push(31); stack.push(98); stack.push(92); stack.push(23); System.out.println("Before sort: " + stack); sortStack(stack); System.out.println("After sort: " + stack); // smallest on top }}13. Summary & Key TakeawaysA stack is a simple, elegant, and powerful data structure. Here is everything in one place:What it is: A linear data structure that follows LIFO — Last In, First Out.Core operations: push (add to top), pop (remove from top), peek (view top), isEmpty — all in O(1) time.Three ways to implement it in Java:Array-based: fast, fixed size, risk of overflowArrayList-based: dynamic, easy, slightly more overheadLinkedList-based: truly dynamic, memory-efficient per-element, best for unknown sizesWhen to use it:Undo/redo systemsBrowser navigationBalancing brackets and parenthesesEvaluating mathematical expressionsBacktracking problemsManaging recursive function callsDepth-first searchWhen NOT to use it:When you need random access to elementsWhen insertion/deletion is needed from both ends (use Deque)When you need to search efficiently (use HashMap or BST)Modern Java recommendation: Prefer ArrayDeque over the legacy Stack class for non-thread-safe scenarios. Use Stack only when you need synchronized access.The stack is one of those data structures that once you truly understand, you start seeing it everywhere — in your browser, in your IDE, in recursive algorithms, and deep within the operating system itself.This article covered everything from the fundamentals of the Stack data structure to multiple Java implementations, time complexity analysis, real-world applications, and six practice problems of increasing difficulty. Bookmark it as a reference and revisit the practice problems regularly — they are the real test of your understanding.

DataStructuresJavaStackDataStructureLIFO
Queue Data Structure Complete Guide - Java Explained With All Operations

Queue Data Structure Complete Guide - Java Explained With All Operations

IntroductionIf you have been learning Data Structures and Algorithms, you have probably already spent time with arrays, linked lists, and stacks. Now it is time to meet one of the most important and widely used data structures in computer science — the Queue.Queue is not just a theoretical concept. It powers some of the most critical systems you use every day — from how your printer handles jobs, to how your CPU schedules tasks, to how Google Maps finds the shortest path between two locations. Understanding Queue deeply means understanding how real systems work.In this complete guide we will cover absolutely everything — what a Queue is, how it differs from a Stack, every type of Queue, all operations with code, Java implementations, time and space complexity, common interview questions, and the most important LeetCode problems that use Queue.What Is a Queue?A Queue is a linear data structure that follows the FIFO principle — First In First Out. This means the element that was added first is the one that gets removed first.Think of it exactly like a real-world queue (a line of people). The person who joined the line first gets served first. No cutting in line, no serving from the back — strict order from front to back.This is the fundamental difference between a Queue and a Stack:Stack → LIFO (Last In First Out) — like a stack of plates, you take from the topQueue → FIFO (First In First Out) — like a line of people, you serve from the frontReal Life Examples of QueueBefore writing a single line of code, let us understand where queues appear in real life. This will make every technical concept feel natural.Printer Queue — when you send multiple documents to print, they print in the order they were sent. The first document sent prints first.CPU Task Scheduling — your operating system manages running processes in a queue. Tasks get CPU time in the order they arrive (in basic scheduling).Customer Service Call Center — when you call a helpline and are put on hold, you are placed in a queue. The first caller on hold gets connected first.WhatsApp Messages — messages are delivered in the order they are sent. The first message sent is the first one received.BFS (Breadth First Search) — every time you use Google Maps or any navigation app to find the shortest path, it uses BFS internally which is entirely powered by a Queue.Ticket Booking Systems — online booking portals process requests in the order they arrive. First come first served.Queue Terminology — Key Terms You Must KnowBefore diving into code, let us get the vocabulary right:Front — the end from which elements are removed (dequeued). This is where the "first person in line" stands.Rear (or Back) — the end at which elements are added (enqueued). New arrivals join here.Enqueue — the operation of adding an element to the rear of the queue. Like joining the back of a line.Dequeue — the operation of removing an element from the front of the queue. Like the first person in line being served and leaving.Peek (or Front) — looking at the front element without removing it. Like seeing who is first in line without serving them yet.isEmpty — checking whether the queue has no elements.isFull — relevant for fixed-size queues, checking whether no more elements can be added.Types of QueuesThis is where most beginners get confused. There is not just one type of Queue — there are several variations each designed to solve specific problems.1. Simple Queue (Linear Queue)The most basic form. Elements enter from the rear and leave from the front. Strict FIFO, nothing fancy.Enqueue → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue rear frontProblem with Simple Queue: In array-based implementation, once elements are dequeued from the front, those slots cannot be reused even if there is space. This wastes memory. This is why Circular Queue was invented.2. Circular QueueIn a Circular Queue, the rear wraps around to the front when it reaches the end of the array. The last position connects back to the first, forming a circle. This solves the wasted space problem of simple queues. [1] [2] [3] / \ [6] [4] \ / [5] ← rearUsed in: CPU scheduling, memory management, traffic light systems, streaming buffers.3. Double Ended Queue (Deque)A Deque (pronounced "deck") allows insertion and deletion from both ends — front and rear. It is the most flexible queue type.Enqueue Front → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue FrontEnqueue Rear → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue RearTwo subtypes:Input Restricted Deque — insertion only at rear, deletion from both endsOutput Restricted Deque — deletion only at front, insertion at both endsUsed in: browser history (back and forward), undo-redo operations, sliding window problems.4. Priority QueueElements are not served in FIFO order — instead each element has a priority and the element with the highest priority is served first regardless of when it was added.Think of an emergency room. A patient with a critical injury jumps ahead of someone with a minor cut even if they arrived later.Two types:Max Priority Queue — highest value = highest priorityMin Priority Queue — lowest value = highest priorityUsed in: Dijkstra's shortest path, Huffman encoding, A* search algorithm, task scheduling with priorities.5. Blocking QueueA thread-safe queue used in multi-threading. If the queue is empty, a thread trying to dequeue will wait (block) until an element is available. If the queue is full, a thread trying to enqueue will wait until space is available.Used in: Producer-Consumer problems, thread pool implementations, Java's java.util.concurrent package.Queue Operations and Time ComplexityEvery queue operation has a specific time complexity that you must know cold for interviews.OperationDescriptionTime ComplexityEnqueueAdd element to rearO(1)DequeueRemove element from frontO(1)Peek/FrontView front elementO(1)isEmptyCheck if queue is emptyO(1)SizeNumber of elementsO(1)SearchFind a specific elementO(n)Space Complexity: O(n) — where n is the number of elements stored.All core queue operations are O(1). This is what makes Queue so powerful — no matter how many elements are in the queue, adding and removing always takes constant time.Implementing Queue in Java — All WaysJava gives you multiple ways to use a Queue. Let us go through each one.Way 1: Using LinkedList (Most Common)LinkedList implements the Queue interface in Java. This is the most commonly used Queue implementation.import java.util.LinkedList;import java.util.Queue;Queue<Integer> queue = new LinkedList<>();// Enqueue — add to rearqueue.offer(10);queue.offer(20);queue.offer(30);// Peek — view front without removingSystem.out.println(queue.peek()); // 10// Dequeue — remove from frontSystem.out.println(queue.poll()); // 10System.out.println(queue.poll()); // 20// Check emptySystem.out.println(queue.isEmpty()); // false// SizeSystem.out.println(queue.size()); // 1offer() vs add() — both add to the queue. add() throws an exception if the queue is full (for bounded queues). offer() returns false instead. Always prefer offer().poll() vs remove() — both remove from front. remove() throws an exception if queue is empty. poll() returns null. Always prefer poll().peek() vs element() — both view the front. element() throws exception if empty. peek() returns null. Always prefer peek().Way 2: Using ArrayDeque (Fastest)ArrayDeque is faster than LinkedList for Queue operations because it uses a resizable array internally with no node allocation overhead.import java.util.ArrayDeque;import java.util.Queue;Queue<Integer> queue = new ArrayDeque<>();queue.offer(1);queue.offer(2);queue.offer(3);System.out.println(queue.peek()); // 1System.out.println(queue.poll()); // 1System.out.println(queue.size()); // 2When to use ArrayDeque over LinkedList? Use ArrayDeque whenever possible for Queue or Stack operations. It is faster because it avoids the overhead of node objects that LinkedList creates for every element. In competitive programming and interviews, ArrayDeque is the preferred choice.Way 3: Using Deque (Double Ended Queue)import java.util.ArrayDeque;import java.util.Deque;Deque<Integer> deque = new ArrayDeque<>();// Add to frontdeque.offerFirst(10);// Add to reardeque.offerLast(20);deque.offerLast(30);// Remove from frontSystem.out.println(deque.pollFirst()); // 10// Remove from rearSystem.out.println(deque.pollLast()); // 30// Peek front and rearSystem.out.println(deque.peekFirst()); // 20System.out.println(deque.peekLast()); // 20Way 4: Using PriorityQueueimport java.util.PriorityQueue;// Min Heap — smallest element has highest priorityPriorityQueue<Integer> minPQ = new PriorityQueue<>();minPQ.offer(30);minPQ.offer(10);minPQ.offer(20);System.out.println(minPQ.poll()); // 10 — smallest comes out first// Max Heap — largest element has highest priorityPriorityQueue<Integer> maxPQ = new PriorityQueue<>((a, b) -> b - a);maxPQ.offer(30);maxPQ.offer(10);maxPQ.offer(20);System.out.println(maxPQ.poll()); // 30 — largest comes out firstWay 5: Implementing Queue From Scratch Using ArrayUnderstanding the underlying implementation helps you in interviews when asked to build one from scratch.class MyQueue { private int[] arr; private int front; private int rear; private int size; private int capacity; public MyQueue(int capacity) { this.capacity = capacity; arr = new int[capacity]; front = 0; rear = -1; size = 0; } public void enqueue(int val) { if (size == capacity) { System.out.println("Queue is full!"); return; } rear = (rear + 1) % capacity; // circular wrapping arr[rear] = val; size++; } public int dequeue() { if (isEmpty()) { System.out.println("Queue is empty!"); return -1; } int val = arr[front]; front = (front + 1) % capacity; // circular wrapping size--; return val; } public int peek() { if (isEmpty()) return -1; return arr[front]; } public boolean isEmpty() { return size == 0; } public int size() { return size; }}Notice the % capacity in enqueue and dequeue — that is what makes it a Circular Queue. Without this, once the rear reaches the end of the array, you cannot add more even if front has moved forward and freed up space.Way 6: Implementing Queue Using Two StacksThis is a very popular interview question — implement a Queue using two stacks. The idea is to use one stack for enqueue and another for dequeue.class QueueUsingTwoStacks { Stack<Integer> s1 = new Stack<>(); // for enqueue Stack<Integer> s2 = new Stack<>(); // for dequeue public void enqueue(int val) { s1.push(val); // always push to s1 } public int dequeue() { if (s2.isEmpty()) { // transfer all elements from s1 to s2 // this reverses the order, giving FIFO behavior while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.pop(); } public int peek() { if (s2.isEmpty()) { while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.peek(); } public boolean isEmpty() { return s1.isEmpty() && s2.isEmpty(); }}Why does this work?When you transfer elements from s1 to s2, the order reverses. The element that was added first to s1 ends up on top of s2 — which means it gets dequeued first. FIFO achieved using two LIFOs!Amortized time complexity: Each element is pushed and popped at most twice (once in s1, once in s2). So dequeue is O(1) amortized even though individual calls might take O(n).This is LeetCode 232 — Implement Queue using Stacks.Queue vs Stack — Side by SideFeatureQueueStackPrincipleFIFO — First In First OutLIFO — Last In First OutInsert atRearTopRemove fromFrontTopReal lifeLine of peopleStack of platesJava classLinkedList, ArrayDequeStack, ArrayDequeMain useBFS, schedulingDFS, backtracking, parsingPeekFront elementTop elementBFS — The Most Important Application of QueueBreadth First Search (BFS) is the single most important algorithm that uses a Queue. Understanding BFS is why Queue matters so much in DSA.BFS explores a graph or tree level by level — all nodes at distance 1 first, then all at distance 2, and so on. A Queue naturally enforces this level-by-level behavior.public void bfs(int start, List<List<Integer>> graph) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[graph.size()]; queue.offer(start); visited[start] = true; while (!queue.isEmpty()) { int node = queue.poll(); // process front node System.out.print(node + " "); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); // add unvisited neighbors to rear } } }}Why Queue and not Stack for BFS? Queue ensures you process all neighbors of a node before going deeper. Stack would take you deep into one path first — that is DFS, not BFS. The FIFO property is what guarantees level-by-level exploration.BFS with Queue is used in:Shortest path in unweighted graphsLevel order traversal of treesFinding connected componentsWord ladder problemsRotten oranges, flood fill, and matrix BFS problemsLevel Order Traversal — BFS on TreesOne of the most common Queue problems in interviews is Level Order Traversal of a binary tree.public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> result = new ArrayList<>(); if (root == null) return result; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); while (!queue.isEmpty()) { int levelSize = queue.size(); // number of nodes at current level List<Integer> level = new ArrayList<>(); for (int i = 0; i < levelSize; i++) { TreeNode node = queue.poll(); level.add(node.val); if (node.left != null) queue.offer(node.left); if (node.right != null) queue.offer(node.right); } result.add(level); } return result;}The key trick here is using queue.size() at the start of each while loop iteration to know exactly how many nodes belong to the current level. Process exactly that many nodes, then move to the next level.This is LeetCode 102 — Binary Tree Level Order Traversal.Sliding Window Maximum — Monotonic DequeOne of the most impressive Queue applications is the Sliding Window Maximum problem using a Monotonic Deque. This is the queue equivalent of the Monotonic Stack pattern you saw in stack problems.The idea — maintain a deque that stores indices of elements in decreasing order. The front always holds the index of the maximum element in the current window.public int[] maxSlidingWindow(int[] nums, int k) { Deque<Integer> deque = new ArrayDeque<>(); // stores indices int[] result = new int[nums.length - k + 1]; int idx = 0; for (int i = 0; i < nums.length; i++) { // remove indices that are out of the current window while (!deque.isEmpty() && deque.peekFirst() < i - k + 1) { deque.pollFirst(); } // remove indices whose values are smaller than current // they can never be the maximum for any future window while (!deque.isEmpty() && nums[deque.peekLast()] < nums[i]) { deque.pollLast(); } deque.offerLast(i); // window is fully formed, record maximum (front of deque) if (i >= k - 1) { result[idx++] = nums[deque.peekFirst()]; } } return result;}This gives O(n) time for what would otherwise be an O(n×k) problem. This is LeetCode 239 — Sliding Window Maximum.Java Queue Interface — Complete Method ReferenceHere is every method you will ever need from Java's Queue and Deque interfaces:Queue Methods:offer(e) — add to rear, returns false if full (preferred over add) poll() — remove from front, returns null if empty (preferred over remove) peek() — view front without removing, returns null if empty (preferred over element) isEmpty() — returns true if no elements size() — returns number of elements contains(o) — returns true if element existsDeque Additional Methods:offerFirst(e) — add to front offerLast(e) — add to rear pollFirst() — remove from front pollLast() — remove from rear peekFirst() — view front peekLast() — view rearPriorityQueue Specific:offer(e) — add with natural ordering or custom comparator poll() — remove element with highest priority peek() — view highest priority element without removingCommon Interview Questions About QueueThese are the questions interviewers ask to test your understanding of queues conceptually — not just coding.Q1. What is the difference between Queue and Stack? Queue is FIFO — elements are removed in the order they were added. Stack is LIFO — the most recently added element is removed first. Queue removes from the front, Stack removes from the top.Q2. Why is ArrayDeque preferred over LinkedList for Queue in Java? ArrayDeque uses a resizable array internally and has better cache locality and no node allocation overhead. LinkedList creates a new node object for every element added, which means more garbage collection pressure. ArrayDeque is faster in practice for most Queue use cases.Q3. When would you use a PriorityQueue instead of a regular Queue? When the order of processing depends on priority rather than arrival order. For example in a hospital, critical patients are treated before minor cases regardless of when they arrived. Or in Dijkstra's algorithm, always processing the shortest known distance first.Q4. How is Queue used in BFS? BFS uses a Queue to explore nodes level by level. The starting node is enqueued first. Each time a node is dequeued, all its unvisited neighbors are enqueued. Since Queue is FIFO, all neighbors of a node are processed before going deeper — guaranteeing level-by-level exploration.Q5. What is the difference between poll() and remove() in Java Queue? Both remove the front element. remove() throws NoSuchElementException if the queue is empty. poll() returns null instead of throwing. Always use poll() for safer code.Q6. Can a Queue have duplicates? Yes. Queue does not have any restriction on duplicate values unlike Sets. The same value can appear multiple times in a Queue.Q7. What is a Blocking Queue and when is it used? A Blocking Queue is a thread-safe Queue used in multi-threaded applications. When a thread tries to dequeue from an empty queue, it blocks (waits) until an element is available. When a thread tries to enqueue into a full queue, it blocks until space is available. Used in Producer-Consumer patterns.Top LeetCode Problems on QueueHere are the most important LeetCode problems that use Queue — organized from beginner to advanced:Beginner Level:232. Implement Queue using Stacks — implement Queue with two stacks, classic interview question225. Implement Stack using Queues — reverse of 232, implement Stack using Queue933. Number of Recent Calls — sliding window with QueueIntermediate Level:102. Binary Tree Level Order Traversal — BFS on tree, must know107. Binary Tree Level Order Traversal II — same but bottom up994. Rotting Oranges — multi-source BFS on grid1091. Shortest Path in Binary Matrix — BFS shortest path542. 01 Matrix — multi-source BFS, distance to nearest 0127. Word Ladder — BFS on word graph, classicAdvanced Level:239. Sliding Window Maximum — monotonic deque, must know862. Shortest Subarray with Sum at Least K — monotonic deque with prefix sums407. Trapping Rain Water II — 3D BFS with priority queue787. Cheapest Flights Within K Stops — BFS with constraintsQueue Cheat Sheet — Everything at a GlanceCreate a Queue:Queue<Integer> q = new LinkedList<>(); // standardQueue<Integer> q = new ArrayDeque<>(); // faster, preferredDeque<Integer> dq = new ArrayDeque<>(); // double endedPriorityQueue<Integer> pq = new PriorityQueue<>(); // min heapPriorityQueue<Integer> pq = new PriorityQueue<>((a,b) -> b-a); // max heapCore Operations:q.offer(x); // enqueueq.poll(); // dequeueq.peek(); // front elementq.isEmpty(); // check emptyq.size(); // number of elementsDeque Operations:dq.offerFirst(x); // add to frontdq.offerLast(x); // add to reardq.pollFirst(); // remove from frontdq.pollLast(); // remove from reardq.peekFirst(); // view frontdq.peekLast(); // view rearBFS Template:Queue<Integer> queue = new LinkedList<>();queue.offer(start);visited[start] = true;while (!queue.isEmpty()) { int node = queue.poll(); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); } }}ConclusionQueue is one of those data structures that appears simple on the surface but has incredible depth once you start exploring its variations and applications. From the basic FIFO concept to Circular Queues, Deques, Priority Queues, Monotonic Deques, and BFS — each layer adds a new tool to your problem-solving arsenal.Here is the learning path to follow based on everything covered in this guide:Start with understanding FIFO vs LIFO and when each applies. Then get comfortable with Java's Queue interface — offer, poll, peek. Practice the BFS template until it feels automatic. Then move to Level Order Traversal problems. Once BFS clicks, tackle multi-source BFS problems like Rotting Oranges. Finally learn the Monotonic Deque pattern for sliding window problems.Master these and you will handle every Queue problem in any coding interview with confidence.

QueueData StructureJavaBFSDequePriority QueueCircular Queue
Recursion in Java - Complete Guide With Examples and Practice Problems

Recursion in Java - Complete Guide With Examples and Practice Problems

IntroductionIf there is one topic in programming that confuses beginners more than anything else, it is recursion. Most people read the definition, nod their head, and then immediately freeze when they have to write recursive code themselves.The problem is not that recursion is genuinely hard. The problem is that most explanations start with code before building the right mental model. Once you have the right mental model, recursion clicks permanently and you start seeing it everywhere — in tree problems, graph problems, backtracking, dynamic programming, divide and conquer, and more.This guide covers everything from the ground up. What recursion is, how the call stack works, how to identify base cases and recursive cases, every type of recursion, common patterns, time and space complexity analysis, the most common mistakes, and the top LeetCode problems to practice.By the end of this article, recursion will not feel like magic anymore. It will feel like a natural tool you reach for confidently.What Is Recursion?Recursion is when a function calls itself to solve a smaller version of the same problem.That is the complete definition. But let us make it concrete.Imagine you want to count down from 5 to 1. One way is a loop. Another way is — print 5, then solve the exact same problem for counting down from 4 to 1. Then print 4, solve for 3. And so on until you reach the base — there is nothing left to count down.void countDown(int n) { if (n == 0) return; // stop here System.out.println(n); countDown(n - 1); // solve the smaller version}The function countDown calls itself with a smaller input each time. Eventually it reaches 0 and stops. That stopping condition is the most important part of any recursive function — the base case.The Two Parts Every Recursive Function Must HaveEvery correctly written recursive function has exactly two parts. Without both, the function either gives wrong answers or runs forever.Part 1: Base CaseThe base case is the condition under which the function stops calling itself and returns a direct answer. It is the smallest version of the problem that you can solve without any further recursion.Without a base case, recursion never stops and you get a StackOverflowError — Java's way of telling you the call stack ran out of memory.Part 2: Recursive CaseThe recursive case is where the function calls itself with a smaller or simpler input — moving closer to the base case with each call. If your recursive case does not make the problem smaller, you have an infinite loop.Think of it like a staircase. The base case is the ground floor. The recursive case is each step going down. Every step must genuinely bring you one level closer to the ground.How Recursion Works — The Call StackThis is the mental model that most explanations skip, and it is the reason recursion confuses people.Every time a function is called in Java, a new stack frame is created and pushed onto the call stack. This frame stores the function's local variables, parameters, and where to return to when the function finishes.When a recursive function calls itself, a new frame is pushed on top. When that call finishes, its frame is popped and execution returns to the previous frame.Let us trace countDown(3) through the call stack:countDown(3) called → frame pushed prints 3 calls countDown(2) → frame pushed prints 2 calls countDown(1) → frame pushed prints 1 calls countDown(0) → frame pushed n == 0, return → frame popped back in countDown(1), return → frame popped back in countDown(2), return → frame popped back in countDown(3), return → frame poppedOutput: 3, 2, 1The call stack grows as calls go deeper, then shrinks as calls return. This is why recursion uses O(n) space for n levels deep — each level occupies one stack frame in memory.Your First Real Recursive Function — FactorialFactorial is the classic first recursion example. n! = n × (n-1) × (n-2) × ... × 1Notice the pattern — n! = n × (n-1)!. The factorial of n is n times the factorial of n-1. That recursive structure makes it perfect for recursion.public int factorial(int n) { // base case if (n == 0 || n == 1) return 1; // recursive case return n * factorial(n - 1);}Dry Run — factorial(4)factorial(4)= 4 * factorial(3)= 4 * 3 * factorial(2)= 4 * 3 * 2 * factorial(1)= 4 * 3 * 2 * 1= 24The call stack builds up going in, then multiplications happen coming back out. This "coming back out" phase is called the return phase or unwinding of the stack.Time Complexity: O(n) — n recursive calls Space Complexity: O(n) — n frames on the call stackThe Two Phases of RecursionEvery recursive function has two phases and understanding both is critical.Phase 1: The Call Phase (Going In)This happens as the function keeps calling itself with smaller inputs. Things you do before the recursive call happen in this phase — in order from the outermost call to the innermost.Phase 2: The Return Phase (Coming Back Out)This happens as each call finishes and returns to its caller. Things you do after the recursive call happen in this phase — in reverse order, from the innermost call back to the outermost.This distinction explains why the output order can be surprising:void printBothPhases(int n) { if (n == 0) return; System.out.println("Going in: " + n); // call phase printBothPhases(n - 1); System.out.println("Coming out: " + n); // return phase}For printBothPhases(3):Going in: 3Going in: 2Going in: 1Coming out: 1Coming out: 2Coming out: 3This two-phase understanding is what makes problems like reversing a string or printing a linked list backwards via recursion feel natural.Types of RecursionRecursion is not one-size-fits-all. There are several distinct types and knowing which type applies to a problem shapes how you write the solution.1. Direct RecursionThe function calls itself directly. This is the most common type — what we have seen so far.void direct(int n) { if (n == 0) return; direct(n - 1); // calls itself}2. Indirect RecursionFunction A calls Function B which calls Function A. They form a cycle.void funcA(int n) { if (n <= 0) return; System.out.println("A: " + n); funcB(n - 1);}void funcB(int n) { if (n <= 0) return; System.out.println("B: " + n); funcA(n - 1);}Used in: state machines, mutual recursion in parsers, certain mathematical sequences.3. Tail RecursionThe recursive call is the last operation in the function. Nothing happens after the recursive call returns — no multiplication, no addition, nothing.// NOT tail recursive — multiplication happens after returnint factorial(int n) { if (n == 1) return 1; return n * factorial(n - 1); // multiply after return — not tail}// Tail recursive — recursive call is the last thingint factorialTail(int n, int accumulator) { if (n == 1) return accumulator; return factorialTail(n - 1, n * accumulator); // last operation}Why does tail recursion matter? In languages that support tail call optimization (like Scala, Kotlin, and many functional languages), tail recursive functions can be converted to iteration internally — no stack frame accumulation, O(1) space. Java does NOT perform tail call optimization, but understanding tail recursion is still important for interviews and functional programming concepts.4. Head RecursionThe recursive call happens first, before any other processing. All processing happens in the return phase.void headRecursion(int n) { if (n == 0) return; headRecursion(n - 1); // call first System.out.println(n); // process after}// Output: 1 2 3 4 5 (processes in reverse order of calls)5. Tree RecursionThe function makes more than one recursive call per invocation. This creates a tree of calls rather than a linear chain. Fibonacci is the classic example.int fibonacci(int n) { if (n <= 1) return n; return fibonacci(n - 1) + fibonacci(n - 2); // TWO recursive calls}The call tree for fibonacci(4): fib(4) / \ fib(3) fib(2) / \ / \ fib(2) fib(1) fib(1) fib(0) / \ fib(1) fib(0)Time Complexity: O(2ⁿ) — exponential! Each call spawns two more. Space Complexity: O(n) — maximum depth of the call treeThis is why memoization (caching results) is so important for tree recursion — it converts O(2ⁿ) to O(n) by never recomputing the same subproblem twice.6. Mutual RecursionA specific form of indirect recursion where two functions call each other alternately to solve a problem. Different from indirect recursion in that the mutual calls are the core mechanism of the solution.// Check if a number is even or odd using mutual recursionboolean isEven(int n) { if (n == 0) return true; return isOdd(n - 1);}boolean isOdd(int n) { if (n == 0) return false; return isEven(n - 1);}Common Recursion Patterns in DSAThese are the patterns you will see over and over in interview problems. Recognizing them is more important than memorizing solutions.Pattern 1: Linear Recursion (Do Something, Recurse on Rest)Process the current element, then recurse on the remaining problem.// Sum of arrayint arraySum(int[] arr, int index) { if (index == arr.length) return 0; // base case return arr[index] + arraySum(arr, index + 1); // current + rest}Pattern 2: Divide and Conquer (Split Into Two Halves)Split the problem into two halves, solve each recursively, combine results.// Merge Sortvoid mergeSort(int[] arr, int left, int right) { if (left >= right) return; // base case — single element int mid = (left + right) / 2; mergeSort(arr, left, mid); // sort left half mergeSort(arr, mid + 1, right); // sort right half merge(arr, left, mid, right); // combine}Pattern 3: Backtracking (Try, Recurse, Undo)Try a choice, recurse to explore it, undo the choice when backtracking.// Generate all subsetsvoid subsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { if (index == nums.length) { result.add(new ArrayList<>(current)); return; } // Choice 1: include nums[index] current.add(nums[index]); subsets(nums, index + 1, current, result); current.remove(current.size() - 1); // undo // Choice 2: exclude nums[index] subsets(nums, index + 1, current, result);}Pattern 4: Tree Recursion (Left, Right, Combine)Recurse on left subtree, recurse on right subtree, combine or process results.// Height of binary treeint height(TreeNode root) { if (root == null) return 0; // base case int leftHeight = height(root.left); // solve left int rightHeight = height(root.right); // solve right return 1 + Math.max(leftHeight, rightHeight); // combine}Pattern 5: Memoization (Cache Recursive Results)Store results of recursive calls so the same subproblem is never solved twice.Map<Integer, Integer> memo = new HashMap<>();int fibonacci(int n) { if (n <= 1) return n; if (memo.containsKey(n)) return memo.get(n); // return cached int result = fibonacci(n - 1) + fibonacci(n - 2); memo.put(n, result); // cache before returning return result;}This converts Fibonacci from O(2ⁿ) to O(n) time with O(n) space — a massive improvement.Recursion vs Iteration — When to Use WhichThis is one of the most common interview questions about recursion. Here is a clear breakdown:Use Recursion when:The problem has a naturally recursive structure (trees, graphs, divide and conquer)The solution is significantly cleaner and easier to understand recursivelyThe problem involves exploring multiple paths or choices (backtracking)The depth of recursion is manageable (not too deep to cause stack overflow)Use Iteration when:The problem is linear and a loop is equally clearMemory is a concern (iteration uses O(1) stack space vs O(n) for recursion)Performance is critical and function call overhead mattersJava's stack size limit could be hit (default around 500-1000 frames for deep recursion)The key rule: Every recursive solution can be converted to an iterative one (usually using an explicit stack). But recursive solutions for tree and graph problems are almost always cleaner to write and understand.Time and Space Complexity of Recursive FunctionsAnalyzing complexity for recursive functions requires a specific approach.The Recurrence Relation MethodExpress the time complexity as a recurrence relation and solve it.Factorial:T(n) = T(n-1) + O(1) = T(n-2) + O(1) + O(1) = T(1) + n×O(1) = O(n)Fibonacci (naive):T(n) = T(n-1) + T(n-2) + O(1) ≈ 2×T(n-1) = O(2ⁿ)Binary Search:T(n) = T(n/2) + O(1) = O(log n) [by Master Theorem]Merge Sort:T(n) = 2×T(n/2) + O(n) = O(n log n) [by Master Theorem]Space Complexity Rule for RecursionSpace complexity of a recursive function = maximum depth of the call stack × space per frameLinear recursion (factorial, sum): O(n) spaceBinary recursion (Fibonacci naive): O(n) space (maximum depth, not number of nodes)Divide and conquer (merge sort): O(log n) space (depth of recursion tree)Memoized Fibonacci: O(n) space (memo table + call stack)Classic Recursive Problems With SolutionsProblem 1: Reverse a StringString reverse(String s) { if (s.length() <= 1) return s; // base case // last char + reverse of everything before last char return s.charAt(s.length() - 1) + reverse(s.substring(0, s.length() - 1));}Dry run for "hello":reverse("hello") = 'o' + reverse("hell")reverse("hell") = 'l' + reverse("hel")reverse("hel") = 'l' + reverse("he")reverse("he") = 'e' + reverse("h")reverse("h") = "h"Unwinding: "h" → "he" → "leh" → "lleh" → "olleh" ✅Problem 2: Power Function (x^n)double power(double x, int n) { if (n == 0) return 1; // base case if (n < 0) return 1.0 / power(x, -n); // handle negative if (n % 2 == 0) { double half = power(x, n / 2); return half * half; // x^n = (x^(n/2))^2 } else { return x * power(x, n - 1); }}This is the fast power algorithm — O(log n) time instead of O(n).Problem 3: Fibonacci With Memoizationint[] memo = new int[100];Arrays.fill(memo, -1);int fib(int n) { if (n <= 1) return n; if (memo[n] != -1) return memo[n]; memo[n] = fib(n - 1) + fib(n - 2); return memo[n];}Time: O(n) — each value computed once Space: O(n) — memo array + call stackProblem 4: Tower of HanoiThe classic recursion teaching problem. Move n disks from source to destination using a helper rod.void hanoi(int n, char source, char destination, char helper) { if (n == 1) { System.out.println("Move disk 1 from " + source + " to " + destination); return; } // Move n-1 disks from source to helper hanoi(n - 1, source, helper, destination); // Move the largest disk from source to destination System.out.println("Move disk " + n + " from " + source + " to " + destination); // Move n-1 disks from helper to destination hanoi(n - 1, helper, destination, source);}Time Complexity: O(2ⁿ) — minimum moves required is 2ⁿ - 1 Space Complexity: O(n) — call stack depthProblem 5: Generate All Subsets (Power Set)void generateSubsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { result.add(new ArrayList<>(current)); // add current subset for (int i = index; i < nums.length; i++) { current.add(nums[i]); // include generateSubsets(nums, i + 1, current, result); // recurse current.remove(current.size() - 1); // exclude (backtrack) }}For [1, 2, 3] — generates all 8 subsets: [], [1], [1,2], [1,2,3], [1,3], [2], [2,3], [3]Time: O(2ⁿ) — 2ⁿ subsets Space: O(n) — recursion depthProblem 6: Binary Search Recursivelyint binarySearch(int[] arr, int target, int left, int right) { if (left > right) return -1; // base case — not found int mid = left + (right - left) / 2; if (arr[mid] == target) return mid; else if (arr[mid] < target) return binarySearch(arr, target, mid + 1, right); else return binarySearch(arr, target, left, mid - 1);}Time: O(log n) — halving the search space each time Space: O(log n) — log n frames on the call stackRecursion on Trees — The Natural HabitatTrees are where recursion truly shines. Every tree problem becomes elegant with recursion because a tree is itself a recursive structure — each node's left and right children are trees themselves.// Maximum depth of binary treeint maxDepth(TreeNode root) { if (root == null) return 0; return 1 + Math.max(maxDepth(root.left), maxDepth(root.right));}// Check if tree is symmetricboolean isSymmetric(TreeNode left, TreeNode right) { if (left == null && right == null) return true; if (left == null || right == null) return false; return left.val == right.val && isSymmetric(left.left, right.right) && isSymmetric(left.right, right.left);}// Path sum — does any root-to-leaf path sum to target?boolean hasPathSum(TreeNode root, int target) { if (root == null) return false; if (root.left == null && root.right == null) return root.val == target; return hasPathSum(root.left, target - root.val) || hasPathSum(root.right, target - root.val);}Notice the pattern in all three — base case handles null, recursive case handles left and right subtrees, result combines both.How to Think About Any Recursive Problem — Step by StepThis is the framework you should apply to every new recursive problem you encounter:Step 1 — Identify the base case What is the smallest input where you know the answer directly without any recursion? For arrays it is usually empty array or single element. For trees it is null node. For numbers it is 0 or 1.Step 2 — Trust the recursive call Assume your function already works correctly for smaller inputs. Do not trace through the entire recursion mentally — just trust it. This is the Leap of Faith and it is what makes recursion feel natural.Step 3 — Express the current problem in terms of smaller problems How does the answer for size n relate to the answer for size n-1 (or n/2, or subtrees)? This relationship is your recursive case.Step 4 — Make sure each call moves toward the base case The input must become strictly smaller with each call. If it does not, you have infinite recursion.Step 5 — Write the base case first, then the recursive case Always. Writing the recursive case first leads to bugs because you have not defined when to stop.Common Mistakes and How to Avoid ThemMistake 1: Missing or wrong base case The most common mistake. Missing the base case causes StackOverflowError. Wrong base case causes wrong answers.Always ask — what is the simplest possible input, and what should the function return for it? Write that case first.Mistake 2: Not moving toward the base case If you call factorial(n) inside factorial(n) without reducing n, you loop forever. Every recursive call must make the problem strictly smaller.Mistake 3: Trusting your brain to trace deep recursion Do not try to trace 10 levels of recursion in your head. Trust the recursive call, verify the base case, and check that each call reduces the problem. That is all you need.Mistake 4: Forgetting to return the recursive result// WRONG — result is computed but not returnedint sum(int n) { if (n == 0) return 0; sum(n - 1) + n; // computed but discarded!}// CORRECTint sum(int n) { if (n == 0) return 0; return sum(n - 1) + n;}Mistake 5: Modifying shared state without backtracking In backtracking problems, if you add something to a list before a recursive call, you must remove it after the call returns. Forgetting to backtrack leads to incorrect results and is one of the trickiest bugs to find.Mistake 6: Recomputing the same subproblems Naive Fibonacci computes fib(3) multiple times when computing fib(5). Use memoization whenever you notice overlapping subproblems in your recursion tree.Top LeetCode Problems on RecursionThese are organized by pattern — work through them in this order for maximum learning:Pure Recursion Basics:509. Fibonacci Number — Easy — start here, implement with and without memoization344. Reverse String — Easy — recursion on arrays206. Reverse Linked List — Easy — recursion on linked list50. Pow(x, n) — Medium — fast power with recursionTree Recursion (Most Important):104. Maximum Depth of Binary Tree — Easy — simplest tree recursion112. Path Sum — Easy — decision recursion on tree101. Symmetric Tree — Easy — mutual recursion on tree110. Balanced Binary Tree — Easy — bottom-up recursion236. Lowest Common Ancestor of a Binary Tree — Medium — classic tree recursion124. Binary Tree Maximum Path Sum — Hard — advanced tree recursionDivide and Conquer:148. Sort List — Medium — merge sort on linked list240. Search a 2D Matrix II — Medium — divide and conquerBacktracking:78. Subsets — Medium — generate all subsets46. Permutations — Medium — generate all permutations77. Combinations — Medium — generate combinations79. Word Search — Medium — backtracking on grid51. N-Queens — Hard — classic backtrackingMemoization / Dynamic Programming:70. Climbing Stairs — Easy — Fibonacci variant with memoization322. Coin Change — Medium — recursion with memoization to DP139. Word Break — Medium — memoized recursionRecursion Cheat Sheet// Linear recursion templatereturnType solve(input) { if (baseCase) return directAnswer; // process current return solve(smallerInput);}// Tree recursion templatereturnType solve(TreeNode root) { if (root == null) return baseValue; returnType left = solve(root.left); returnType right = solve(root.right); return combine(left, right, root.val);}// Backtracking templatevoid backtrack(choices, current, result) { if (goalReached) { result.add(copy of current); return; } for (choice : choices) { make(choice); // add to current backtrack(...); // recurse undo(choice); // remove from current }}// Memoization templateMap<Input, Output> memo = new HashMap<>();returnType solve(input) { if (baseCase) return directAnswer; if (memo.containsKey(input)) return memo.get(input); returnType result = solve(smallerInput); memo.put(input, result); return result;}FAQs — People Also AskQ1. What is recursion in Java with a simple example? Recursion is when a function calls itself to solve a smaller version of the same problem. A simple example is factorial — factorial(5) = 5 × factorial(4) = 5 × 4 × factorial(3) and so on until factorial(1) returns 1 directly.Q2. What is the difference between recursion and iteration? Iteration uses loops (for, while) and runs in O(1) space. Recursion uses function calls and uses O(n) stack space for n levels deep. Recursion is often cleaner for tree and graph problems. Iteration is better when memory is a concern or the problem is inherently linear.Q3. What causes StackOverflowError in Java recursion? StackOverflowError happens when recursion goes too deep — too many frames accumulate on the call stack before any of them return. This is caused by missing base case, wrong base case, or input too large for Java's default stack size limit.Q4. What is the difference between recursion and dynamic programming? Recursion solves a problem by breaking it into subproblems. Dynamic programming is recursion plus memoization — storing results of subproblems so they are never computed twice. DP converts exponential recursive solutions into polynomial ones by eliminating redundant computation.Q5. What is tail recursion and does Java support tail call optimization? Tail recursion is when the recursive call is the absolute last operation in the function. Java does NOT support tail call optimization — Java always creates a new stack frame for each call even if it is tail recursive. Languages like Scala and Kotlin (on the JVM) do support it with the tailrec keyword.Q6. How do you convert recursion to iteration? Every recursive solution can be converted to iterative using an explicit stack data structure. The call stack's behavior is replicated manually — push the initial call, loop while stack is not empty, pop, process, and push sub-calls. Tree traversals are a common example of this conversion.ConclusionRecursion is not magic. It is a systematic way of solving problems by expressing them in terms of smaller versions of themselves. Once you internalize the two parts (base case and recursive case), understand the call stack mentally, and learn to trust the recursive call rather than trace it completely, everything clicks.The learning path from here is clear — start with simple problems like Fibonacci and array sum. Move to tree problems where recursion is most natural. Then tackle backtracking. Finally add memoization to bridge into dynamic programming.Every hour you spend understanding recursion deeply pays dividends across the entire rest of your DSA journey. Trees, graphs, divide and conquer, backtracking, dynamic programming — all of them build on this foundation.

RecursionJavaBase CaseCall StackBacktrackingDynamic Programming
LeetCode 2390: Removing Stars From a String — Java Solution With All Approaches Explained

LeetCode 2390: Removing Stars From a String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 2390 Removing Stars From a String?If you are preparing for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 2390 Removing Stars From a String is a must-solve problem. It tests your understanding of the stack data structure and string manipulation — two of the most frequently tested topics in technical interviews.In this article, we will cover:What the problem is asking in plain English3 different Java approaches (Brute Force, Stack, StringBuilder)Step-by-step dry run with examplesTime and space complexity for each approachCommon mistakes to avoidFAQs that appear in Google's People Also AskLet's dive in!Problem Statement SummaryYou are given a string s containing lowercase letters and stars *. In one operation:Choose any * in the stringRemove the * itself AND the closest non-star character to its leftRepeat until all stars are removed and return the final string.Example:Input: s = "leet**cod*e"Output: "lecoe"Real Life Analogy — Think of It as a Backspace KeyImagine you are typing on a keyboard. Every * acts as your backspace key — it deletes itself and the character just before it.You type "leet" and press backspace twice:Backspace 1 → deletes t → "lee"Backspace 2 → deletes e → "le"That is exactly what this problem simulates! Once you see it this way, the solution becomes very obvious.Approach 1: Brute Force Simulation (Beginner Friendly)IdeaDirectly simulate the process the problem describes:Scan the string from left to rightFind the first *Remove it and the character just before itRepeat until no stars remainJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder(s);int i = 0;while (i < sb.length()) {if (sb.charAt(i) == '*') {sb.deleteCharAt(i); // remove the starif (i > 0) {sb.deleteCharAt(i - 1); // remove closest left characteri--;}} else {i++;}}return sb.toString();}Time and Space ComplexityComplexityValueReasonTimeO(n²)Each deletion shifts all remaining charactersSpaceO(n)StringBuilder storage⚠️ Important WarningThis problem has n up to 100,000. Brute force will get Time Limit Exceeded (TLE) on LeetCode. Use this only to understand the concept, never in production or interviews.Approach 2: Stack Based Solution (Interview Favorite)IdeaA stack is the perfect data structure here because:We always remove the most recently added letter when a * appearsThat is the definition of Last In First Out (LIFO) — exactly what a stack doesAlgorithm:Letter → push onto stack* → pop from stack (removes closest left character)At the end, build result from stack contentsJava Codepublic String removeStars(String s) {Stack<Character> st = new Stack<>();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (!st.empty()) {st.pop();}} else {st.push(c);}}StringBuilder sb = new StringBuilder();while (!st.empty()) {sb.append(st.pop());}return sb.reverse().toString();}Step-by-Step Dry Run — "leet**cod*e"StepCharacterActionStack State1lpush[l]2epush[l,e]3epush[l,e,e]4tpush[l,e,e,t]5*pop t[l,e,e]6*pop e[l,e]7cpush[l,e,c]8opush[l,e,c,o]9dpush[l,e,c,o,d]10*pop d[l,e,c,o]11epush[l,e,c,o,e]✅ Final Answer: "lecoe"Time and Space ComplexityComplexityValueReasonTimeO(n)Single pass through the stringSpaceO(n)Stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅IdeaThis is the best and most optimized approach. A StringBuilder can act as a stack:append(c) → works like pushdeleteCharAt(sb.length() - 1) → works like popNo reverse needed at the end unlike the Stack approachJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (sb.length() > 0) {sb.deleteCharAt(sb.length() - 1);}} else {sb.append(c);}}return sb.toString();}Step-by-Step Dry Run — "erase*****"StepCharacterActionStringBuilder1eappend"e"2rappend"er"3aappend"era"4sappend"eras"5eappend"erase"6*delete last"eras"7*delete last"era"8*delete last"er"9*delete last"e"10*delete last""✅ Final Answer: ""Why StringBuilder Beats Stack in JavaFactorStack<Character>StringBuilderMemoryBoxes char → Character objectWorks on primitives directlyReverse neededYesNoCode lengthMore verboseCleaner and shorterPerformanceSlightly slowerFasterTime and Space ComplexityComplexityValueReasonTimeO(n)One pass, each character processed onceSpaceO(n)StringBuilder storageAll Approaches Comparison TableApproachTimeSpacePasses LeetCode?Best ForBrute ForceO(n²)O(n)❌ TLEUnderstanding conceptStackO(n)O(n)✅ YesInterview explanationStringBuilderO(n)O(n)✅ YesBest solutionHow This Relates to LeetCode 3174 Clear DigitsIf you have already solved LeetCode 3174 Clear Digits, you will notice this problem is nearly identical:Feature3174 Clear Digits2390 Removing StarsTriggerDigit 0-9Star *RemovesClosest left non-digitClosest left non-starDifficultyEasyMediumBest approachStringBuilderStringBuilderThe exact same solution pattern works for both. This is why learning patterns matters more than memorizing individual solutions!Common Mistakes to Avoid1. Not checking sb.length() > 0 before deleting Even though the problem guarantees valid input, always add this guard. It shows clean, defensive coding in interviews.2. Forgetting to reverse when using Stack Stack gives you characters in reverse order. If you forget .reverse(), your answer will be backwards.3. Using Brute Force for large inputs With n up to 100,000, O(n²) will time out. Always use the O(n) approach.FAQs — People Also AskQ1. What data structure is best for LeetCode 2390? A Stack or StringBuilder used as a stack is the best data structure. Both give O(n) time complexity. StringBuilder is slightly more optimal in Java because it avoids object boxing overhead.Q2. Why does a star remove the closest left character? Because the problem defines it that way — think of * as a backspace key on a keyboard. It always deletes the character immediately before the cursor position.Q3. What is the time complexity of LeetCode 2390? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 2390 asked in Google interviews? Yes, this type of stack simulation problem is commonly asked at Google, Amazon, Microsoft, and Meta interviews as it tests understanding of LIFO operations and string manipulation.Q5. What is the difference between LeetCode 2390 and LeetCode 844? Both use the same backspace simulation pattern. In 844 Backspace String Compare, # is the backspace character and you compare two strings. In 2390, * is the backspace and you return the final string.Similar LeetCode Problems to Practice NextProblemDifficultyPattern844. Backspace String CompareEasyStack simulation1047. Remove All Adjacent Duplicates In StringEasyStack simulation3174. Clear DigitsEasyStack simulation20. Valid ParenthesesEasyClassic stack735. Asteroid CollisionMediumStack simulationConclusionLeetCode 2390 Removing Stars From a String is a classic stack simulation problem that every developer preparing for coding interviews should master. The key insight is recognizing that * behaves exactly like a backspace key, which makes a stack or StringBuilder the perfect tool.Quick Recap:Brute force works conceptually but TLEs on large inputsStack solution is clean and great for explaining in interviewsStringBuilder solution is the most optimal in Java — no boxing, no reversal

StringStackMediumLeetCode
LeetCode 682 Baseball Game - Java Solution Explained

LeetCode 682 Baseball Game - Java Solution Explained

IntroductionLeetCode 682 Baseball Game is one of the cleanest and most beginner-friendly stack simulation problems on LeetCode. It does not require any fancy algorithm or deep insight — it purely tests whether you can carefully read the rules and simulate them faithfully using the right data structure.But do not let "Easy" fool you. This problem is a great place to practice thinking about which data structure fits best and why. We will solve it three different ways — Stack, ArrayList, and Deque — so you can see the tradeoffs and pick the one that makes most sense to you.You can find the problem here — LeetCode 682 Baseball Game.What Is the Problem Really Asking?You are keeping score for a baseball game with four special rules. You process a list of operations one by one and maintain a record of scores. At the end, return the total sum of all scores in the record.The four operations are:A number (like "5" or "-2") — just add that number as a new score to the record."C" — the last score was invalid, remove it from the record."D" — add a new score that is double the most recent score."+" — add a new score that is the sum of the two most recent scores.That is it. Four rules, simulate them in order, sum up what is left.Real Life Analogy — A Scoreboard With CorrectionsImagine a scoreboard operator at a sports event. They write scores on a whiteboard as the game progresses:A player scores 5 points → write 5Another player scores 2 → write 2Referee says last score was invalid → erase the last number (C)Special bonus rule kicks in → double the last valid score (D)Two scores combine → add the last two scores as one entry (+)At the end, add up everything on the whiteboard. The stack is your whiteboard — you write on top and erase from the top.Why Stack Is the Natural FitAll four operations only ever look at or modify the most recently added scores. C removes the last one. D doubles the last one. + uses the last two. This "most recent first" access pattern is the definition of LIFO — Last In First Out — which is exactly what a Stack provides.Any time a problem says "the previous score" or "the last two scores," your brain should immediately think Stack.Approach 1: Stack (Your Solution) ✅The IdeaUse a Stack of integers. For each operation:Number → parse and pushC → pop the topD → peek the top, push doubled value+ → pop top two, push both back, push their sumpublic int calPoints(String[] operations) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < operations.length; i++) { String op = operations[i]; if (op.equals("C")) { st.pop(); // remove last score } else if (op.equals("D")) { st.push(st.peek() * 2); // double of last score } else if (op.equals("+")) { int prev1 = st.pop(); // most recent score int prev2 = st.pop(); // second most recent score int sum = prev1 + prev2; st.push(prev2); // put them back st.push(prev1); st.push(sum); // push the new score } else { st.push(Integer.parseInt(op)); // regular number } } // sum all remaining scores int total = 0; while (!st.empty()) { total += st.pop(); } return total;}One small improvement over your original solution — using op.equals("C") instead of op.charAt(0) == 'C'. This is cleaner and handles edge cases better since negative numbers like "-2" also start with - not a digit, so charAt(0) comparisons can get tricky. Using equals is always safer for string operations.Why the + Operation Needs Pop-Push-PopThe trickiest part is the + operation. You need the two most recent scores. Stack only lets you see the top. So you pop the first, then the second, compute the sum, then push both back before pushing the sum. This restores the record correctly — the previous two scores stay, and the new sum score is added on top.Detailed Dry Run — ops = ["5","2","C","D","+"]Let us trace every step carefully:"5" → number, parse and push Stack: [5]"2" → number, parse and push Stack: [5, 2]"C" → remove last score, pop Stack: [5]"D" → double last score, peek=5, push 10 Stack: [5, 10]"+" → sum of last two:pop prev1 = 10pop prev2 = 5sum = 15push prev2=5, push prev1=10, push sum=15 Stack: [5, 10, 15]Sum all: 5 + 10 + 15 = 30 ✅Detailed Dry Run — ops = ["5","-2","4","C","D","9","+","+"]"5" → push 5. Stack: [5]"-2" → push -2. Stack: [5, -2]"4" → push 4. Stack: [5, -2, 4]"C" → pop 4. Stack: [5, -2]"D" → peek=-2, push -4. Stack: [5, -2, -4]"9" → push 9. Stack: [5, -2, -4, 9]"+" → prev1=9, prev2=-4, sum=5. Push -4, 9, 5. Stack: [5, -2, -4, 9, 5]"+" → prev1=5, prev2=9, sum=14. Push 9, 5, 14. Stack: [5, -2, -4, 9, 5, 14]Sum: 5 + (-2) + (-4) + 9 + 5 + 14 = 27 ✅Approach 2: ArrayList (Most Readable)The IdeaArrayList gives you index-based access which makes the + operation much cleaner — no need to pop and push back. Just access the last two elements directly using size()-1 and size()-2.public int calPoints(String[] operations) { ArrayList<Integer> record = new ArrayList<>(); for (String op : operations) { int n = record.size(); if (op.equals("C")) { record.remove(n - 1); // remove last element } else if (op.equals("D")) { record.add(record.get(n - 1) * 2); // double last } else if (op.equals("+")) { // sum of last two — no need to remove and re-add! record.add(record.get(n - 1) + record.get(n - 2)); } else { record.add(Integer.parseInt(op)); } } int total = 0; for (int score : record) { total += score; } return total;}See how the + operation becomes a single line with ArrayList? record.get(n-1) + record.get(n-2) directly accesses the last two elements without any pop-push gymnastics.Dry Run — ops = ["5","2","C","D","+"]"5" → add 5. List: [5]"2" → add 2. List: [5, 2]"C" → remove last. List: [5]"D" → 5×2=10, add 10. List: [5, 10]"+" → get(0)+get(1) = 5+10=15, add 15. List: [5, 10, 15]Sum: 30 ✅Time Complexity: O(n) — single pass through operations Space Complexity: O(n) — ArrayList stores at most n scoresThe one tradeoff — remove(n-1) on an ArrayList is O(1) for the last element (no shifting needed). And get() is O(1). So this is fully O(n) overall and arguably the cleanest solution to read and understand.Approach 3: Deque (ArrayDeque — Fastest in Java)The IdeaArrayDeque is faster than Stack in Java because Stack is synchronized (thread-safe overhead) and ArrayDeque is not. For single-threaded LeetCode problems, ArrayDeque is always the better choice over Stack.public int calPoints(String[] operations) { Deque<Integer> deque = new ArrayDeque<>(); for (String op : operations) { if (op.equals("C")) { deque.pollLast(); // remove last } else if (op.equals("D")) { deque.offerLast(deque.peekLast() * 2); // double last } else if (op.equals("+")) { int prev1 = deque.pollLast(); int prev2 = deque.pollLast(); int sum = prev1 + prev2; deque.offerLast(prev2); // restore deque.offerLast(prev1); // restore deque.offerLast(sum); // new score } else { deque.offerLast(Integer.parseInt(op)); } } int total = 0; for (int score : deque) { total += score; } return total;}The logic is identical to the Stack approach. The only difference is the method names — offerLast instead of push, pollLast instead of pop, peekLast instead of peek.Time Complexity: O(n) Space Complexity: O(n)For iterating a Deque to sum, you can use a for-each loop directly — no need to pop everything out like with Stack.Approach ComparisonApproachTimeSpaceBest ForStackO(n)O(n)Classic interview answer, clear LIFO intentArrayListO(n)O(n)Cleanest code, easiest to readArrayDequeO(n)O(n)Best performance, preferred in productionAll three approaches have identical time and space complexity. The difference is purely in code style and readability. In an interview, any of these is perfectly acceptable. Mention that ArrayDeque is preferred over Stack in Java for performance if you want to impress.Why op.equals() Is Better Than op.charAt(0)Your original solution uses operations[i].charAt(0) == 'C' to check operations. This works but has a subtle risk — the + character check with charAt(0) is fine, but imagine if a future test had a number starting with C or D (it will not in this problem but defensive coding is a good habit). More importantly, "-2".charAt(0) is '-' which is fine, but using equals is semantically clearer — you are comparing the whole string, not just the first character. This shows cleaner coding habits in interviews.Edge Cases to KnowNegative numbers like "-2" Integer.parseInt("-2") handles negatives perfectly. The D operation on -2 gives -4. The + operation works correctly with negatives too. No special handling needed."C" after a "+" that added a score The problem guarantees C always has at least one score to remove. So after + adds a score, a C removes just that one new score — the previous two scores that + used remain intact. This is correct behavior and our solution handles it automatically.All scores removed If all operations are numbers followed by C operations removing every score, the stack ends up empty and the sum is 0. Our while loop handles this correctly — it simply never executes and returns 0.Only one operation A single number like ["5"] → push 5, sum is 5. Works fine.Common Mistakes to AvoidIn the + operation, forgetting to push both numbers back When you pop prev1 and prev2 to compute the sum, you must push them back onto the stack before pushing the sum. If you only push the sum without restoring prev1 and prev2, those scores disappear from the record permanently — which is wrong. The + operation only adds a new score, it does not remove the previous ones.Using charAt(0) comparison for detecting numbers Negative numbers start with -, not a digit. If you check charAt(0) >= '0' && charAt(0) <= '9' to detect numbers, you will miss negatives. The safest approach is to check for C, D, and + explicitly using equals, and fall through to the else for everything else (which covers both positive and negative numbers).Calling st.peek() or st.pop() without checking empty The problem guarantees valid operations — C always has something to remove, + always has two previous scores, D always has one. But in real code and defensive interview solutions, adding empty checks shows good habits even when the constraints guarantee safety.FAQs — People Also AskQ1. Why is Stack a good choice for LeetCode 682 Baseball Game? Because all four operations only access the most recently added scores — the last score for C and D, the last two for +. This "most recent first" access pattern is exactly what LIFO (Last In First Out) provides. Stack's push, pop, and peek all run in O(1) making it perfectly efficient.Q2. What is the time complexity of LeetCode 682? O(n) time where n is the number of operations. Each operation performs a constant number of stack operations (at most 3 pushes/pops for the + case). Space complexity is O(n) for storing scores.Q3. Why does the + operation need to pop and push back in the Stack approach? Stack only gives direct access to the top element. To get the second most recent score, you must pop the first one, peek/pop the second, then push the first one back. The ArrayList approach avoids this by using index-based access directly.Q4. What is the difference between Stack and ArrayDeque in Java for this problem? Both work correctly. ArrayDeque is faster because Stack is a legacy class that extends Vector and is synchronized (thread-safe), adding unnecessary overhead for single-threaded use. ArrayDeque has no synchronization overhead. For LeetCode and interviews, either is acceptable but ArrayDeque is technically better.Q5. Is LeetCode 682 asked in coding interviews? It appears occasionally as a warmup or screening problem. Its main value is testing whether you can carefully simulate rules without making logical errors — a skill that matters in systems programming, game development, and any domain with complex state management.Similar LeetCode Problems to Practice Next71. Simplify Path — Medium — stack simulation with path operations1047. Remove All Adjacent Duplicates In String — Easy — stack simulation735. Asteroid Collision — Medium — stack simulation with conditions150. Evaluate Reverse Polish Notation — Medium — stack with arithmetic operations, very similar pattern227. Basic Calculator II — Medium — stack with operator precedenceConclusionLeetCode 682 Baseball Game is a perfect problem to build confidence with stack simulation. The four operations are clearly defined, the rules are unambiguous, and the stack maps naturally to every operation. Once you understand why pop-push-back is needed for + in the stack approach and how ArrayList simplifies that with index access, you have genuinely understood the tradeoffs between these data structures.If you are newer to stacks, start with the ArrayList solution for clarity. Once that clicks, rewrite it with Stack to understand the LIFO mechanics. Then try ArrayDeque to understand why it is preferred in modern Java code.

LeetCodeJavaStackArrayListDequeEasy
LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

IntroductionIn coding interviews and competitive programming, many problems test how well you can manipulate numbers and arrays together. One such beginner-friendly problem is LeetCode 2553 – Separate the Digits in an Array.In this problem, we are given an integer array, and we need to separate every digit of every number while maintaining the original order.This problem is excellent for practicing:Array traversalDigit extractionReverse processingArrayList usage in JavaThinking about order preservationProblem Link🔗 ProblemLeetCode 2553: Separate the Digits in an ArrayProblem StatementGiven an array of positive integers nums, return an array containing all digits of each integer in the same order they appear.ExampleInput:nums = [13,25,83,77]Output:[1,3,2,5,8,3,7,7]IntuitionThe main challenge is:Extract digits from each numberPreserve the original left-to-right orderNormally, extracting digits using % 10 gives digits in reverse order.Example:83 → 3 → 8So we need a way to restore the correct order.Approach 1 – Using String ConversionIdeaConvert every number into a string and then traverse each character.This is the simplest and most beginner-friendly approach.AlgorithmTraverse every number in the array.Convert the number into a string.Traverse each character of the string.Convert character back to integer.Store digits into ArrayList.Convert ArrayList to array.Java Code – String Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int num : nums) { String str = String.valueOf(num); for (char ch : str.toCharArray()) { list.add(ch - '0'); } } int[] ans = new int[list.size()]; for (int i = 0; i < list.size(); i++) { ans[i] = list.get(i); } return ans; }}Dry Run (String Approach)Input:nums = [13,25]Step 113 → "13"Digits added:1, 3Step 225 → "25"Digits added:2, 5Final Array:[1,3,2,5]Time Complexity & Space ComplexityTime ComplexityO(N × D)Where:N = number of elementsD = number of digitsSpace ComplexityO(N × D)For storing digits.Approach 2 – Mathematical Digit Extraction (Optimal Without String)This is the approach you implemented in your code.Instead of converting numbers into strings, we extract digits mathematically using:digit = num % 10num = num / 10But digits come in reverse order.To fix this:Traverse the original array from back to frontStore extracted digitsReverse the final resultThis avoids string conversion completely.Intuition Behind Reverse TraversalSuppose:nums = [13,25]If we traverse from the end:25 → 5,213 → 3,1Stored list:[5,2,3,1]Now reverse the list:[1,3,2,5]Correct answer achieved.Java Code – Mathematical Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int i = nums.length - 1; i >= 0; i--) { if (nums[i] < 10) { list.add(nums[i]); } else { int val = nums[i]; while (val != 0) { int digit = val % 10; val = val / 10; list.add(digit); } } } int[] ans = new int[list.size()]; int k = 0; for (int i = list.size() - 1; i >= 0; i--) { ans[k++] = list.get(i); } return ans; }}Dry Run (Mathematical Approach)Input:nums = [13,25,83]Traverse from Back83Digits extracted:3, 8List:[3,8]25Digits extracted:5,2List:[3,8,5,2]13Digits extracted:3,1List:[3,8,5,2,3,1]Reverse Final List[1,3,2,5,8,3]Correct answer.Time Complexity Analysis & Space ComplexityTime ComplexityO(N × D)Because every digit is processed once.Space ComplexityO(N × D)For storing final digits.Which Approach is Better?ApproachAdvantagesDisadvantagesString ConversionEasy to understandUses extra string conversionMathematical ExtractionBetter DSA practiceSlightly harder logicInterview PerspectiveIn interviews:Beginners should first explain the string approach.Then discuss optimization using mathematical extraction.Interviewers like when candidates:Understand digit manipulationThink about order preservationCompare multiple approachesCommon Mistakes1. Forgetting Reverse OrderUsing % 10 extracts digits backward.Example:123 → 3,2,1You must reverse later.2. Not Handling Single Digit NumbersSingle digit numbers should directly be added.3. Character Conversion MistakeWrong:list.add(ch);Correct:list.add(ch - '0');Frequently Asked Questions (FAQs)Q1. Why do digits come in reverse order?Because % 10 always extracts the last digit first.Example:123 % 10 = 3Q2. Can we solve this without ArrayList?Yes, but ArrayList makes dynamic storage easier.Q3. Which approach is more optimal?Both have similar complexity.Mathematical extraction avoids string conversion and is preferred in interviews.Q4. Is this problem important for interviews?Yes. It teaches:Number manipulationOrder handlingArray traversalBasic optimization thinkingConclusionLeetCode 2553 is a simple yet valuable beginner problem for understanding:Digit extractionArray handlingReverse traversalOrder preservationYou learned two approaches:String Conversion ApproachMathematical Digit Extraction ApproachThe mathematical solution is especially useful because it strengthens core DSA concepts and improves problem-solving skills for interviews.If you're preparing for coding interviews in Java, this is a great problem to master before moving to harder digit manipulation questions.

ArrayEasyLeetcodeDigit ExtractionJava
LeetCode 1047: Remove All Adjacent Duplicates In String — Java Solution With All Approaches Explained

LeetCode 1047: Remove All Adjacent Duplicates In String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 1047 Remove All Adjacent Duplicates In String?If you are grinding LeetCode for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 1047 Remove All Adjacent Duplicates In String is a problem you cannot skip. It is one of the most elegant examples of the stack simulation pattern and appears frequently as a warmup or follow-up question in technical rounds.In this article we will cover everything you need — plain English explanation, real life analogy, 3 Java approaches with dry runs, complexity analysis, common mistakes, FAQs, and similar problems to practice next.Here is the problem link-: Leetcode 1047 What Is the Problem Really Asking?You are given a string. Keep scanning it and whenever you find two same letters sitting next to each other, remove both of them. After removing, the letters around them might now become adjacent and form a new pair — so you keep doing this until no more adjacent duplicates exist.Example walkthrough for "abbaca":"abbaca" → bb are adjacent duplicates → remove → "aaca""aaca" → aa are adjacent duplicates → remove → "ca""ca" → no adjacent duplicates → done!✅ Output: "ca"Real Life Analogy — Think of Popping BubblesImagine a row of colored bubbles. Whenever two bubbles of the same color are next to each other, they pop and disappear. After they pop, the bubbles on either side might now touch each other — and if they are the same color, they pop too! You keep going until no two same-colored bubbles are touching.That chain reaction is exactly what this problem simulates. And the best tool to handle that chain reaction? A stack.Approach 1: Brute Force (Beginner Friendly)The IdeaScan the string repeatedly. Every time you find two adjacent equal characters, remove them. Keep doing this until a full pass finds nothing to remove.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(s); boolean found = true; while (found) { found = false; for (int i = 0; i < sb.length() - 1; i++) { if (sb.charAt(i) == sb.charAt(i + 1)) { sb.deleteCharAt(i); sb.deleteCharAt(i); found = true; break; } } } return sb.toString();}This is easy to understand but very slow. For each pair found, you restart the entire scan. With n up to 100,000, this will get Time Limit Exceeded on LeetCode. Use it only to build intuition.Time Complexity: O(n²) — repeated passes over the string Space Complexity: O(n) — StringBuilder storageApproach 2: Stack Based Solution (Classic Interview Approach)The IdeaA stack is perfect here because of one key observation — when you remove a pair, the character that was before the pair is now adjacent to the character after the pair. That is a Last In First Out situation, which is exactly what a stack handles naturally.Algorithm:If the current character matches the top of the stack → pop (they cancel each other)Otherwise → push the current character onto the stackAt the end, the stack contains your final answerpublic String removeDuplicates(String s) { Stack<Character> st = new Stack<>(); StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (!st.empty() && c == st.peek()) { st.pop(); // adjacent duplicate found, cancel both } else { st.push(c); } } while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString();}Dry Run — "abbaca"We go character by character and check against the top of the stack:a → stack empty, push → stack: [a]b → top is a, not equal, push → stack: [a, b]b → top is b, equal! pop → stack: [a]a → top is a, equal! pop → stack: []c → stack empty, push → stack: [c]a → top is c, not equal, push → stack: [c, a]Stack remaining: [c, a] → reverse → ✅ "ca"Notice how after removing bb, the two as automatically become adjacent and get caught — the stack handles this chain reaction naturally without any extra logic!Time Complexity: O(n) — single pass through the string Space Complexity: O(n) — stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅The IdeaThis is your own solution and the best one! Instead of using a separate Stack<Character>, we use StringBuilder itself as a stack:sb.append(c) acts as pushsb.deleteCharAt(sb.length() - 1) acts as popsb.charAt(sb.length() - 1) acts as peekNo extra data structure, no boxing of char into Character objects, and no reversal needed at the end. Clean, fast, and minimal.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (sb.length() != 0 && c == sb.charAt(sb.length() - 1)) { sb.deleteCharAt(sb.length() - 1); // adjacent duplicate, remove both } else { sb.append(c); } } return sb.toString();}Dry Run — "azxxzy"a → sb empty, append → "a"z → last char is a, not equal, append → "az"x → last char is z, not equal, append → "azx"x → last char is x, equal! delete → "az"z → last char is z, equal! delete → "a"y → last char is a, not equal, append → "ay"✅ Final Answer: "ay"Again, notice the chain reaction — after xx was removed, z and z became adjacent and got removed too. The StringBuilder handles this perfectly in a single pass!Time Complexity: O(n) — one pass, every character processed exactly once Space Complexity: O(n) — StringBuilder storageWhy StringBuilder Beats Stack in JavaWhen you use Stack<Character> in Java, every char primitive gets auto-boxed into a Character object. That means extra memory allocation for every single character. With StringBuilder, you work directly on the underlying char array — faster and leaner. Plus you skip the reversal step entirely.For an interview, the Stack approach is great for explaining your thought process clearly. But for the final submitted solution, StringBuilder is the way to go.Common Mistakes to AvoidNot checking sb.length() != 0 before peeking If the StringBuilder is empty and you call sb.charAt(sb.length() - 1), you will get a StringIndexOutOfBoundsException. Always guard this check — even if the problem guarantees valid input, it shows clean coding habits.Thinking you need multiple passes Many beginners think you need to scan the string multiple times because of chain reactions. The stack handles chain reactions automatically in a single pass. Trust the process!Forgetting to reverse when using Stack Since a stack gives you characters in reverse order when you pop them, you must call .reverse() at the end. With StringBuilder you do not need this.How This Fits Into the Stack Simulation PatternBy now you might be noticing a theme across multiple problems:LeetCode 3174 Clear Digits — digit acts as backspace, deletes closest left non-digit LeetCode 2390 Removing Stars — star acts as backspace, deletes closest left non-star LeetCode 1047 Remove Adjacent Duplicates — character cancels itself if it matches the top of stackAll three use the exact same StringBuilder-as-stack pattern. The only difference is the condition that triggers a deletion. This is why pattern recognition is the real skill — once you internalize this pattern, you can solve a whole family of problems in minutes.FAQs — People Also AskQ1. What is the best approach for LeetCode 1047 in Java? The StringBuilder approach is the best. It runs in O(n) time, uses O(n) space, requires no extra data structure, and avoids the reversal step needed with a Stack.Q2. Why does a stack work for removing adjacent duplicates? Because whenever you remove a pair, the characters around them become the new neighbors. A stack naturally keeps track of the most recently seen character, so it catches these chain reactions without any extra logic.Q3. What is the time complexity of LeetCode 1047? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 1047 asked in coding interviews? Yes, it is commonly asked as a warmup problem or follow-up at companies like Google, Amazon, and Adobe. It tests your understanding of stack-based string manipulation.Q5. What is the difference between LeetCode 1047 and LeetCode 1209? LeetCode 1047 removes pairs of adjacent duplicates. LeetCode 1209 is the harder version — it removes groups of k adjacent duplicates, requiring you to store counts alongside characters in the stack.Similar LeetCode Problems to Practice Next2390. Removing Stars From a String — Medium — star as backspace3174. Clear Digits — Easy — digit as backspace844. Backspace String Compare — Easy — compare two strings after backspaces1209. Remove All Adjacent Duplicates in String II — Medium — harder version with k duplicates735. Asteroid Collision — Medium — stack simulation with collision logicConclusionLeetCode 1047 Remove All Adjacent Duplicates In String is a beautiful problem that teaches you one of the most powerful and reusable patterns in DSA — stack simulation. The moment you spot that a removal can cause a chain reaction of more removals, you know a stack is your best friend.The StringBuilder solution is clean, optimal, and interview-ready. Master it, understand why it works, and you will be able to tackle the entire family of stack simulation problems with confidence.Found this helpful? Share it with friends preparing for coding interviews

LeetCodeJavaStackStringEasy
LeetCode 1306: Jump Game III – Java DFS & Graph Traversal Solution Explained

LeetCode 1306: Jump Game III – Java DFS & Graph Traversal Solution Explained

IntroductionLeetCode 1306 – Jump Game III is an interesting graph traversal problem that combines:Depth First Search (DFS)Breadth First Search (BFS)RecursionVisited trackingCycle detectionAt first glance, this problem looks like an array problem.But internally, it behaves exactly like a graph traversal problem where:Each index acts like a nodeEach jump acts like an edgeThis problem is commonly asked in coding interviews because it tests:Recursive thinkingGraph traversal intuitionAvoiding infinite loopsState trackingProblem Link🔗 https://leetcode.com/problems/jump-game-iii/Problem StatementYou are given:An array arrA starting index startFrom index i, you can jump:i + arr[i]ori - arr[i]Your goal is to determine whether you can reach any index having value:0ExampleInputarr = [4,2,3,0,3,1,2]start = 5OutputtrueExplanationPossible path:5 → 4 → 1 → 3At index:3Value becomes:0So answer is:trueUnderstanding the ProblemThink of every index as a graph node.From each node:index iwe have two possible edges:i + arr[i]andi - arr[i]The goal is simply:Can we reach any node containing value 0?Brute Force IntuitionA naive recursive solution would:Try both forward and backward jumpsContinue recursivelyStop when we find zeroWhy Brute Force FailsWithout tracking visited indices, recursion may enter infinite loops.Example:1 → 3 → 1 → 3 → 1...This creates cycles.So we must track visited nodes.DFS IntuitionWe perform DFS traversal from the starting index.At every index:Check boundariesCheck if already visitedCheck if value is zeroExplore both possible jumpsKey DFS ObservationEach index should only be visited once.Why?Because revisiting creates cycles and unnecessary computation.So we use:HashSet<Integer> visitedorboolean[] visitedRecursive DFS ApproachSteps1. Boundary CheckIf index goes outside array:return false2. Visited CheckIf already visited:return false3. Found ZeroIf current index contains:0Return:true4. Explore Both DirectionsTry:start + arr[start]andstart - arr[start]Java DFS Solutionclass Solution { public boolean solve(HashSet<Integer> zeroIndexes, HashSet<Integer> visited, int start, int[] arr) { if(start >= arr.length || start < 0) return false; if(visited.contains(start)) return false; visited.add(start); if(zeroIndexes.contains(start)) return true; return solve(zeroIndexes, visited, start + arr[start], arr) || solve(zeroIndexes, visited, start - arr[start], arr); } public boolean canReach(int[] arr, int start) { HashSet<Integer> visited = new HashSet<>(); HashSet<Integer> zeroIndexes = new HashSet<>(); for(int i = 0; i < arr.length; i++) { if(arr[i] == 0) { zeroIndexes.add(i); } } return solve(zeroIndexes, visited, start, arr); }}Simpler Optimized DFS SolutionWe actually do not need a separate set for zero indexes.We can directly check:arr[start] == 0Cleaner Java DFS Solutionclass Solution { public boolean dfs(int[] arr, boolean[] visited, int start) { if(start < 0 || start >= arr.length) return false; if(visited[start]) return false; if(arr[start] == 0) return true; visited[start] = true; return dfs(arr, visited, start + arr[start]) || dfs(arr, visited, start - arr[start]); } public boolean canReach(int[] arr, int start) { return dfs(arr, new boolean[arr.length], start); }}Dry RunInputarr = [4,2,3,0,3,1,2]start = 5Step 1Current index:5Value:1Possible jumps:5 + 1 = 65 - 1 = 4Step 2Visit index:4Value:3Possible jumps:4 + 3 = 7 (invalid)4 - 3 = 1Step 3Visit index:1Value:2Possible jumps:1 + 2 = 31 - 2 = -1 (invalid)Step 4Visit index:3Value:0Return:trueBFS ApproachThis problem can also be solved using BFS.Instead of recursion:Use queueExplore neighbors level by levelJava BFS Solutionclass Solution { public boolean canReach(int[] arr, int start) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[arr.length]; queue.offer(start); while(!queue.isEmpty()) { int index = queue.poll(); if(index < 0 || index >= arr.length) continue; if(visited[index]) continue; if(arr[index] == 0) return true; visited[index] = true; queue.offer(index + arr[index]); queue.offer(index - arr[index]); } return false; }}Time Complexity AnalysisDFS ComplexityTime ComplexityO(N)Each index is visited at most once.Space ComplexityO(N)Due to recursion stack and visited array.BFS ComplexityTime ComplexityO(N)Space ComplexityO(N)DFS vs BFSApproachAdvantagesDisadvantagesDFSSimple recursive logicRecursion stackBFSIterative solutionQueue managementInterview ExplanationIn interviews, explain:This problem behaves like graph traversal where each index acts as a node and jumps act as edges. We use DFS or BFS with visited tracking to avoid infinite cycles.This demonstrates strong graph intuition.Common Mistakes1. Forgetting Visited TrackingThis causes infinite recursion.2. Missing Boundary ChecksAlways check:start < 0 || start >= arr.length3. Revisiting NodesAvoid processing already visited indices.FAQsQ1. Is this an array problem or graph problem?Internally it is a graph traversal problem.Q2. Which is better: DFS or BFS?Both are valid.DFS is usually simpler for this problem.Q3. Why do we need visited tracking?To avoid infinite loops caused by cycles.Q4. Can this be solved greedily?No.Because multiple paths must be explored.ConclusionLeetCode 1306 is an excellent beginner-friendly graph traversal problem.It teaches:DFS traversalBFS traversalCycle detectionRecursive thinkingVisited state managementThe most important insight is:Treat every index as a graph node.Once you understand this idea, many graph and traversal interview problems become much easier.

LeetCodeMediumDFSBFSGraph TraversalJavaRecursion
Merge Sort Algorithm Explained | Java Implementation, Intuition & Complexity

Merge Sort Algorithm Explained | Java Implementation, Intuition & Complexity

IntroductionSorting is one of the most fundamental operations in computer science, and Merge Sort is among the most efficient and widely used sorting algorithms.It follows the Divide and Conquer approach, making it highly scalable and predictable even for large datasets.In this article, we will cover:Intuition behind Merge SortStep-by-step breakdownMultiple approachesJava implementation with commentsTime & space complexity analysis🔗 Problem LinkGeeksforGeeks: Merge SortProblem StatementGiven an array arr[] with starting index l and ending index r, sort the array using the Merge Sort algorithm.ExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]Output:[1, 2, 3, 4, 5, 6, 7, 8, 9, 10]Key InsightMerge Sort works by:Divide → Conquer → CombineDivide the array into two halvesRecursively sort each halfMerge both sorted halvesIntuition (Visual Understanding)For:[4, 1, 3, 9, 7]Step 1: Divide[4, 1, 3] [9, 7][4, 1] [3] [9] [7][4] [1]Step 2: Merge[4] [1] → [1, 4][1, 4] [3] → [1, 3, 4][9] [7] → [7, 9]Step 3: Final Merge[1, 3, 4] + [7, 9] → [1, 3, 4, 7, 9]Approach 1: Recursive Merge Sort (Top-Down)IdeaKeep dividing until single elements remainMerge sorted subarraysJava Codeclass Solution { // Function to merge two sorted halves void merge(int[] arr, int l, int mid, int h) { // Temporary array to store merged result int[] temp = new int[h - l + 1]; int i = l; // pointer for left half int j = mid + 1; // pointer for right half int k = 0; // pointer for temp array // Compare elements from both halves while (i <= mid && j <= h) { if (arr[i] <= arr[j]) { temp[k] = arr[i]; i++; } else { temp[k] = arr[j]; j++; } k++; } // Copy remaining elements from left half while (i <= mid) { temp[k] = arr[i]; i++; k++; } // Copy remaining elements from right half while (j <= h) { temp[k] = arr[j]; j++; k++; } // Copy sorted elements back to original array for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } // Recursive merge sort function void mergeSort(int arr[], int l, int h) { // Base case: single element if (l >= h) return; int mid = l + (h - l) / 2; // Sort left half mergeSort(arr, l, mid); // Sort right half mergeSort(arr, mid + 1, h); // Merge both halves merge(arr, l, mid, h); }}Approach 2: Iterative Merge Sort (Bottom-Up)IdeaStart with subarrays of size 1Merge pairsIncrease size graduallyCodeclass Solution { void merge(int[] arr, int l, int mid, int h) { int[] temp = new int[h - l + 1]; int i = l, j = mid + 1, k = 0; while (i <= mid && j <= h) { if (arr[i] <= arr[j]) temp[k++] = arr[i++]; else temp[k++] = arr[j++]; } while (i <= mid) temp[k++] = arr[i++]; while (j <= h) temp[k++] = arr[j++]; for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } void mergeSort(int[] arr, int n) { for (int size = 1; size < n; size *= 2) { for (int l = 0; l < n - size; l += 2 * size) { int mid = l + size - 1; int h = Math.min(l + 2 * size - 1, n - 1); merge(arr, l, mid, h); } } }}Approach 3: Using Built-in Sorting (For Comparison)Arrays.sort(arr);👉 Internally uses optimized algorithms (TimSort in Java)Complexity AnalysisTime ComplexityCaseComplexityBestO(n log n)AverageO(n log n)WorstO(n log n)Space ComplexityO(n) (extra array for merging)Why Merge Sort is PowerfulStable sorting algorithmWorks efficiently on large datasetsPredictable performanceUsed in external sorting (large files)❌ Why Not Use Bubble/Selection Sort?AlgorithmTime ComplexityBubble SortO(n²)Selection SortO(n²)Merge SortO(n log n) ✅Key TakeawaysMerge Sort uses divide and conquerRecursion splits problem into smaller partsMerging is the key stepAlways O(n log n), regardless of inputWhen to Use Merge SortLarge datasetsLinked lists (very efficient)Stable sorting requiredExternal sortingConclusionMerge Sort is one of the most reliable and efficient sorting algorithms. Understanding its recursive structure and merging process is essential for mastering advanced algorithms.Once you grasp the divide-and-conquer pattern, it becomes easier to solve many complex problems.Frequently Asked Questions (FAQs)1. Is Merge Sort stable?Yes, it maintains the relative order of equal elements.2. Why is extra space required?Because we use a temporary array during merging.3. Can it be done in-place?Not efficiently; standard merge sort requires extra space.

GeekfOfGeeksMediumSortingMerge SortJava
LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

IntroductionIf you are preparing for coding interviews or improving your Data Structures and Algorithms skills, LeetCode 39 Combination Sum is one of the most important backtracking problems to learn. This problem helps you understand how recursion explores multiple possibilities and how combinations are generated efficiently. It is a foundational problem that builds strong problem-solving skills and prepares you for many advanced recursion and backtracking questions.Why Should You Solve This Problem?Combination Sum is not just another coding question — it teaches you how to think recursively and break a complex problem into smaller decisions. By solving it, you learn how to manage recursive paths, avoid duplicate combinations, and build interview-level backtracking intuition. Once you understand this pattern, problems like subsets, permutations, N-Queens, and Sudoku Solver become much easier to approach.LeetCode Problem LinkProblem Name: Combination SumProblem Link: Combination SumProblem StatementGiven an array of distinct integers called candidates and a target integer target, you need to return all unique combinations where the chosen numbers sum to the target.Important rules:You can use the same number unlimited times.Only unique combinations should be returned.Order of combinations does not matter.ExampleExample 1Input:candidates = [2,3,6,7]target = 7Output:[[2,2,3],[7]]Explanation2 + 2 + 3 = 77 itself equals targetUnderstanding the Problem in Simple WordsWe are given some numbers.We need to:Pick numbers from the arrayAdd them togetherReach the target sumUse numbers multiple times if neededAvoid duplicate combinationsThis problem belongs to the Backtracking + Recursion category.Real-Life AnalogyImagine you have coins of different values.You want to make an exact payment.You can reuse coins multiple times.You need to find every possible valid coin combination.This is exactly what Combination Sum does.Intuition Behind the SolutionAt every index, we have two choices:Pick the current numberSkip the current numberSince numbers can be reused unlimited times, when we pick a number, we stay at the same index.This creates a recursion tree.We continue until:Target becomes 0 → valid answerTarget becomes negative → invalid pathArray ends → stop recursionWhy Backtracking Works HereBacktracking helps us:Explore all possible combinationsUndo previous decisionsTry another pathIt is useful whenever we need:All combinationsAll subsetsPath explorationRecursive searchingApproach 1: Backtracking Using Pick and SkipCore IdeaAt every element:Either take itOr move to next elementJava Code (Pick and Skip Method)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] candidates, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == candidates.length) {return;}if (candidates[index] <= target) {current.add(candidates[index]);solve(candidates, index, target - candidates[index], current);current.remove(current.size() - 1);}solve(candidates, index + 1, target, current);}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Approach 2: Backtracking Using Loop (Optimized)This is the cleaner and more optimized version.Your code belongs to this category.Java Code (Loop-Based Backtracking)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == arr.length) {return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Dry Run of the AlgorithmInputcandidates = [2,3,6,7]target = 7Step-by-Step ExecutionStart:solve([2,3,6,7], index=0, target=7, [])Pick 2[2]target = 5Pick 2 again:[2,2]target = 3Pick 2 again:[2,2,2]target = 1No valid choice possible.Backtrack.Try 3[2,2,3]target = 0Valid answer found.Add:[2,2,3]Try 7[7]target = 0Valid answer found.Add:[7]Final Output[[2,2,3],[7]]Recursion Tree Visualization[]/ | | \2 3 6 7/2/2/3Every branch explores a different combination.Time Complexity AnalysisTime ComplexityO(2^Target)More accurately:O(N^(Target/minValue))Where:N = Number of candidatesTarget = Required sumReason:Every number can be picked multiple times.This creates many recursive branches.Space ComplexityO(Target)Reason:Recursion stack stores elements.Maximum recursion depth depends on target.Why We Pass Same Index AgainNotice this line:solve(arr, i, target - arr[i], current);We pass i, not i+1.Why?Because we can reuse the same number unlimited times.If we used i+1, we would move forward and lose repetition.Why Duplicate Combinations Are Not CreatedWe start loop from current index.This guarantees:[2,3]and[3,2]are not both generated.Order remains controlled.Common Mistakes Beginners Make1. Using i+1 Instead of iWrong:solve(arr, i+1, target-arr[i], current)This prevents reuse.2. Forgetting Backtracking StepWrong:current.remove(current.size()-1)Without removing, recursion keeps incorrect values.3. Missing Target == 0 Base CaseThis is where valid answer is stored.Important Interview InsightCombination Sum is a foundational problem.It helps build understanding for:Combination Sum IISubsetsPermutationsN-QueensWord SearchSudoku SolverThis question is frequently asked in coding interviews.Pattern RecognitionUse Backtracking when problem says:Find all combinationsGenerate all subsetsFind all pathsUse recursionExplore possibilitiesOptimized Thinking StrategyWhenever you see:Target sumRepeated selectionMultiple combinationsThink:Backtracking + DFSEdge CasesCase 1candidates = [2]target = 1Output:[]No possible answer.Case 2candidates = [1]target = 3Output:[[1,1,1]]Interview Answer in One Line“We use backtracking to recursively try all candidate numbers while reducing the target and backtrack whenever a path becomes invalid.”Final Java Codeclass Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Key TakeawaysCombination Sum uses Backtracking.Reuse same element by passing same index.Target becomes smaller in recursion.Backtracking removes last element.Very important for interview preparation.Frequently Asked QuestionsIs Combination Sum DP or Backtracking?It is primarily solved using Backtracking.Dynamic Programming can also solve it but recursion is more common.Why is this Medium difficulty?Because:Requires recursion understandingRequires backtracking logicRequires duplicate preventionCan we sort the array?Yes.Sorting can help with pruning.ConclusionLeetCode 39 Combination Sum is one of the best problems to learn recursion and backtracking.Once you understand this pattern, many interview problems become easier.The loop-based recursive solution is clean, optimized, and interview-friendly.If you master this question, you gain strong understanding of recursive decision trees and combination generation.

LeetcodeMediumRecursionBacktrackingJava
LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

IntroductionLeetCode 230 – Kth Smallest Element in a BST is one of the most important Binary Search Tree interview problems.This question is popular because it tests:BST propertiesInorder traversalDFS recursionTree traversal optimizationRecursive state managementUnderstanding this problem properly builds a strong foundation for advanced BST problems.Problem Link🔗 https://leetcode.com/problems/kth-smallest-element-in-a-bst/Problem StatementGiven:Root of a Binary Search TreeInteger kReturn:The kth smallest value in the BSTThe indexing is:1-indexedExample 1Inputroot = [3,1,4,null,2]k = 1Output1ExplanationBST inorder traversal becomes:[1,2,3,4]1st smallest element is:1Example 2Inputroot = [5,3,6,2,4,null,null,1]k = 3Output3Key ObservationThe most important BST property:Inorder Traversal of BST gives sorted orderExample:5/ \3 6/ \2 4/1Inorder traversal:1 → 2 → 3 → 4 → 5 → 6So:kth smallest = kth node in inorder traversalIntuitionWe perform:Left → Root → RightWhile traversing:Keep counting visited nodesWhen count becomes kStore answerNo need to traverse entire tree after finding answer.Brute Force ApproachIdeaStore complete inorder traversal in listReturn:list.get(k - 1)Brute Force Java Solutionclass Solution {public void inorder(TreeNode root, List<Integer> list) {if(root == null) return;inorder(root.left, list);list.add(root.val);inorder(root.right, list);}public int kthSmallest(TreeNode root, int k) {List<Integer> list = new ArrayList<>();inorder(root, list);return list.get(k - 1);}}Complexity of Brute ForceTime ComplexityO(N)Space ComplexityO(N)Extra list storage required.Optimized Recursive ApproachIdeaInstead of storing entire traversal:Maintain counterStop when kth node is reachedThis saves unnecessary storage.Java Solutionclass Solution {int coun = 0;int ans = -1;public void inorder(TreeNode root, int k, List<Integer> lis) {if(root == null) return;inorder(root.left, k, lis);coun++;if(coun == k) {ans = root.val;return;}inorder(root.right, k, lis);}public int kthSmallest(TreeNode root, int k) {List<Integer> lis = new ArrayList<>();inorder(root, k, lis);return ans;}}Cleaner Optimized Versionclass Solution {int count = 0;int answer = -1;public void inorder(TreeNode root, int k) {if(root == null) return;inorder(root.left, k);count++;if(count == k) {answer = root.val;return;}inorder(root.right, k);}public int kthSmallest(TreeNode root, int k) {inorder(root, k);return answer;}}Why This WorksBST inorder traversal always visits nodes in:sorted ascending orderSo:1st visited node = smallest2nd visited node = second smallestkth visited node = kth smallestDry RunInputroot = [5,3,6,2,4,null,null,1]k = 3BST Structure5/ \3 6/ \2 4/1Inorder Traversal1 → 2 → 3 → 4 → 5 → 6Counter ProgressNodeCount112233At count = 3:answer = 3Final Output3Iterative Stack ApproachIdeaUse explicit stack instead of recursion.Iterative Java Solutionclass Solution {public int kthSmallest(TreeNode root, int k) {Stack<TreeNode> stack = new Stack<>();while(true) {while(root != null) {stack.push(root);root = root.left;}root = stack.pop();k--;if(k == 0) {return root.val;}root = root.right;}}}Time Complexity AnalysisOptimized RecursiveTime ComplexityO(H + k)Where:H = tree heightWe visit only required nodesWorst case:O(N)Space ComplexityO(H)Recursive stack space.Iterative ComplexityTime ComplexityO(H + k)Space ComplexityO(H)Stack space.Follow-Up OptimizationProblem Follow-UpWhat if BST changes frequently?Example:Insert operationsDelete operationsFrequent kth smallest queriesAdvanced OptimizationStore:size of subtreeinside every node.This allows:O(log N)kth smallest queries.This concept is used in:Order Statistic TreesAugmented BSTsIndexed TreesInterview ExplanationIn interviews, explain:Inorder traversal of a BST gives nodes in sorted order. Therefore, the kth visited node during inorder traversal is the kth smallest element.This demonstrates:BST understandingDFS recursionTree traversal masteryOptimization thinkingCommon Mistakes1. Forgetting BST PropertyThis solution works because BST inorder traversal is sorted.Not true for normal binary trees.2. Using Extra Array UnnecessarilyOptimized approach avoids storing entire traversal.3. Incorrect Counter PlacementCounter must increase:AFTER left traversalBEFORE right traversal4. Forgetting Early ReturnOnce kth element is found:answer should be stored immediatelyFAQsQ1. Why does inorder traversal work?Because BST inorder traversal produces sorted order.Q2. Can this be solved iteratively?Yes.Using stack-based inorder traversal.Q3. Why is BST important here?Without BST ordering property:kth smallest cannot be determined using inorderQ4. Is this frequently asked?Yes.It is one of the most common BST interview questions.ConclusionLeetCode 230 is an excellent BST problem for mastering:Inorder traversalBST propertiesDFS recursionStack traversalTree optimizationThe core insight is:Inorder traversal of a BST always produces sorted order.Once this concept becomes intuitive, many BST interview problems become much easier.

LeetCodeKth Smallest Element in BSTBinary Search TreeJavaInorder TraversalBSTMedium
LeetCode 110: Balanced Binary Tree – Java Optimized DFS Solution Explained

LeetCode 110: Balanced Binary Tree – Java Optimized DFS Solution Explained

IntroductionLeetCode 110 – Balanced Binary Tree is one of the most important binary tree interview problems.This problem teaches:Tree recursionHeight calculationDepth First Search (DFS)Bottom-up recursionOptimization techniquesIt is frequently asked in coding interviews because it checks whether you can:Traverse trees efficientlyAvoid repeated calculationsCombine recursion with conditionsOptimize brute force tree solutionsThis problem is also a foundation for advanced tree problems like:AVL TreesHeight-balanced treesDiameter of Binary TreeTree DP problemsProblem Link🔗 https://leetcode.com/problems/balanced-binary-tree/Problem StatementGiven the root of a binary tree:Return:trueif the tree is:height-balancedOtherwise return:falseWhat is a Balanced Binary Tree?A binary tree is balanced if:For every node,|height(left subtree) - height(right subtree)| <= 1Meaning:Left and right subtree heights should not differ by more than:1Example 1Inputroot = [3,9,20,null,null,15,7]Tree:3/ \9 20/ \15 7OutputtrueExplanation:Every node satisfies:height difference <= 1Example 2Inputroot = [1,2,2,3,3,null,null,4,4]Tree:1/ \2 2/ \3 3/ \4 4OutputfalseExplanation:Left subtree becomes much deeper than right subtree.Difference becomes greater than:1Key ObservationTo determine if tree is balanced:At every node we need:Height of left subtreeHeight of right subtreeCompare differenceThis naturally becomes a recursive DFS problem.Brute Force ApproachIntuitionFor every node:Calculate left heightCalculate right heightCompare differenceRecursively check childrenBrute Force Java Solutionclass Solution {public int height(TreeNode root) {if(root == null)return 0;return 1 + Math.max(height(root.left), height(root.right));}public boolean isBalanced(TreeNode root) {if(root == null)return true;int left = height(root.left);int right = height(root.right);if(Math.abs(left - right) > 1)return false;return isBalanced(root.left) && isBalanced(root.right);}}Problem with Brute ForceThe height function gets called repeatedly.For every node:Heights are recalculated again and again.This increases complexity significantly.Brute Force ComplexityTime ComplexityO(N²)because height calculation repeats.Space ComplexityO(H)for recursion stack.Optimized DFS ApproachInstead of:Calculating heights separatelyWe can:Calculate height and balance together.Core Optimization IdeaWhile calculating height:If subtree becomes unbalanced:Return negative value immediatelyThis avoids unnecessary computation.Optimized Java Solutionclass Solution {public int solve(TreeNode roo) {if(roo == null)return 0;int left = solve(roo.left);if(left < 0) {return -1;}int right = solve(roo.right);if(right < 0) {return -1;}if(Math.abs(left - right) > 1) {return -1000;}return 1 + Math.max(left, right);}public boolean isBalanced(TreeNode root) {int ans = solve(root);return ans < 0 ? false : true;}}Cleaner Optimized VersionWe can simplify negative returns using:-1consistently.Cleaner Java Solutionclass Solution {public int height(TreeNode root) {if(root == null)return 0;int left = height(root.left);if(left == -1)return -1;int right = height(root.right);if(right == -1)return -1;if(Math.abs(left - right) > 1)return -1;return 1 + Math.max(left, right);}public boolean isBalanced(TreeNode root) {return height(root) != -1;}}Why This WorksAt every node:Recursively calculate left heightRecursively calculate right heightIf difference > 1:Tree is unbalancedPropagate failure upward immediately.Dry RunInput1/ \2 2/ \3 3/ \4 4Step 1Start from leaf nodes:4 → height = 1Step 2Node:3gets:left = 1right = 1Difference:0Balanced.Height:2Step 3At node:2Left height:2Right height:0Difference:2Unbalanced.Return:-1Final ResultTree is:Not balancedReturn:falseTime Complexity AnalysisOptimized DFS SolutionTime ComplexityO(N)because every node is visited once.Space ComplexityO(H)where:H = height of treeWorst case:O(N)for skewed tree.Brute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(H)Optimized DFSO(N)O(H)Interview ExplanationIn interviews, explain:Instead of recalculating heights repeatedly, we combine height calculation and balance checking into a single DFS traversal.This demonstrates:Optimization skillsRecursive DFS understandingBottom-up tree processingCommon Mistakes1. Recalculating Heights RepeatedlyThis causes:O(N²)complexity.2. Forgetting Absolute DifferenceAlways use:Math.abs(left - right)3. Not Handling Null NodesBase case:if(root == null)return 0;is necessary.FAQsQ1. What is a balanced binary tree?A tree where left and right subtree heights differ by at most:1for every node.Q2. Why use DFS?Because height calculation naturally follows recursive depth traversal.Q3. Why return -1?It acts as a signal:Subtree already unbalancedQ4. Is this problem important for interviews?Very important.It is one of the most common tree optimization questions.ConclusionLeetCode 110 is an excellent binary tree optimization problem.It teaches:DFS traversalHeight calculationBottom-up recursionOptimization techniquesThe key insight is:Combine balance checking and height calculation in one DFS traversal.Once you understand this optimization pattern, many advanced tree problems become much easier.

LeetCodeBalanced Binary TreeJavaBinary TreeDFSTree HeightRecursionTree
LeetCode 3488 — Closest Equal Element Queries: A Complete Walkthrough from Brute Force to Optimal

LeetCode 3488 — Closest Equal Element Queries: A Complete Walkthrough from Brute Force to Optimal

If you have been grinding LeetCode lately, you have probably run into problems where your first clean-looking solution times out and forces you to rethink from scratch. LeetCode 3488 is exactly that kind of problem. This article walks through the complete thought process — from the naive approach that got me TLE, to the intuition shift, to the final optimized solution in Java.You can find the original problem here: LeetCode 3488 — Closest Equal Element Queries at Problem LinkUnderstanding the ProblemYou are given a circular array nums and an array of queries. For each query queries[i], you must find the minimum distance between the element at index queries[i] and any other index j such that nums[j] == nums[queries[i]]. If no such other index exists, the answer is -1.The critical detail here is the word circular. The array wraps around, which means the distance between two indices i and j in an array of length n is not simply |i - j|. It is:min( |i - j| , n - |i - j| )You can travel either clockwise or counterclockwise, and you take whichever path is shorter.Breaking Down the ExamplesExample 1nums = [1, 3, 1, 4, 1, 3, 2], queries = [0, 3, 5]For query index 0, the value is 1. Other indices holding 1 are 2 and 4. Circular distances are min(2, 5) = 2 and min(4, 3) = 3. The minimum is 2.For query index 3, the value is 4. It appears nowhere else in the array. Answer is -1.For query index 5, the value is 3. The other 3 sits at index 1. Circular distance is min(4, 3) = 3. Answer is 3.Output: [2, -1, 3]Example 2nums = [1, 2, 3, 4], queries = [0, 1, 2, 3]Every element is unique. Every query returns -1.Output: [-1, -1, -1, -1]First Attempt — Brute ForceMy first instinct was straightforward. For each query, scan the entire array, collect every index that matches the queried value, compute the circular distance to each, and return the minimum. Clean logic, easy to reason about, and dead simple to implement.while (i != queries.length) { int max = Integer.MAX_VALUE; for (int j = 0; j < nums.length; j++) { int target = nums[queries[i]]; if (nums[j] == target && j != queries[i]) { // Linear distance between the two indices int right = Math.abs(j - queries[i]); // Distance going the other direction around the ring int left = nums.length - right; // True circular distance is the shorter of the two int dist = Math.min(right, left); max = Math.min(max, dist); } } lis.add(max == Integer.MAX_VALUE ? -1 : max); i++;}This got TLE immediately, and once you look at the constraints it is obvious why. Both nums.length and queries.length can be up to 10^5. For every query you are scanning every element, giving you O(n × q) time — which in the worst case is 10 billion operations. No judge is going to wait for that.Rethinking the Approach — Where Is the Waste?After the TLE, the question I asked myself was: what work is being repeated unnecessarily?The answer was obvious in hindsight. Every time a query asks about a value like 3, the brute force scans the entire array again looking for every index that holds 3. If ten different queries all ask about value 3, you are doing that scan ten times. You are finding the same indices over and over.The fix is to do that work exactly once, before any query is processed. You precompute a map from each value to all the indices where it appears. Then for every query you simply look up the relevant list and work within it.That observation reduces the precomputation to O(n) — one pass through the array. The question then becomes: once you have that sorted list of indices for a given value, how do you find the closest one to your query index efficiently?The Key Insight — You Only Need Two NeighboursHere is the insight that makes this problem elegant. The index list for any value is sorted in ascending order because you build it by iterating left to right through the array. If your query index sits at position mid inside that sorted list, then by definition every index to the left of mid - 1 is farther away than arr[mid - 1], and every index to the right of mid + 1 is farther away than arr[mid + 1].This means you never need to compare against all duplicates. You only ever need to check the immediate left and right neighbours of your query index within the sorted list.The one subtlety is the circular wrap. Because the array itself is circular, the left neighbour of the very first element in the list is actually the last element in the list, since you can wrap around the ring. This is handled cleanly with modular arithmetic: (mid - 1 + n) % n for the left neighbour and (mid + 1) % n for the right.The Optimized Solution — HashMap + Binary SearchStep 1 — Precompute the index mapIterate through nums once and build a HashMap mapping each value to a list of all indices where it appears. The lists are sorted by construction since you insert indices in order.Step 2 — Binary search to locate the query indexFor a given query at index q, look up the index list for nums[q]. Binary search the list to find the position of q within it. This runs in O(log n) rather than O(n).Step 3 — Check immediate neighbours and compute circular distancesOnce you have the position mid, fetch arr[(mid + 1) % n] and arr[(mid - 1 + n) % n]. For each, compute the circular distance using min(|diff|, totalLength - |diff|). Return the smaller of the two.Full Annotated Java Solutionclass Solution { public List<Integer> solveQueries(int[] nums, int[] queries) { int c = 0; // Precompute: map each value to the sorted list of indices where it appears. // Since we iterate left to right, the list is sorted by construction. HashMap<Integer, List<Integer>> mp = new HashMap<>(); for (int i = 0; i < nums.length; i++) { mp.computeIfAbsent(nums[i], k -> new ArrayList<>()).add(i); } List<Integer> lis = new ArrayList<>(); while (c != queries.length) { // Retrieve the sorted index list for the value at the queried position List<Integer> arr = mp.get(nums[queries[c]]); int n = arr.size(); int i = 0; int j = n - 1; int min = -1; while (i <= j) { int mid = i + (j - i) / 2; if (arr.get(mid) == queries[c]) { // Only one occurrence in the entire array — no duplicate exists if (n == 1) { min = -1; } else { // Circular neighbour to the right within the index list int right = arr.get((mid + 1) % n); // Circular neighbour to the left within the index list int left = arr.get((mid - 1 + n) % n); // Compute circular distance to the right neighbour int d1 = Math.abs(right - queries[c]); int distRight = Math.min(d1, nums.length - d1); // Compute circular distance to the left neighbour int d2 = Math.abs(left - queries[c]); int distLeft = Math.min(d2, nums.length - d2); // The answer is the closer of the two neighbours min = Math.min(distLeft, distRight); } break; } else if (arr.get(mid) > queries[c]) { // Query index is smaller — search the left half j = mid - 1; } else { // Query index is larger — search the right half i = mid + 1; } } lis.add(min); c++; } return lis; }}Complexity AnalysisTime Complexity: O(n log n)Building the HashMap takes O(n). For each of the q queries, binary search over the index list takes O(log n) in the worst case. Total: O(n + q log n), which simplifies to O(n log n) given the constraint that q ≤ n.Space Complexity: O(n)The HashMap stores every index exactly once across all its lists, so total space used is O(n).Compared to the brute force O(n × q), this is the difference between ~1.7 million operations and ~10 billion operations at the constraint limits.Common PitfallsMixing up the two values of n. Inside the solution, n refers to arr.size() — the number of occurrences of a particular value. But when computing circular distance, you need nums.length — the full array length. These are different numbers and swapping them silently produces wrong answers.Forgetting the + n in the left neighbour formula. Writing (mid - 1) % n when mid is 0 produces -1 in Java, since Java's modulo preserves the sign of the dividend. Always write (mid - 1 + n) % n.Not handling the single-occurrence case. If a value appears only once, n == 1, and the neighbour formula wraps around to the element itself, giving a distance of zero — which is completely wrong. Guard against this explicitly before running the neighbour logic.What This Problem Teaches YouThe journey from brute force to optimal here follows a pattern worth internalizing.The brute force was correct but repeated work. Recognizing that repeated work and lifting it into a precomputation step is the single move that makes this problem tractable. The HashMap does that.Once you have a sorted structure, binary search is almost always the right tool to find a position within it. And once you have a position in a sorted structure, you only ever need to look at adjacent elements to find the nearest one — checking anything further is redundant by definition.These are not tricks specific to this problem. They are transferable patterns that appear across dozens of medium and hard problems on the platform. Internalizing them — rather than memorizing solutions — is what actually builds problem-solving ability over time.

ArraysHashMapBinary SearchCircular ArraysMediumLeetCodeJava
LeetCode 462: Minimum Moves to Equal Array Elements II | Java Solution Explained (Median Approach)

LeetCode 462: Minimum Moves to Equal Array Elements II | Java Solution Explained (Median Approach)

IntroductionLeetCode 462 is a classic mathematical and greedy problem.We are given an integer array where each operation allows us to:Increment an element by 1Decrement an element by 1Our task is to make all numbers equal while using the minimum number of moves.At first glance, this may look like a simple array problem.But the hidden concept behind this question is:Median propertyGreedy optimizationAbsolute difference minimizationThis problem is extremely popular in coding interviews because it tests logical thinking more than coding complexity.# Problem LinkProblem StatementYou are given an integer array nums.In one move:You can increase an element by 1Or decrease an element by 1You must make all array elements equal.Return the minimum number of operations required.Example 1Input:nums = [1,2,3]Output:2Explanation:[1,2,3]→ [2,2,3]→ [2,2,2]Total operations = 2Example 2Input:nums = [1,10,2,9]Output:16Key ObservationWe need to choose one target value such that all numbers move toward it.Question:Which target gives minimum total moves?Answer:MedianMedian minimizes the sum of absolute differences.Why Median Works?Suppose:nums = [1,2,3,10]If target = 2|1-2| + |2-2| + |3-2| + |10-2|= 1 + 0 + 1 + 8= 10If target = 5|1-5| + |2-5| + |3-5| + |10-5|= 4 + 3 + 2 + 5= 14Median gives minimum moves.Approach 1: Brute ForceIn this approach, we try every possible value as target.For each target:Calculate total operations neededStore minimum answerAlgorithmFind minimum and maximum elementTry every value between themCompute total movesReturn minimumJava Code (Brute Force)class Solution {public int minMoves2(int[] nums) {int min = Integer.MAX_VALUE;int max = Integer.MIN_VALUE;for (int num : nums) {min = Math.min(min, num);max = Math.max(max, num);}int result = Integer.MAX_VALUE;for (int target = min; target <= max; target++) {int moves = 0;for (int num : nums) {moves += Math.abs(num - target);}result = Math.min(result, moves);}return result;}}Time ComplexityO(N × Range)Very slow for large values.Approach 2: Sorting + Median (Optimal)This is the best and most commonly used approach.IdeaSort arrayPick median elementCalculate total absolute differenceStepsStep 1: Sort ArraySorting helps us easily find median.Step 2: Pick MedianMedian index = n / 2Step 3: Calculate MovesFor every element:moves += abs(median - value)Optimal Java Solutionclass Solution {public int minMoves2(int[] nums) {Arrays.sort(nums);int mid = nums.length / 2;int ans = 0;for (int i = 0; i < nums.length; i++) {int diff = Math.abs(nums[mid] - nums[i]);ans += diff;}return ans;}}Code ExplanationStep 1: Sort ArrayArrays.sort(nums);Sorting allows median calculation.Step 2: Get Medianint mid = nums.length / 2;Middle element becomes target.Step 3: Compute DifferenceMath.abs(nums[mid] - nums[i])Find distance from median.Step 4: Add All Movesans += diff;Store total moves.Approach 3: Two Pointer OptimizationAfter sorting, we can use two pointers.Instead of calculating absolute difference manually, we can pair smallest and largest values.IdeaAfter sorting:moves += nums[right] - nums[left]Because both numbers will meet toward median.Java Code (Two Pointer)class Solution {public int minMoves2(int[] nums) {Arrays.sort(nums);int left = 0;int right = nums.length - 1;int moves = 0;while (left < right) {moves += nums[right] - nums[left];left++;right--;}return moves;}}Why Two Pointer Works?Because:Median minimizes total distancePairing smallest and largest values gives direct movement cost.Dry RunInput:nums = [1,10,2,9]Sort:[1,2,9,10]Median:9Operations:|1-9| = 8|2-9| = 7|9-9| = 0|10-9| = 1Total:16Time ComplexitySortingO(N log N)TraversingO(N)TotalO(N log N)Space ComplexityO(1)Ignoring sorting stack.Common Mistakes1. Using Average Instead of MedianMany people think average gives minimum.Wrong.Average minimizes squared difference.Median minimizes absolute difference.2. Forgetting SortingMedian requires sorted order.3. Overflow IssueValues can be large.Sometimes use:long ansfor safer calculation.4. Using Wrong Median IndexCorrect:n / 2Edge CasesCase 1Single element array.Answer = 0Case 2All elements already equal.Answer = 0Case 3Negative numbers.Algorithm still works.FAQsQ1. Why median gives minimum moves?Median minimizes total absolute difference.Q2. Can average work?No.Average does not minimize absolute distance.Q3. Is sorting necessary?Yes.Sorting helps us easily find median.Q4. Which approach is best?Sorting + median approach.Interview InsightInterviewers ask this problem to test:Median property understandingGreedy optimizationMathematical thinkingArray manipulationConclusionLeetCode 462 is one of the most important median-based interview questions.The major learning is:Median minimizes total absolute differenceSorting makes finding median easySum of distances gives answerOnce you understand why median works, this question becomes very simple.

MathMedianMediumLeetCodeJavaArrayTwo PointerSorting
LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 145 – Binary Tree Postorder Traversal is one of the most important tree traversal problems for beginners learning Data Structures and Algorithms.This problem teaches:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPostorder traversal is extremely useful in advanced tree problems such as:Tree deletionExpression tree evaluationBottom-up computationsDynamic programming on treesProblem Link🔗 https://leetcode.com/problems/binary-tree-postorder-traversal/Problem StatementGiven the root of a binary tree, return the postorder traversal of its nodes' values.What is Postorder Traversal?In postorder traversal, nodes are visited in this order:Left → Right → RootUnlike preorder or inorder traversal, the root node is processed at the end.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Postorder TraversalTraversal order:3 → 2 → 1Output:[3,2,1]Recursive Approach (Most Common)IntuitionIn postorder traversal:Traverse left subtreeTraverse right subtreeVisit current nodeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Left → Right → RootRecursive function:postorder(node.left)postorder(node.right)visit(node)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);solve(list, root.right);list.add(root.val);}public List<Integer> postorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Step 2Move right to:2Move left to:3Left and right of 3 are null.Add:3Step 3Return to:2Add:2Step 4Return to:1Add:1Final Answer[3,2,1]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of the treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use stacks to simulate recursion.Iterative Postorder IntuitionPostorder traversal order is:Left → Right → RootOne common trick is:Traverse in modified preorder:Root → Right → LeftReverse the result.After reversing, we get:Left → Right → Rootwhich is postorder traversal.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value to answer.Push left child.Push right child.Reverse final answer.Java Iterative Solutionclass Solution {public List<Integer> postorderTraversal(TreeNode root) {LinkedList<Integer> ans = new LinkedList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.addFirst(node.val);if(node.left != null) {stack.push(node.left);}if(node.right != null) {stack.push(node.right);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add at front:[1]Push right child:2Step 3Pop:2Add at front:[2,1]Push left child:3Step 4Pop:3Add at front:[3,2,1]Final Answer[3,2,1]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Postorder traversal processes nodes in Left → Right → Root order. Recursion naturally handles this traversal. Iteratively, we simulate recursion using a stack and reverse traversal order.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct postorder:Left → Right → Root2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Incorrect Stack Push OrderFor iterative solution:Push left firstPush right secondbecause we reverse the result later.FAQsQ1. Why is postorder traversal useful?It is used in:Tree deletionExpression tree evaluationBottom-up dynamic programmingCalculating subtree informationQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can postorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Postorder TraversalMorris traversal performs tree traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 145 is an excellent beginner-friendly tree traversal problem.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key postorder pattern is:Left → Right → RootMastering this traversal helps in solving many advanced tree problems such as:Tree DPTree deletionExpression evaluationSubtree calculationsAdvanced DFS problems

LeetCodeBinary Tree Postorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
Quick Sort Algorithm Explained | Java Implementation, Partition Logic & Complexity

Quick Sort Algorithm Explained | Java Implementation, Partition Logic & Complexity

IntroductionQuick Sort is one of the most powerful and widely used sorting algorithms in computer science. It follows the Divide and Conquer approach and is known for its excellent average-case performance.What makes Quick Sort special is:It sorts in-place (no extra array required)It is faster in practice than many O(n log n) algorithms like Merge SortIt is heavily used in real-world systems and librariesIn this article, we’ll go deep into:Intuition behind Quick SortPartition logic (most important part)Step-by-step dry runJava implementation with commentsTime complexity analysisCommon mistakes and optimizations🔗 Problem LinkGeeksforGeeks: Quick SortProblem StatementGiven an array arr[], sort it in ascending order using Quick Sort.Requirements:Use Divide and ConquerChoose pivot elementPlace pivot in correct positionElements smaller → left sideElements greater → right sideExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [2, 1, 6, 10, 4, 1, 3, 9, 7]Output:[1, 1, 2, 3, 4, 6, 7, 9, 10]Core Idea of Quick SortPick a pivot → Place it correctly → Recursively sort left & right🔥 Key Insight (Partition is Everything)Quick Sort depends entirely on partitioning:👉 After partition:Pivot is at its correct sorted positionLeft side → smaller elementsRight side → larger elementsIntuition (Visual Understanding)Consider:[4, 1, 3, 9, 7]Step 1: Choose PivotLet’s say pivot = 4Step 2: Rearrange Elements[1, 3] 4 [9, 7]Now:Left → smallerRight → largerStep 3: Apply RecursivelyLeft: [1, 3]Right: [9, 7]Final result:[1, 3, 4, 7, 9]Partition Logic (Most Important)Your implementation uses:Pivot = first elementTwo pointers:i → moves forwardj → moves backwardJava Codeclass Solution { public void quickSort(int[] arr, int low, int high) { // Base case: if array has 1 or 0 elements if (low < high) { // Partition array and get pivot index int pivotInd = partition(arr, low, high); // Sort left part quickSort(arr, low, pivotInd - 1); // Sort right part quickSort(arr, pivotInd + 1, high); } } // Function to swap two elements void swap(int[] arr, int i, int j) { int temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; } private int partition(int[] arr, int low, int high) { int pivot = arr[low]; // choosing first element as pivot int i = low + 1; // start from next element int j = high; // start from end while (i <= j) { // Move i forward until element > pivot while (i <= high && arr[i] <= pivot) { i++; } // Move j backward until element <= pivot while (j >= low && arr[j] > pivot) { j--; } // Swap if pointers haven't crossed if (i < j) { swap(arr, i, j); } } // Place pivot at correct position swap(arr, low, j); return j; // return pivot index }}Step-by-Step Dry RunInput:[4, 1, 3, 9, 7]Execution:Pivot = 4i → moves until element > 4j → moves until element ≤ 4Swaps happen → pivot placed correctlyFinal partition:[1, 3, 4, 9, 7]Complexity AnalysisTime ComplexityCaseComplexityBest CaseO(n log n)Average CaseO(n log n)Worst CaseO(n²)Why Worst Case Happens?When array is:Already sortedReverse sortedPivot always becomes smallest/largest.Space ComplexityO(log n) (recursion stack)❌ Common MistakesWrong partition logicInfinite loops in while conditionsIncorrect pivot placementNot handling duplicates properly⚡ Optimizations1. Random PivotAvoid worst-case:int pivotIndex = low + new Random().nextInt(high - low + 1);swap(arr, low, pivotIndex);2. Median of ThreeChoose better pivot:median(arr[low], arr[mid], arr[high])Quick Sort vs Merge SortFeatureQuick SortMerge Sort link to get moreSpaceO(log n)O(n)SpeedFaster (practical)StableWorst CaseO(n²)O(n log n)Why Quick Sort is PreferredCache-friendlyIn-place sortingFaster in real-world scenariosKey TakeawaysPartition is the heart of Quick SortPivot must be placed correctlyRecursion splits problem efficientlyAvoid worst case using random pivotWhen to Use Quick SortLarge arraysMemory constraints (in-place)Performance-critical applicationsConclusionQuick Sort is one of the most efficient and practical sorting algorithms. Mastering its partition logic is crucial for solving advanced problems and performing well in coding interviews.Understanding how pointers move and how pivot is placed will make this algorithm intuitive and powerful.Frequently Asked Questions (FAQs)1. Is Quick Sort stable?No, it is not stable.2. Why is Quick Sort faster than Merge Sort?Because it avoids extra space and is cache-efficient.3. What is the most important part?👉 Partition logic

MediumJavaSortingQuick SortGeeksofGeeks
LeetCode 102: Binary Tree Level Order Traversal – Java BFS Solution Explained

LeetCode 102: Binary Tree Level Order Traversal – Java BFS Solution Explained

IntroductionLeetCode 102 – Binary Tree Level Order Traversal is one of the most important Binary Tree traversal problems for coding interviews.This problem introduces:Breadth First Search (BFS)Queue data structureLevel-by-level traversalTree traversal patternsInterview-level BFS thinkingUnlike DFS traversals like preorder, inorder, and postorder, this problem explores the tree level by level.This traversal is widely used in:Graph traversalShortest path problemsTree serializationZigzag traversalBFS-based interview questionsProblem Link🔗 https://leetcode.com/problems/binary-tree-level-order-traversal/Problem StatementGiven the root of a binary tree, return the level order traversal of its nodes' values.Traversal should happen:Level by levelLeft to rightExampleInputroot = [3,9,20,null,null,15,7]Tree Structure: 3 / \ 9 20 / \ 15 7Level Order TraversalLevel 1:[3]Level 2:[9,20]Level 3:[15,7]Final Output:[[3],[9,20],[15,7]]Understanding the ProblemThe main challenge is:Process nodes level by level.This is exactly what:Breadth First Search (BFS)is designed for.Why Queue is Used?A queue follows:First In First Out (FIFO)This ensures:Nodes are processed in insertion orderParent nodes are processed before child nodesLevels are traversed correctlyBrute Force IntuitionOne brute force idea is:Calculate height of treeTraverse each level separatelyStore nodes level by levelBrute Force ComplexityThis approach becomes inefficient because:Each level traversal may revisit nodesComplexity may become:O(N²)for skewed trees.Optimal BFS IntuitionInstead of traversing each level separately:Use a queueProcess nodes level by level naturallyAt every level:Store queue sizeProcess exactly those many nodesAdd children into queueMove to next levelKey BFS ObservationBefore processing a level:int size = queue.size();This tells us:How many nodes belong to the current level.BFS AlgorithmSteps1. Initialize QueueInsert root node.2. Process Until Queue Becomes EmptyWhile queue is not empty:Find current level sizeTraverse current levelStore valuesPush child nodes3. Store Current LevelAfter processing one level:ans.add(levelList);Java BFS Solution/** * Definition for a binary tree node. * public class TreeNode { * int val; * TreeNode left; * TreeNode right; * } */class Solution { public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> ans = new ArrayList<>(); Queue<TreeNode> queue = new LinkedList<>(); if(root == null) return ans; queue.offer(root); while(!queue.isEmpty()) { int size = queue.size(); List<Integer> level = new ArrayList<>(); for(int i = 0; i < size; i++) { root = queue.poll(); level.add(root.val); if(root.left != null) queue.offer(root.left); if(root.right != null) queue.offer(root.right); } ans.add(level); } return ans; }}Dry RunInputroot = [3,9,20,null,null,15,7]Tree: 3 / \ 9 20 / \ 15 7Initial Queue[3]Level 1Queue size:1Process:3Add children:9, 20Level result:[3]Queue now:[9,20]Level 2Queue size:2Process:9, 20Add children:15, 7Level result:[9,20]Queue now:[15,7]Level 3Queue size:2Process:15, 7Level result:[15,7]Queue becomes empty.Final Answer[[3],[9,20],[15,7]]Time Complexity AnalysisTime ComplexityO(N)Every node is visited exactly once.Space ComplexityO(N)Queue may store an entire level of nodes.DFS Alternative ApproachThis problem can also be solved using DFS recursion.Idea:Pass current level during recursionCreate new list when level appears first timeAdd node into correct level listJava DFS Solutionclass Solution { public void dfs(TreeNode root, int level, List<List<Integer>> ans) { if(root == null) return; if(level == ans.size()) { ans.add(new ArrayList<>()); } ans.get(level).add(root.val); dfs(root.left, level + 1, ans); dfs(root.right, level + 1, ans); } public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> ans = new ArrayList<>(); dfs(root, 0, ans); return ans; }}BFS vs DFS for Level Order TraversalApproachAdvantagesDisadvantagesBFSNatural level traversalUses queueDFSRecursive solutionSlightly harder intuitionInterview ExplanationIn interviews, explain:Level order traversal is a BFS problem because we process nodes level by level. A queue naturally supports this traversal order.This demonstrates strong BFS understanding.Common Mistakes1. Forgetting Queue SizeWithout storing:int size = queue.size();levels cannot be separated correctly.2. Using DFS IncorrectlySimple DFS alone does not guarantee level ordering.3. Forgetting Null CheckAlways handle:if(root == null)FAQsQ1. Why is BFS preferred here?Because BFS naturally processes nodes level by level.Q2. Can this problem be solved recursively?Yes.Using DFS with level tracking.Q3. What data structure is mainly used?Queue.Q4. Is Level Order Traversal important?Yes.It is one of the most frequently asked BFS tree problems.Related ProblemsAfter mastering this problem, practice:Binary Tree Zigzag Level Order TraversalAverage of Levels in Binary TreeRight Side View of Binary TreeBinary Tree Vertical Order TraversalMaximum Depth of Binary TreeConclusionLeetCode 102 is one of the most important BFS tree traversal problems.It teaches:BFS traversalQueue usageLevel-by-level processingTree traversal fundamentalsThe key idea is:Use queue size to separate levels.Once this intuition becomes clear, many BFS-based tree interview problems become much easier.

LeetCodeBinary Tree Level Order TraversalBFSQueueBinary TreeJavaTree TraversalMedium
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
LeetCode 1752: Check if Array Is Sorted and Rotated – Java Solution Explained

LeetCode 1752: Check if Array Is Sorted and Rotated – Java Solution Explained

IntroductionLeetCode 1752 – Check if Array Is Sorted and Rotated is a classic array observation problem that tests your understanding of:Sorted arraysRotation logicCircular traversalEdge case handlingPattern recognitionAt first, many developers overcomplicate this problem by trying to actually rotate arrays and compare them. However, the problem can be solved using a very elegant observation.This problem is commonly asked in coding interviews because it evaluates:Logical thinkingArray traversal skillsOptimization abilityUnderstanding of rotated arraysProblem Link🔗 https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/Problem StatementGiven an array:numsReturn:trueif the array was originally sorted in non-decreasing order and then rotated some number of times.Otherwise return:falseDuplicates are allowed.Understanding RotationSuppose the original sorted array is:[1,2,3,4,5]After rotation:[3,4,5,1,2]The array is still almost sorted except for one “breaking point”.Key ObservationA sorted rotated array can have:At most one decreasing pairExample:[3,4,5,1,2]Breaking point:5 > 1Only once.Invalid Example[2,1,3,4]Breaking points:2 > 1and circularly:4 > 2Two breaking points.So answer is:falseBrute Force ApproachIntuitionTry all possible rotations.For every rotation:Rotate arrayCheck if sortedIf any rotation works → return trueBrute Force AlgorithmFor every rotation count:Create rotated arrayVerify sorted orderIf sorted:return trueElse:return falseBrute Force ComplexityTime ComplexityO(N²)because each rotation requires traversal.Space ComplexityO(N)This solution:Finds rotation pointSorts arrayRotates sorted arrayCompares with originalThis is a valid simulation-based approach.Java Solutionclass Solution { public boolean check(int[] nums) { int[] arr = new int[nums.length]; int o = 0; int mini = Integer.MIN_VALUE; int temp = 0; int maxnumind = 0; for(int a : nums) { arr[o] = a; temp = mini; mini = Math.max(mini, a); if(mini != temp) { maxnumind = o; } o++; } for(int i = 0; i < nums.length - 1; i++) { if(nums[i] > nums[i + 1]) { maxnumind = i; } } int ro = nums.length - maxnumind - 1; Arrays.sort(nums); int[] rotarr = new int[nums.length]; for(int i = 0; i < nums.length; i++) { rotarr[i] = nums[(i + ro) % nums.length]; } for(int i = 0; i < arr.length; i++) { if(rotarr[i] != arr[i]) { return false; } } return true; }}Optimized Approach (Best Solution)We do not need:SortingExtra arraysRotation simulationWe only count:decreasing pairsOptimized IntuitionFor a valid rotated sorted array:nums[i] > nums[i+1]can happen only once.Also check circular condition:last element > first elementOptimized Java Solutionclass Solution { public boolean check(int[] nums) { int count = 0; for(int i = 0; i < nums.length; i++) { if(nums[i] > nums[(i + 1) % nums.length]) { count++; } } return count <= 1; }}Why This WorksIf array is sorted and rotated:Sequence increases normallyOnly one position breaks orderIf more than one break exists:Not a rotated sorted arrayDry RunInputnums = [3,4,5,1,2]Step 1Compare adjacent elements:3 < 44 < 55 > 1 ← breaking point1 < 22 < 3 (circular)Breaking points:1Valid.Return:trueAnother Dry RunInputnums = [2,1,3,4]Comparisons:2 > 1 ← break1 < 33 < 44 > 2 ← circular breakBreaking points:2Invalid.Return:falseTime Complexity AnalysisTime ComplexityO(N log N)because of sorting.Space ComplexityO(N)extra arrays used.Optimized ApproachTime ComplexityO(N)single traversal.Space ComplexityO(1)Comparison of ApproachesApproachTime ComplexitySpace ComplexityRotation SimulationO(N log N)O(N)Decreasing Pair CountO(N)O(1)Interview ExplanationIn interviews, explain:A sorted rotated array can contain only one position where the order decreases. By counting such breaking points including circular comparison, we can determine validity in linear time.This demonstrates:Pattern recognitionCircular traversal understandingOptimization thinkingCommon Mistakes1. Forgetting Circular CheckAlways compare:nums[n-1] > nums[0]using modulo.2. Actually Rotating ArraysUnnecessary and inefficient.3. Using Strictly Increasing LogicDuplicates are allowed.So:1,1,2,2is valid.FAQsQ1. Why use modulo?To compare:last element with first elementcircularly.Q2. Why is only one break allowed?Because rotation shifts sorted order only once.Q3. Is sorting required?No.Observation-based traversal is enough.Q4. Is this problem important for interviews?Yes.It tests:Array logicRotationsOptimizationObservation skillsRelated ProblemsAfter mastering this problem, practice:Search in Rotated Sorted ArrayFind Minimum in Rotated Sorted ArrayFind Minimum in Rotated Sorted Array IIConclusionLeetCode 1752 is an excellent observation-based array problem.It teaches:Rotated array logicCircular traversalOptimization techniquesPattern recognitionThe key insight is:A sorted rotated array can have at most one decreasing point.Once you understand this observation, the optimized solution becomes extremely clean and efficient.

LeetCodeJavaArrayRotation ProblemsSortingEasy
LeetCode 2161: Partition Array According to Given Pivot – Java Easy Stable Partition Solution

LeetCode 2161: Partition Array According to Given Pivot – Java Easy Stable Partition Solution

IntroductionLeetCode 2161 is a clean and important array manipulation problem that tests:Array traversalStable partitioningOrder preservationTwo-pass and three-pass approachesLogical grouping of elementsThe interesting part of this problem is that we are not only partitioning the array around a pivot, but we also need to preserve the relative order of elements.This makes the problem slightly different from classical partition algorithms like QuickSort partitioning.In this article, we will understand:The intuition behind stable partitioningWhy order preservation mattersStep-by-step explanationDry runTime and space complexityComplete optimized Java solutionProblem StatementTry this probelm here :- Partition ArrayYou are given:An integer array:numsAn integer:pivotYou must rearrange the array such that:All elements smaller than pivot come firstAll elements equal to pivot come nextAll elements greater than pivot come lastRelative ordering must remain preservedReturn the rearranged array.ExampleInputnums = [9,12,5,10,14,3,10]pivot = 10Output[9,5,3,10,10,12,14]ExplanationElements less than 109, 5, 3Elements equal to 1010, 10Elements greater than 1012, 14All relative orderings are preserved.Key ObservationWe do NOT need sorting.We only need grouping while maintaining original order.This is called:Stable PartitioningApproachWe create a new array and fill it in 3 phases:Phase 1Insert all elements:< pivotPhase 2Insert all elements:== pivotPhase 3Insert all elements:> pivotThis naturally preserves relative ordering because we traverse left-to-right every time.Optimized Java Solutionclass Solution { public int[] pivotArray(int[] nums, int pivot) { int[] ans = new int[nums.length]; int index = 0; // Smaller than pivot for(int i = 0; i < nums.length; i++) { if(nums[i] < pivot) { ans[index] = nums[i]; index++; } } // Equal to pivot for(int i = 0; i < nums.length; i++) { if(nums[i] == pivot) { ans[index] = nums[i]; index++; } } // Greater than pivot for(int i = 0; i < nums.length; i++) { if(nums[i] > pivot) { ans[index] = nums[i]; index++; } } return ans; }}Step-by-Step ExplanationStep 1: Create Answer Arrayint[] ans = new int[nums.length];Stores final partitioned result.Step 2: Insert Smaller Elementsif(nums[i] < pivot)All smaller elements go first.Step 3: Insert Equal Elementsif(nums[i] == pivot)Pivot values are placed in the middle.Step 4: Insert Larger Elementsif(nums[i] > pivot)Larger elements go to the end.Dry RunInputnums = [9,12,5,10,14,3,10]pivot = 10Pass 1: Smaller ElementsAdd:9, 5, 3Current array:[9,5,3]Pass 2: Equal ElementsAdd:10, 10Current array:[9,5,3,10,10]Pass 3: Greater ElementsAdd:12, 14Final array:[9,5,3,10,10,12,14]Time ComplexityWe traverse the array 3 times.Time ComplexityO(N)Because:3N → O(N)Space ComplexityWe use an extra array.Space ComplexityO(N)Why This Problem is ImportantThis problem teaches:Stable partitioningArray groupingRelative order preservationMulti-pass array processingClean implementation strategyThese concepts are frequently used in:Sorting systemsData pipelinesStream processingPartition-based algorithmsCommon Mistakes1. Using QuickSort Partition LogicQuickSort partitioning does NOT preserve order.This problem specifically requires stable ordering.2. Forgetting Equal ElementsSome solutions only handle:< pivotand> pivotBut pivot values must remain in the center.3. Overcomplicating with Two PointersA simple three-pass solution is cleaner and easier to understand.Interview ExplanationIn interviews explain:Since relative order must remain preserved, we cannot use traditional in-place partitioning. Instead, we perform stable partitioning by collecting smaller, equal, and larger elements sequentially.This demonstrates:Understanding of stable operationsStrong array fundamentalsClean coding approachAlternative ApproachAnother approach is using:Three separate listsThen merging themExample:small + equal + largeBut using one answer array is more space efficient.ConclusionLeetCode 2161 is a simple yet important stable partition problem.The key insight is:We must preserve relative ordering while grouping elements around the pivot.Using a clean three-pass traversal gives an elegant and efficient O(N) solution.

LeetCodeJavaMediumArrayArray PartitionPivot
LeetCode 1283 — Find the Smallest Divisor Given a Threshold | Binary Search on Answer Explained

LeetCode 1283 — Find the Smallest Divisor Given a Threshold | Binary Search on Answer Explained

🚀 Try This Problem First!Before reading the solution, attempt it yourself on LeetCode — you'll retain the concept far better.🔗 Problem Link: https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold/Understanding the ProblemYou are given an array of integers nums and an integer threshold. You must choose a positive integer divisor, divide every element of the array by it (rounding up to the nearest integer), sum all the results, and make sure that sum is ≤ threshold.Goal: Find the smallest possible divisor that keeps the sum within the threshold.Important detail — Ceiling Division: Every division rounds up, not down. So 7 ÷ 3 = 3 (not 2), and 10 ÷ 2 = 5.Constraints:1 ≤ nums.length ≤ 5 × 10⁴1 ≤ nums[i] ≤ 10⁶nums.length ≤ threshold ≤ 10⁶Two Key Observations (Before Writing a Single Line of Code)Minimum possible divisor: The divisor must be at least 1. Dividing by anything less than 1 isn't a positive integer. So:low = 1Maximum possible divisor: If divisor = max(nums), then every element divided by it gives at most 1 (due to ceiling), so the sum equals nums.length, which is always ≤ threshold (guaranteed by constraints). So:high = max(nums)Our answer lies in the range [1, max(nums)]. This is the search space for Binary Search.Intuition — Why Binary Search?Ask yourself: what happens as the divisor increases?As divisor gets larger, each divided value gets smaller (or stays the same), so the total sum decreases or stays the same. This is a monotonic relationship — the green flag for Binary Search on the Answer.Instead of trying every divisor from 1 to max(nums), we binary search over divisor values. For each candidate mid, we ask:"Does dividing all elements by mid (ceiling) give a sum ≤ threshold?"This feasibility check runs in O(N), making the whole approach O(N log(max(nums))).The Feasibility Check — Ceiling Sum SimulationGiven a divisor mid, compute the sum of ⌈arr[i] / mid⌉ for all elements. If the total sum ≤ threshold, then mid is a valid divisor.In Java, ceiling division of integers is done as:Math.ceil((double) arr[i] / mid)Binary Search StrategyIf canDivide(mid) is true → mid might be the answer, but try smaller. Set ans = mid, high = mid - 1.If canDivide(mid) is false → divisor is too small, increase it. Set low = mid + 1.Dry Run — Example 1 (Step by Step)Input: nums = [1, 2, 5, 9], threshold = 6We start with low = 1 and high = 9 (max element in array).Iteration 1: mid = 1 + (9 - 1) / 2 = 5Compute ceiling sum with divisor 5: ⌈1/5⌉ + ⌈2/5⌉ + ⌈5/5⌉ + ⌈9/5⌉ = 1 + 1 + 1 + 2 = 55 ≤ 6 → ✅ Valid. Record ans = 5, search smaller → high = 4.Iteration 2: mid = 1 + (4 - 1) / 2 = 2Compute ceiling sum with divisor 2: ⌈1/2⌉ + ⌈2/2⌉ + ⌈5/2⌉ + ⌈9/2⌉ = 1 + 1 + 3 + 5 = 1010 > 6 → ❌ Too large. Increase divisor → low = 3.Iteration 3: mid = 3 + (4 - 3) / 2 = 3Compute ceiling sum with divisor 3: ⌈1/3⌉ + ⌈2/3⌉ + ⌈5/3⌉ + ⌈9/3⌉ = 1 + 1 + 2 + 3 = 77 > 6 → ❌ Too large. Increase divisor → low = 4.Iteration 4: mid = 4 + (4 - 4) / 2 = 4Compute ceiling sum with divisor 4: ⌈1/4⌉ + ⌈2/4⌉ + ⌈5/4⌉ + ⌈9/4⌉ = 1 + 1 + 2 + 3 = 77 > 6 → ❌ Too large. Increase divisor → low = 5.Loop ends: low (5) > high (4). Binary search terminates.Output: ans = 5 ✅The Code Implementationclass Solution {/*** Feasibility Check (Helper Function)** Given a divisor 'mid', this function computes the ceiling sum of* all elements divided by 'mid' and checks if it is within threshold.** @param mid - candidate divisor to test* @param arr - input array* @param thresh - the allowed threshold for the sum* @return true if the ceiling division sum <= threshold, false otherwise*/public boolean canDivide(int mid, int[] arr, int thresh) {int sumOfDiv = 0;for (int i = 0; i < arr.length; i++) {// Ceiling division: Math.ceil(arr[i] / mid)// Cast to double to avoid integer division truncationsumOfDiv += Math.ceil((double) arr[i] / mid);}// If total sum is within threshold, this divisor is validreturn sumOfDiv <= thresh;}/*** Main Function — Binary Search on the Answer** Search range: [1, max(nums)]* - low = 1 → smallest valid positive divisor* - high = max(nums) → guarantees every ceil(num/divisor) = 1,* so sum = nums.length <= threshold (always valid)** @param nums - input array* @param threshold - maximum allowed sum after ceiling division* @return smallest divisor such that the ceiling division sum <= threshold*/public int smallestDivisor(int[] nums, int threshold) {int min = 1; // Lower bound: divisor starts at 1int max = Integer.MIN_VALUE; // Will become max(nums)int ans = 1;// Find the upper bound of binary search (max element)for (int a : nums) {max = Math.max(max, a);}// Binary Search over the divisor spacewhile (min <= max) {int mid = min + (max - min) / 2; // Safe midpoint, avoids overflowif (canDivide(mid, nums, threshold)) {// mid is valid — record it and try a smaller divisorans = mid;max = mid - 1;} else {// mid is too small — the sum exceeded threshold, go highermin = mid + 1;}}return ans; // Smallest valid divisor}}Code Walkthrough — Step by StepSetting bounds: We iterate through nums once to find max — this becomes our upper bound high. The lower bound low = 1 because divisors must be positive integers.Binary Search loop: We pick mid = min + (max - min) / 2 as the candidate divisor. We check if using mid as the divisor keeps the ceiling sum ≤ threshold.Feasibility helper (canDivide): For each element, we compute Math.ceil((double) arr[i] / mid) and accumulate the total. The cast to double is critical — without it, Java performs integer division (which truncates, not rounds up).Narrowing the search: If the sum is within threshold → record ans = mid, try smaller (max = mid - 1). If the sum exceeds threshold → divisor is too small, increase it (min = mid + 1).A Critical Bug to Watch Out For — The return min vs return ans TrapIn your original code, the final line was return min instead of return ans. This is a subtle bug. After the loop ends, min has overshot past the answer (it's now ans + 1). Always store the answer in a dedicated variable ans and return that. Using return min would return the wrong result in most cases.Common Mistakes to AvoidWrong lower bound: Setting low = min(nums) instead of low = 1 seems intuitive but is wrong. A divisor smaller than the minimum element is still valid — for example, dividing [5, 9] by 3 gives ⌈5/3⌉ + ⌈9/3⌉ = 2 + 3 = 5, which could be within threshold.Forgetting ceiling division: Using arr[i] / mid (integer division, which truncates) instead of Math.ceil((double) arr[i] / mid) is wrong. The problem explicitly states results are rounded up.Returning min instead of ans: After the binary search loop ends, min > max, meaning min has already gone past the valid answer. Always return the stored ans.Integer overflow in midpoint: Always use mid = min + (max - min) / 2 instead of (min + max) / 2. When both values are large (up to 10⁶), their sum can overflow an int.Complexity AnalysisTime Complexity: O(N × log(max(nums)))Binary search runs over [1, max(nums)] → at most log₂(10⁶) ≈ 20 iterations.Each iteration calls canDivide which is O(N).Total: O(N log M) where M = max(nums).Space Complexity: O(1) No extra data structures — only a few integer variables are used throughout.How This Relates to LeetCode 1011This problem and LeetCode 1011 (Ship Packages Within D Days) are almost identical in structure:🔗 LeetCode 1011 #Search space: [max(weights), sum(weights)]Feasibility check: Can we ship in ≤ D days?Monotonic property: More capacity → fewer daysGoal: Minimize capacityLeetCode 1283Search space: [1, max(nums)]Feasibility check: Is ceiling sum ≤ threshold?Monotonic property: Larger divisor → smaller sumGoal: Minimize divisorOnce you deeply understand one, the other takes minutes to solve.Similar Problems (Same Pattern — Binary Search on Answer)LeetCode 875 — Koko Eating Bananas [ Blog is also avaliable on this - Read Now ]LeetCode 1011 — Capacity To Ship Packages Within D Days [ Blog is also avaliable on this - Read Now ]LeetCode 410 — Split Array Largest SumLeetCode 2064 — Minimized Maximum of Products Distributed to Any StoreAll follow the same template: identify a monotonic answer space, write an O(N) feasibility check, and binary search over it.Key Takeaways✅ When the problem asks "find the minimum value such that a condition holds" — think Binary Search on the Answer.✅ The lower bound is the most constrained valid value (1 here, since divisors must be positive).✅ The upper bound is the least constrained valid value (max element, guarantees sum = length ≤ threshold).✅ Ceiling division in Java requires casting to double: Math.ceil((double) a / b).✅ Always store the answer in a separate ans variable — never return min or max directly after a binary search loop.Happy Coding! Smash that upvote if this helped you crack the pattern. 🚀

LeetCodeBinary SearchMediumJavaBinary Search on AnswerArraysCeiling Division
LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 144 – Binary Tree Preorder Traversal is one of the most important beginner-friendly tree traversal problems in Data Structures and Algorithms.This problem helps you understand:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPreorder traversal is widely used in:Tree copyingSerializationExpression treesDFS-based problemsHierarchical data processingIt is also one of the most commonly asked tree problems in coding interviews.Problem Link🔗 ProblemLeetCode 144: Binary Tree Preorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the preorder traversal of its nodes' values.What is Preorder Traversal?In preorder traversal, nodes are visited in this order:Root → Left → RightThe root node is processed first before traversing subtrees.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Preorder TraversalTraversal order:1 → 2 → 3Output:[1,2,3]Recursive Approach (Most Common)IntuitionIn preorder traversal:Visit current nodeTraverse left subtreeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Root → Left → RightRecursive function:visit(node)preorder(node.left)preorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;list.add(root.val);solve(list, root.left);solve(list, root.right);}public List<Integer> preorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Add:1Move right to:2Step 2Add:2Move left to:3Step 3Add:3Final Answer[1,2,3]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Preorder IntuitionPreorder traversal order is:Root → Left → RightUsing a stack:Process current node immediatelyPush right child firstPush left child secondWhy?Because stacks follow:Last In First Out (LIFO)So left subtree gets processed first.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value.Push right child.Push left child.Repeat until stack becomes empty.Java Iterative Solutionclass Solution {public List<Integer> preorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.add(node.val);if(node.right != null) {stack.push(node.right);}if(node.left != null) {stack.push(node.left);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add:[1]Push right child:2Step 3Pop:2Add:[1,2]Push left child:3Step 4Pop:3Add:[1,2,3]Final Answer[1,2,3]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Preorder traversal processes nodes in Root → Left → Right order. Recursion naturally handles this traversal. Iteratively, we use a stack and push the right child before the left child so the left subtree gets processed first.This demonstrates strong DFS and stack understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Left → Root → RightThat is inorder traversal.Correct preorder:Root → Left → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Wrong Stack Push OrderFor iterative traversal:Push right firstPush left secondOtherwise traversal order becomes incorrect.FAQsQ1. Why is preorder traversal useful?It is heavily used in:Tree cloningSerializationDFS traversalExpression treesQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can preorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Preorder TraversalMorris traversal performs preorder traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 144 is one of the most fundamental binary tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key preorder pattern is:Root → Left → RightMastering this traversal builds a strong foundation for advanced tree problems such as:Tree serializationDFS-based problemsTree reconstructionExpression treesMorris traversal

LeetCodeBinary Tree Preorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
LeetCode 98: Validate Binary Search Tree – Java DFS Recursive Solution Explained

LeetCode 98: Validate Binary Search Tree – Java DFS Recursive Solution Explained

IntroductionLeetCode 98 – Validate Binary Search Tree is one of the most important Binary Search Tree interview problems.This question is extremely popular because it tests:BST propertiesRecursive tree traversalDFS recursionRange validationTree constraints handlingMany beginners make mistakes on this problem because checking only parent-child relationships is not enough.Understanding the correct BST validation logic is very important for interviews.Problem Link🔗 https://leetcode.com/problems/validate-binary-search-tree/Problem StatementGiven the root of a binary tree, determine whether it is a valid Binary Search Tree (BST).A valid BST follows:Left subtree contains only smaller valuesRight subtree contains only greater valuesBoth left and right subtrees must also be BSTsExample 1Inputroot = [2,1,3]OutputtrueExplanation 2 / \ 1 3All BST conditions are satisfied.Example 2Inputroot = [5,1,4,null,null,3,6]OutputfalseWhy False? 5 / \ 1 4 / \ 3 6Although:4 < 6the node:4exists inside the right subtree of:5and should therefore be greater than 5.This violates BST rules.Key InsightThe most important understanding:Every node must satisfy an entire valid range, not just parent comparison.This is where many incorrect solutions fail.Common Wrong ThinkingMany beginners try:if(root.left.val < root.val && root.right.val > root.val)This is incorrect.Because BST validation depends on:ALL ancestor constraintsnot just immediate parent.Correct IntuitionEach node has:Minimum allowed valueMaximum allowed valueFor example:Left subtree -> values smaller than rootRight subtree -> values greater than rootAs recursion goes deeper:constraints become tighterVisual Understanding 10 / \ 5 15 / \ 6 20Node:6is invalid because:6 < 10even though:6 < 15This proves:Parent-only checking is insufficient.Brute Force ApproachIdeaFor every node:Find maximum in left subtreeFind minimum in right subtreeValidate BST conditionsBrute Force ComplexityTime ComplexityO(N²)Because subtree traversal repeats for every node.Space ComplexityO(H)Recursive stack space.Optimized Recursive DFS ApproachThe optimized idea:Pass valid range during recursion.Each node must satisfy:min < node.val < maxJava Solutionclass Solution { public boolean solve(TreeNode root, long min, long max) { if(root == null) return true; if(root.val <= min || root.val >= max) { return false; } return solve(root.left, min, root.val) && solve(root.right, root.val, max); } public boolean isValidBST(TreeNode root) { if(root == null) return true; return solve(root, Long.MIN_VALUE, Long.MAX_VALUE); }}Why Use Long Instead of Int?Constraints allow:-2³¹ <= Node.val <= 2³¹ - 1Using:Integer.MIN_VALUEInteger.MAX_VALUEcan create edge-case failures.So we safely use:Long.MIN_VALUELong.MAX_VALUEHow This WorksFor every node:Left SubtreeAllowed range:(min, root.val)Right SubtreeAllowed range:(root.val, max)This guarantees global BST validity.Dry RunInputroot = [2,1,3]Step 1Current node:2Allowed range:(-∞, +∞)Valid.Step 2Move left:1Allowed range:(-∞, 2)Valid.Step 3Move right:3Allowed range:(2, +∞)Valid.Final OutputtrueAnother Dry RunInputroot = [5,1,4,null,null,3,6]Step 1Node:5Range:(-∞, +∞)Valid.Step 2Move right to:4Range:(5, +∞)Now:4 <= 5Invalid BST.Final OutputfalseTime Complexity AnalysisTime ComplexityO(N)Every node visited once.Space ComplexityO(H)Where:H = height of treeWorst case:O(N)for skewed tree.Alternative Approach Using Inorder TraversalKey PropertyBST inorder traversal produces:strictly increasing orderInorder Java Solutionclass Solution { TreeNode prev = null; public boolean inorder(TreeNode root) { if(root == null) return true; if(!inorder(root.left)) return false; if(prev != null && root.val <= prev.val) { return false; } prev = root; return inorder(root.right); } public boolean isValidBST(TreeNode root) { return inorder(root); }}Interview ExplanationIn interviews, explain:A valid BST requires every node to satisfy ancestor constraints, not just parent constraints. Therefore, we recursively maintain valid minimum and maximum bounds for each node.This demonstrates:Deep BST understandingRecursive DFS masteryConstraint propagationEdge-case handlingCommon Mistakes1. Comparing Only Parent NodesIncorrect approach:root.left.val < root.valThis misses ancestor violations.2. Forgetting Strict InequalityBST requires:strictly smallerstrictly greaterDuplicates are invalid.3. Using int Instead of longCan fail on edge values.Always use:long minlong max4. Incorrect Range PassingCorrect recursion:left -> (min, root.val)right -> (root.val, max)FAQsQ1. Why does parent comparison fail?Because BST validity depends on all ancestor constraints.Q2. Why use min/max bounds?Bounds propagate BST restrictions correctly.Q3. Can inorder traversal solve this?Yes.BST inorder traversal must be strictly increasing.Q4. Is this asked frequently?Very frequently.It is one of the most important BST interview questions.Related ProblemsPractice these next:Search in BSTInsert into BSTLowest Common Ancestor in BSTKth Smallest Element in BSTConclusionLeetCode 98 is an excellent problem for mastering:BST validationRecursive DFSConstraint propagationTree traversalInterview problem-solvingThe key insight is:Every BST node must satisfy a valid global range, not just local parent conditions.Once this concept becomes intuitive, many advanced BST problems become significantly easier.

LeetCodeBinary Search TreeBSTJavaDFS TraversalBinary TreeRecursionMedium
LeetCode 3689: Maximum Total Subarray Value I – Java Greedy Solution Explained

LeetCode 3689: Maximum Total Subarray Value I – Java Greedy Solution Explained

IntroductionLeetCode 3689, “Maximum Total Subarray Value I”, is an interesting medium-level array problem that focuses on maximizing the total value of selected subarrays. The challenge introduces an important observation-based greedy approach that simplifies the problem significantly.In this article, we will break down the problem statement, understand the intuition behind the solution, analyze the Java code step-by-step, and discuss the time and space complexity.Problem StatementTry this problem here :- Maximum Total Subarray Value IYou are given:An integer array numsAn integer kYou must choose exactly k non-empty subarrays from the array.The value of a subarray is defined as:Value = Maximum Element − Minimum ElementThe goal is to maximize the total value of all chosen subarrays.ExampleExample 1Input:nums = [1,3,2]k = 2Output:4Explanation:Subarray [1,3] → 3 - 1 = 2Subarray [1,3,2] → 3 - 1 = 2Total = 2 + 2 = 4Example 2Input:nums = [4,2,5,1]k = 3Output:12Explanation:The maximum possible subarray value is:5 - 1 = 4Choose this optimal subarray 3 times:4 + 4 + 4 = 12Key ObservationThe problem allows:Overlapping subarraysReusing the same exact subarray multiple timesThis changes everything.To maximize the total value:Find the maximum possible subarray value.Reuse that same subarray exactly k times.Now the question becomes:What is the maximum possible value of any subarray?Since a subarray’s value is:max(subarray) - min(subarray)The largest possible value is simply:global maximum element - global minimum elementSo the final answer becomes:(maxElement - minElement) * kJava Solutionclass Solution { public long maxTotalValue(int[] nums, int k) { long min = Long.MAX_VALUE; long max = Long.MIN_VALUE; long ans = 0; for(int i = 0; i < nums.length; i++) { min = Math.min(min, nums[i]); max = Math.max(max, nums[i]); } ans = max - min; return ans * k; }}Step-by-Step Dry RunInputnums = [4,2,5,1]k = 3Step 1: Find Minimum and MaximumTraverse the array:ElementCurrent MinCurrent Max444224525115Final:min = 1max = 5Step 2: Calculate Maximum Subarray Value5 - 1 = 4Step 3: Multiply by k4 * 3 = 12Final Answer:12Why This Greedy Approach WorksThe problem explicitly allows selecting:The same subarray multiple timesOverlapping subarraysSo once we identify the subarray with the highest possible value, there is no reason to choose anything else.The optimal strategy is:Choose the best subarray repeatedly k timesThis reduces the entire problem to finding:Maximum element - Minimum elementTime ComplexityTime ComplexityO(n)We traverse the array only once.Space ComplexityO(1)Only a few variables are used.Interview InsightsThis problem tests:Observation skillsGreedy thinkingAbility to simplify constraintsUnderstanding of problem flexibilityMany developers initially overcomplicate the problem using sliding window or dynamic programming approaches. However, the key insight is realizing that repeated subarrays are allowed.Final ThoughtsLeetCode 3689 is a great example of how carefully reading constraints can dramatically simplify a problem.Instead of generating all subarrays, the optimal solution comes from a simple mathematical observation:Maximum Total Value = (Global Max − Global Min) × kThis leads to an elegant and highly efficient O(n) solution.If you are preparing for coding interviews, this problem is an excellent exercise in greedy optimization and pattern recognition.

LeetCodeJavaMediumSubarray
LeetCode 2784: Check if Array is Good – Java HashMap Solution Explained

LeetCode 2784: Check if Array is Good – Java HashMap Solution Explained

IntroductionLeetCode 2784 – Check if Array is Good is a beginner-friendly array and hashing problem that tests your understanding of:Frequency countingHashMap usageArray validationPermutation logicEdge case handlingAlthough the problem looks simple initially, many candidates fail because they misunderstand the exact structure of the required array.This problem is commonly asked to test:Attention to detailLogical validationCounting techniquesHashing fundamentalsProblem Link🔗 https://leetcode.com/problems/check-if-array-is-good/Problem StatementAn array is considered good if it is a permutation of:base[n] = [1, 2, 3, ..., n-1, n, n]Meaning:Numbers from:1 to n-1appear exactly once.Number:nappears exactly twice.You need to return:trueif the given array is good, otherwise:falseUnderstanding the PatternA valid good array must follow:[1, 2, 3, ..., n-1, n, n]Examples:[1,1][1,2,3,3][1,2,3,4,4]Invalid examples:[1,2,2][1,2,4,4][1,1,2,2]Key ObservationsObservation 1The maximum element determines:nObservation 2Array size must be:n + 1because:1 to n-1 => n-1 elementsn appears twice => 2 elementsTotal = n + 1Observation 3Frequency conditions:NumberFrequency1 to n-1Exactly 1nExactly 2Brute Force ApproachIdeaSort arrayCompare with expected arrayReturn resultBrute Force AlgorithmStep 1Find maximum element:nStep 2Create expected array:[1,2,3,...,n,n]Step 3Sort both arrays and compare.Brute Force ComplexityTime ComplexityO(N log N)due to sorting.Space ComplexityO(N)Optimized HashMap ApproachInstead of sorting:Count frequencies directlyValidate conditionsThis makes the solution faster and cleaner.Intuition Behind HashMap SolutionWe store frequency of every number.Then verify:Maximum element appears twiceEvery other number appears onceArray length equals:max + 1Java HashMap Solutionclass Solution { public boolean isGood(int[] nums) { if(nums.length == 1) return false; int maxElement = Integer.MIN_VALUE; HashMap<Integer, Integer> map = new HashMap<>(); for(int i = 0; i < nums.length; i++) { map.put(nums[i], map.getOrDefault(nums[i], 0) + 1); maxElement = Math.max(maxElement, nums[i]); } int n = maxElement; if(nums.length != n + 1) { return false; } for(int i = 1; i <= n; i++) { if(!map.containsKey(i)) { return false; } if(i == n) { if(map.get(i) != 2) return false; } else { if(map.get(i) != 1) return false; } } return true; }}Dry RunInputnums = [1,3,3,2]Step 1 – Find MaximumMaximum element:3So:n = 3Step 2 – Length CheckExpected length:n + 1 = 4Actual length:4Valid.Step 3 – Frequency CountFrequency map:NumberCount112132Step 4 – Validate ConditionsNumbers 1 and 2 appear once ✅Number 3 appears twice ✅Return:trueEdge CasesCase 1[1]Invalid because:base[1] = [1,1]Case 2[1,1]Valid.Case 3[1,2,2]Invalid because:n = 2Expected:[1,2,2]Actually valid.Case 4[3,4,4,1,2,1]Invalid because:length != max + 1Optimized Alternative Using SortingAnother clean solution:Sort arrayVerify:nums[i] == i + 1for all except last.Last two elements should be equal.Java Sorting Solutionclass Solution { public boolean isGood(int[] nums) { Arrays.sort(nums); int n = nums.length - 1; for(int i = 0; i < n; i++) { if(nums[i] != i + 1) return false; } return nums[n] == n; }}Time Complexity AnalysisHashMap SolutionTime ComplexityO(N)Space ComplexityO(N)Sorting SolutionTime ComplexityO(N log N)Space ComplexityO(1)excluding sorting overhead.HashMap vs SortingApproachTime ComplexitySpace ComplexityHashMapO(N)O(N)SortingO(N log N)O(1)Interview ExplanationIn interviews, explain:A good array must follow the exact pattern [1,2,3,...,n,n]. The maximum element determines n, and frequency counting helps verify whether all required numbers appear correctly.This demonstrates strong understanding of:Frequency countingValidation logicEdge case handlingCommon Mistakes1. Forgetting Length CheckAlways verify:length == max + 12. Ignoring Missing NumbersArray must contain:1 to ncompletely.3. Wrong Frequency ValidationOnly maximum element should appear twice.All others must appear once.FAQsQ1. Why does maximum element determine n?Because:base[n]always ends with:n,nQ2. Why should array size be n + 1?Because:1 to n-1 => n-1 elementsn repeated twice => 2 elementsTotal = n+1Q3. Which approach is better?HashMap solution is faster.Sorting solution is simpler.Q4. Is this problem important for interviews?Yes.It tests:HashingValidation logicEdge case thinkingRelated ProblemsAfter mastering this problem, practice:Contains DuplicateFind All Duplicates in an ArrayValid AnagramConclusionLeetCode 2784 is a great beginner-friendly hashing problem.It teaches:Frequency countingValidation logicHashMap usageEdge case handlingThe key insight is:A good array must exactly match the structure [1,2,3,...,n,n].Once you understand this pattern, the problem becomes straightforward and easy to implement.

LeetCodeJavaHashMapArrayFrequency CountEasy
Ceil in BST – Java Recursive Binary Search Tree Solution with Dry Run

Ceil in BST – Java Recursive Binary Search Tree Solution with Dry Run

IntroductionThe Ceil in BST problem is one of the most important Binary Search Tree interview questions.This problem teaches:BST traversalRecursive searchingDecision making using BST propertiesTree optimizationInterview-level recursion conceptsThe main challenge is understanding how BST ordering helps us efficiently locate the smallest value greater than or equal to a target number.Problem Link🔗 GeeksforGeeks – Ceil in BSTProblem StatementGiven a Binary Search Tree and an integer:xfind the:Ceil(x)The ceil of a number is:The smallest value in the BST that is greater than or equal to x.If no such value exists:return -1Example 1Inputroot = [5,1,7,N,2,N,N,N,3]x = 3Output3ExplanationSince:3 exists in the BSTthe ceil is:3Example 2Inputroot = [10,5,11,4,7,N,N,N,N,N,8]x = 6Output7ExplanationThe smallest value greater than or equal to:6is:7Key ObservationBinary Search Trees follow:Left subtree -> smaller valuesRight subtree -> greater valuesThis allows efficient searching.IntuitionSuppose:x = 6and current node is:10Since:10 > 6this node can potentially be the answer.But maybe a smaller valid ceil exists in the left subtree.So:Store current node as possible answerMove leftImportant BST LogicIf:root.data == xWe found exact ceil.Return immediately.If:root.data > xCurrent node can be ceil.Move left to find smaller possible ceil.If:root.data < xCurrent node cannot be ceil.Move right.Brute Force ApproachIdeaTraverse the entire BST:Store all values greater than or equal to xReturn minimum among themBrute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)If storing elements.Optimized BST Recursive ApproachUsing BST properties:Ignore unnecessary branchesSearch intelligentlyReduce traversal workJava Solutionclass Solution { int c = -1; int solve(Node root, int x, int c) { if(root == null) return c; if(root.data == x) return root.data; if(root.data > x) { c = root.data; return solve(root.left, x, c); } else { return solve(root.right, x, c); } } int findCeil(Node root, int x) { return solve(root, x, c); }}How the Solution WorksThe recursion maintains:current best ceil candidateWhenever:root.data > xupdate ceil candidate.Then search left subtree for smaller valid answer.Dry RunInput 10 / \ 5 11 / \ 4 7 \ 8x = 6Step 1Current node:10Since:10 > 6Possible ceil:10Move left.Step 2Current node:5Since:5 < 6Move right.Step 3Current node:7Since:7 > 6Update ceil:7Move left.Step 4Left child is null.Return:7Final Answer7Optimized Iterative ApproachYou can also solve this iteratively.Iterative Java Solutionclass Solution { int findCeil(Node root, int x) { int ceil = -1; while(root != null) { if(root.data == x) { return root.data; } if(root.data > x) { ceil = root.data; root = root.left; } else { root = root.right; } } return ceil; }}Why Iterative is BetterIterative solution avoids recursion stack.Better for:Large treesMemory optimizationInterview follow-up questionsTime Complexity AnalysisBest CaseO(log N)Balanced BST.Worst CaseO(N)Skewed BST.Space ComplexityRecursiveO(H)Recursion stack.IterativeO(1)Extra space.Interview ExplanationIn interviews explain:Since BST maintains sorted ordering, we can intelligently move left or right. Whenever a node is greater than x, it becomes a potential ceil candidate.This demonstrates:BST understandingRecursive reasoningSearch optimizationEfficient traversal logicCommon Mistakes1. Traversing Entire TreeUnnecessary because BST already provides ordering.2. Not Updating Ceil ProperlyAlways update:ceil = root.databefore moving left.3. Returning First Greater ElementNeed the:smallest greater valuenot just any greater value.4. Ignoring Exact MatchIf:root.data == xreturn immediately.FAQsQ1. What is ceil in BST?Smallest value greater than or equal to x.Q2. Why move left after finding larger value?To search for a smaller valid ceil.Q3. Can this be solved iteratively?Yes.Iterative solution is highly optimized.Q4. What if ceil does not exist?Return:-1Related BST ProblemsPractice these next:Search in BSTInsert into BSTKth Smallest in BSTLowest Common Ancestor in BSTConclusionCeil in BST is an excellent problem for learning:BST traversalRecursive decision makingSearch optimizationInterview tree logicThe key insight is:Whenever a node is greater than x, it becomes a potential answer, but a smaller valid ceil may still exist in the left subtree.Mastering this concept makes many BST interview problems significantly easier.

Binary Search TreeBSTJavaRecursionGFGMedium
LeetCode 104: Maximum Depth of Binary Tree – Java Recursive Solution Explained

LeetCode 104: Maximum Depth of Binary Tree – Java Recursive Solution Explained

IntroductionLeetCode 104 – Maximum Depth of Binary Tree is one of the most important beginner tree problems in Data Structures and Algorithms.This problem teaches:Binary Tree TraversalDepth First Search (DFS)RecursionTree Height CalculationDivide and ConquerIt is one of the most frequently asked tree questions in coding interviews because it builds the foundation for:Tree recursionHeight problemsBalanced tree problemsDiameter problemsDFS traversalIf you are starting binary trees, this is one of the best problems to master first.Problem Link🔗 https://leetcode.com/problems/maximum-depth-of-binary-tree/Problem StatementGiven the root of a binary tree:Return:Maximum depth of the treeMaximum depth means:Number of nodes along the longest path from root to the farthest leaf node.Example 1Inputroot = [3,9,20,null,null,15,7]Tree: 3 / \ 9 20 / \ 15 7Output3Explanation:Longest path:3 → 20 → 15contains:3 nodesExample 2Inputroot = [1,null,2]Tree:1 \ 2Output:2Understanding Maximum DepthDepth means:How many levels exist in the treeFor example: 1 / \ 2 3 / 4Levels:Level 1 → 1Level 2 → 2,3Level 3 → 4Maximum depth:3Key ObservationThe depth of a tree depends on:Maximum depth of left subtreeandMaximum depth of right subtreeSo:Depth(root)=1 + max(leftDepth, rightDepth)This is the core recursive formula.Recursive IntuitionAt every node:Find depth of left subtreeFind depth of right subtreeTake maximumAdd current nodeThis naturally becomes a recursive DFS problem.Java Recursive Solutionclass Solution { public int maxDepth(TreeNode root) { if(root == null) return 0; int left = maxDepth(root.left); int right = maxDepth(root.right); return 1 + Math.max(left, right); }}Why This WorksAt every node:Recursively calculate left depthRecursively calculate right depthChoose bigger depthAdd:1for current node.This continues until leaf nodes.Dry RunInput 3 / \ 9 20 / \ 15 7Step 1Start from root:3Step 2Left subtree:9Depth:1Step 3Right subtree:20Its children:15 and 7Depth becomes:2Step 4At root:1 + max(1,2)Result:3Recursive Call FlowmaxDepth(3) ├── maxDepth(9) │ ├── 0 │ └── 0 │ └── maxDepth(20) ├── maxDepth(15) └── maxDepth(7)Then values return upward.Alternative BFS ApproachWe can also solve this using:Level Order Traversalusing a queue.Every level increases depth by:1BFS Java Solutionclass Solution { public int maxDepth(TreeNode root) { if(root == null) return 0; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); int depth = 0; while(!queue.isEmpty()) { int size = queue.size(); for(int i = 0; i < size; i++) { TreeNode node = queue.poll(); if(node.left != null) queue.offer(node.left); if(node.right != null) queue.offer(node.right); } depth++; } return depth; }}DFS vs BFSApproachTechniqueSpaceDFSRecursionO(H)BFSQueueO(N)Time Complexity AnalysisRecursive DFS SolutionTime ComplexityO(N)because every node is visited once.Space ComplexityO(H)where:H = tree heightWorst case:O(N)for skewed tree.BFS SolutionTime ComplexityO(N)Space ComplexityO(N)queue may contain full level.Interview ExplanationIn interviews, explain:The depth of a node depends on the maximum depth between its left and right subtree. This naturally forms a recursive divide-and-conquer problem.This demonstrates:Tree recursion understandingDFS traversal knowledgeDivide and conquer thinkingCommon Mistakes1. Forgetting Base CaseAlways handle:if(root == null) return 0;2. Using Min Instead of MaxWe need:Longest pathnot shortest.3. Incorrect Depth CountingRemember to add:1for current node.FAQsQ1. What is maximum depth?It is the number of nodes in the longest root-to-leaf path.Q2. Why is recursion preferred?Tree problems naturally fit recursive structures.Q3. Can this be solved iteratively?Yes.Using BFS with queue.Q4. Is this problem important for interviews?Very important.It is one of the most fundamental tree recursion problems.Related ProblemsAfter mastering this problem, practice:Minimum Depth of Binary TreeBalanced Binary TreeDiameter of Binary TreeBinary Tree Level Order TraversalPath SumConclusionLeetCode 104 is one of the most important beginner binary tree problems.It teaches:Recursive DFSTree height calculationDivide and conquerBinary tree traversalThe key insight is:Maximum depth equals 1 + maximum depth of left and right subtree.Once this recursive pattern becomes clear, many advanced tree problems become easier to solve.

LeetCodeDepth of Binary TreeJavaBinary TreeDFSBFSRecursionTreeEasy
LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 94 – Binary Tree Inorder Traversal is one of the most important beginner-friendly tree problems in Data Structures and Algorithms.This problem helps you understand:Binary tree traversalDepth First Search (DFS)RecursionStack-based traversalTree interview fundamentalsIt is commonly asked in coding interviews because tree traversal forms the foundation of many advanced tree problems.Problem Link🔗 ProblemLeetCode 94: Binary Tree Inorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the inorder traversal of its nodes' values.What is Inorder Traversal?In inorder traversal, we visit nodes in this order:Left → Root → RightExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Inorder TraversalStep-by-step:1 → 3 → 2Output:[1,3,2]Recursive Approach (Most Common)IntuitionIn inorder traversal:Traverse left subtreeVisit current nodeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal order:Left → Node → RightRecursive function:inorder(node.left)visit(node)inorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);list.add(root.val);solve(list, root.right);}public List<Integer> inorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Add:1Step 2Move right to:2Move left to:3Add:3Return back.Add:2Final Answer[1,3,2]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Inorder IntuitionThe recursive order is:Left → Node → RightSo iteratively:Keep pushing left nodes into stackProcess current nodeMove to right subtreeStack-Based Traversal LogicAlgorithmWhile current node exists OR stack is not empty:Push all left nodesPop top nodeAdd node valueMove to right subtreeJava Iterative Solutionclass Solution {public List<Integer> inorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();Stack<TreeNode> stack = new Stack<>();TreeNode curr = root;while(curr != null || !stack.isEmpty()) {while(curr != null) {stack.push(curr);curr = curr.left;}curr = stack.pop();ans.add(curr.val);curr = curr.right;}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Stack:[1]Step 2Pop:1Add:1Move right to:2Step 3Push:23Stack:[2,3]Step 4Pop:3Add:3Step 5Pop:2Add:2Final Answer[1,3,2]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to write and understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:In inorder traversal, we process nodes in Left → Root → Right order. Recursion naturally fits this traversal. For iterative traversal, we use a stack to simulate recursive calls.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct inorder:Left → Root → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Stack Handling ErrorsIn iterative traversal:Push all left nodes firstThen process nodeThen move rightFAQsQ1. Why is inorder traversal important?It is heavily used in:Binary Search TreesExpression treesTree reconstruction problemsQ2. What is the inorder traversal of a BST?It produces values in sorted order.Q3. Which approach is better for interviews?Recursive is easier.Iterative is preferred for deeper interview rounds.Q4. Can inorder traversal be done without stack or recursion?Yes.Using Morris Traversal with:O(1)space.Bonus: Morris Traversal (Advanced)Morris Traversal performs inorder traversal without recursion or stack.ComplexityTime ComplexityO(N)Space ComplexityO(1)This is an advanced interview optimization.ConclusionLeetCode 94 is one of the most fundamental tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key inorder pattern is:Left → Root → RightMastering this problem builds a strong foundation for advanced tree interview questions like:BST validationTree iteratorsTree reconstructionMorris traversalKth smallest in BST

LeetCodeBinary Tree Inorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
LeetCode 88 Merge Sorted Array Explained: Brute Force to Optimal Java Solution (3 Pointer Approach)

LeetCode 88 Merge Sorted Array Explained: Brute Force to Optimal Java Solution (3 Pointer Approach)

IntroductionLeetCode 88 — Merge Sorted Array is one of the most important beginner-friendly array problems asked in coding interviews.At first glance, the problem looks very easy because both arrays are already sorted. But the real challenge is:How do we merge them efficiently without using extra space?This question is commonly asked by companies because it tests:Array manipulationTwo pointer techniqueIn-place modificationEdge case handlingSpace optimizationThe most important learning from this problem is understanding:Why merging from the back is the optimal strategy.In this article, we will cover:Problem understandingBrute force approachBetter approachOptimal 3-pointer solutionStep-by-step dry runTime & space complexityCommon mistakesInterview tipsFAQsBy the end, you will completely understand the logic behind this problem.Try This Problem👉 https://leetcode.com/problems/merge-sorted-array/Problem StatementYou are given two sorted arrays:nums1nums2Along with two integers:m → valid elements in nums1n → elements in nums2The array nums1 has size:m + nThe last n positions are empty spaces represented by 0.Your task is to merge nums2 into nums1 such that the final array remains sorted.ExampleExample 1Inputnums1 = [1,2,3,0,0,0]m = 3nums2 = [2,5,6]n = 3Output[1,2,2,3,5,6]Understanding the ProblemLet us simplify what the question is asking.We have:nums1 → already sortednums2 → already sortedWe need:one final sorted arrayBut there is one important condition:We must store the answer inside nums1 itself.That means:No returning new arrayModify nums1 directlyWhy This Problem is TrickyMany beginners immediately think:Copy nums2 into nums1Then sort nums1This works.But interviews usually expect a more optimized solution.The challenge is:Can we merge without sorting again?Yes — using the Two Pointer technique.Approach 1 — Brute Force SolutionIdeaCopy all elements of nums2 into empty positions of nums1Sort the final arrayJava Codeclass Solution { public void merge(int[] nums1, int m, int[] nums2, int n) { // Copy nums2 into nums1 for(int i = 0; i < n; i++) { nums1[m + i] = nums2[i]; } // Sort final array Arrays.sort(nums1); }}Dry Run of Brute ForceInitial:nums1 = [1,2,3,0,0,0]nums2 = [2,5,6]After copying:[1,2,3,2,5,6]After sorting:[1,2,2,3,5,6]Time ComplexityCopyingO(n)SortingO((m+n) log(m+n))Space ComplexityO(1)Drawback of Brute ForceSorting again is unnecessary because:Arrays are already sortedWe can merge smarterApproach 2 — Extra Array MergeIdeaUse a third temporary array.This works exactly like merge step in Merge Sort.StepsCompare elements from both arraysInsert smaller one into temp arrayCopy final temp array into nums1Java Codeclass Solution { public void merge(int[] nums1, int m, int[] nums2, int n) { int[] temp = new int[m + n]; int i = 0; int j = 0; int k = 0; while(i < m && j < n) { if(nums1[i] <= nums2[j]) { temp[k++] = nums1[i++]; } else { temp[k++] = nums2[j++]; } } while(i < m) { temp[k++] = nums1[i++]; } while(j < n) { temp[k++] = nums2[j++]; } for(i = 0; i < m + n; i++) { nums1[i] = temp[i]; } }}Time ComplexityO(m + n)Space ComplexityO(m + n)Can We Do Better?Yes.The interview-expected solution uses:Optimal Approach — Three Pointers from BackMost Important ObservationThe end of nums1 already contains empty spaces.So instead of merging from front:We merge from the back.This avoids overwriting important elements.Main IdeaWe use 3 pointers:left → last valid element in nums1right → last element in nums2insertPos → last position of nums1We compare:nums1[left]nums2[right]The larger element is placed at:nums1[insertPos]Then move pointers backward.Why Backward Merging WorksSuppose:nums1 = [1,2,3,0,0,0]nums2 = [2,5,6]If we start from front:we overwrite existing valuesBut from back:empty spaces already existSo no data loss occurs.Optimal Java Solutionclass Solution { public void merge(int[] nums1, int m, int[] nums2, int n) { int left = m - 1; int right = n - 1; int insertPos = m + n - 1; for(int i = insertPos; i >= 0; i--) { if(right < 0 || (left >= 0 && nums1[left] >= nums2[right])) { nums1[i] = nums1[left]; left--; } else { nums1[i] = nums2[right]; right--; } } }}Step-by-Step Dry RunInputnums1 = [1,2,3,0,0,0]nums2 = [2,5,6]Initial Pointersleft = 2 → value 3right = 2 → value 6insertPos = 5Step 1Compare:3 vs 66 is larger.Place 6 at end.[1,2,3,0,0,6]Move:right--insertPos--Step 2Compare:3 vs 5Place 5.[1,2,3,0,5,6]Step 3Compare:3 vs 2Place 3.[1,2,3,3,5,6]Step 4Compare:2 vs 2Place 2.[1,2,2,3,5,6]Done.Time ComplexityWe traverse both arrays once.O(m + n)Space ComplexityNo extra space used.O(1)Why This is the Best SolutionThis solution is optimal because:✅ No sorting required ✅ No extra array required ✅ Single traversal ✅ In-place merging ✅ Interview preferred solutionCommon Mistakes1. Merging from FrontThis overwrites elements in nums1.2. Forgetting Edge CasesExample:m = 0orn = 03. Wrong Pointer InitializationCorrect:left = m - 1right = n - 14. Array Index Out of BoundsAlways check:left >= 0right >= 0Interview TipsIf interviewer asks:“Why merge from back?”Your answer:Because nums1 already has empty spaces at the end. Backward traversal prevents overwriting existing sorted elements.Frequently Asked QuestionsQ1. Why not use sorting?Because arrays are already sorted.Sorting again wastes time.Q2. Why start from end?To safely place larger elements without overwriting.Q3. Is this similar to Merge Sort?Yes.This is essentially the merge step of Merge Sort.Q4. What if nums2 is empty?Then nums1 remains unchanged.Q5. What if nums1 has no valid elements?Then copy all elements from nums2.Final TakeawayThe biggest learning from this problem is:Whenever extra space exists at the end of an array, think about backward traversal.This pattern appears frequently in interview questions.ConclusionLeetCode 88 is one of the best beginner problems to master:Two pointersIn-place array modificationEfficient mergingSpace optimizationAlthough the brute force solution works, the optimal 3-pointer approach is the real interview solution.Once you understand why backward merging works, this problem becomes extremely easy to solve in interviews and coding rounds.

ArraysTwo PointersSortingJavaEasyLeetcode
LeetCode 2196: Create Binary Tree From Descriptions – Java HashMap & Tree Construction Solution

LeetCode 2196: Create Binary Tree From Descriptions – Java HashMap & Tree Construction Solution

IntroductionBinary tree construction problems are extremely common in coding interviews because they test multiple concepts together:Tree data structuresHashMap usageParent-child relationshipsGraph-style thinkingRoot identificationLeetCode 2196 is an excellent medium-level problem that focuses on constructing a binary tree from parent-child descriptions efficiently.In this article, we will deeply understand:How the tree is formedHow to identify the root nodeWhy HashMap is useful hereStep-by-step dry runTime and space complexityComplete optimized Java solutionProblem StatementYou are given a 2D array:descriptions[i] = [parent, child, isLeft]Where:parent is the parent nodechild is the child nodeisLeft == 1 means left childisLeft == 0 means right childYour task is to:Construct the binary treeReturn the root nodeHere is the Link to try it now -: Create Binary Tree From DescriptionsExampleInputdescriptions = [ [20,15,1], [20,17,0], [50,20,1], [50,80,0], [80,19,1]]Output[50,20,80,15,17,19]Visual Representation 50 / \ 20 80 / \ / 15 17 19Key ObservationEvery node except the root appears as a child exactly once.This means:Root node never appears in child positionsIf we store all child nodes,The node not present in the child set becomes the rootThis is the core trick of the problem.Approach OverviewWe solve the problem in 3 steps:Step 1: Find the Root NodeStore every child node in a HashSet.Then iterate through descriptions again:The parent that never appears as a child is the root.Step 2: Create Tree NodesUse a HashMap:value → TreeNodeThis prevents duplicate node creation.Step 3: Connect Parent and ChildBased on:isLeftattach nodes accordingly.Optimized Java Solutionclass Solution { public TreeNode createBinaryTree(int[][] descriptions) { HashSet<Integer> childSet = new HashSet<>(); // Store all child nodes for (int[] arr : descriptions) { childSet.add(arr[1]); } // Find root node int rootValue = -1; for (int[] arr : descriptions) { if (!childSet.contains(arr[0])) { rootValue = arr[0]; } } // Map value -> TreeNode HashMap<Integer, TreeNode> map = new HashMap<>(); for (int i = 0; i < descriptions.length; i++) { int parent = descriptions[i][0]; int child = descriptions[i][1]; int isLeft = descriptions[i][2]; // Create parent node if absent if (!map.containsKey(parent)) { map.put(parent, new TreeNode(parent)); } // Create child node if absent if (!map.containsKey(child)) { map.put(child, new TreeNode(child)); } // Connect nodes if (isLeft == 1) { map.get(parent).left = map.get(child); } else { map.get(parent).right = map.get(child); } } return map.get(rootValue); }}Step-by-Step ExplanationStep 1: Store All Child NodeschildSet.add(arr[1]);Every child is stored.Since root never becomes a child,it will not exist inside this set.Step 2: Identify Rootif (!childSet.contains(arr[0]))This finds the node that only acts as parent.That node becomes the root.Step 3: Create Unique Tree NodesHashMap<Integer, TreeNode> mapAvoids duplicate node creation.Each value maps to exactly one TreeNode.Step 4: Connect Parent and Childmap.get(parent).left = map.get(child);ormap.get(parent).right = map.get(child);depending on:isLeftDry RunInput[ [20,15,1], [20,17,0], [50,20,1], [50,80,0], [80,19,1]]Child Set15, 17, 20, 80, 19Root DetectionCheck parents:20 → exists in child set50 → NOT in child setSo:Root = 50Tree Construction50left → 20right → 8020left → 15right → 1780left → 19Final tree becomes: 50 / \ 20 80 / \ / 15 17 19Time ComplexityBuilding Child SetO(N)Finding RootO(N)Constructing TreeO(N)Total Time ComplexityO(N)Efficient for large constraints.Space ComplexityHashMap + HashSetO(N)Why This Problem is ImportantThis problem teaches:Tree constructionParent-child mappingRoot identificationEfficient object reuseHashMap optimizationIt is frequently asked in interviews because it combines multiple concepts in one clean implementation.Common Mistakes1. Creating Duplicate NodesWrong:new TreeNode(parent)every time.Always reuse nodes through HashMap.2. Incorrect Root DetectionRemember:Root never appears as child.3. Forgetting Left vs Right ChildAlways check:isLeftbefore attaching.Interview TipsIn interviews explain:We first identify the root using a child set, then use a HashMap to create and reuse TreeNode objects efficiently while connecting parent-child relationships.This demonstrates:Strong data structure understandingEfficient memory usageClean tree construction logicRelated ProblemsPractice these next:Construct Binary Tree from TraversalsValidate Binary Search TreeSerialize and Deserialize Binary TreeLowest Common AncestorBinary Tree Level Order TraversalConclusionLeetCode 2196 is a clean and elegant binary tree construction problem.The major insight is:The root node is the only node that never appears as a child.Combined with HashMap-based node reuse, we can construct the entire tree efficiently in linear time.This is an excellent interview problem for mastering tree construction patterns.

LeetCodeJavaTreeHashMapHashSetBinary TreeMedium
Floor in BST – Java Recursive Binary Search Tree Solution with Dry Run

Floor in BST – Java Recursive Binary Search Tree Solution with Dry Run

IntroductionThe Floor in BST problem is one of the most important Binary Search Tree interview questions for beginners.This problem helps you understand:BST traversalRecursive searchingTree optimizationDecision making using BST propertiesEfficient searching techniquesThe main idea is to efficiently find the:Greatest value smaller than or equal to k.Problem Link🔗 GeeksforGeeks – Floor in BSTProblem StatementGiven the root of a Binary Search Tree and an integer:kfind the:Floor(k)The floor of a number is:The greatest value in the BST that is less than or equal to k.If no such value exists:return -1Example 1Inputroot = [10,7,15,2,8,11,16]k = 14Output11ExplanationThe largest value smaller than or equal to:14is:11Example 2Inputroot = [5,2,12,1,3,9,21,null,null,null,null,null,null,19,25]k = 24Output21Key ObservationBinary Search Tree follows:Left subtree -> smaller valuesRight subtree -> greater valuesThis ordering allows optimized searching.IntuitionSuppose:k = 14and current node is:10Since:10 < 14this node can potentially be the floor.But maybe there exists a larger valid floor in the right subtree.So:Store current node as possible answerMove rightBST LogicCase 1If:root.data == kthen exact floor exists.Return immediately.Case 2If:root.data > kcurrent node cannot be floor.Move left.Case 3If:root.data < kcurrent node becomes possible floor.Move right to search for larger valid answer.Brute Force ApproachIdeaTraverse the entire BST:Store all values smaller than or equal to kReturn maximum among themBrute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)If storing nodes.Optimized Recursive BST ApproachUsing BST properties:Ignore unnecessary branchesSearch efficientlyReduce traversal operationsJava Solutionclass Solution { int f = -1; public int findMaxFork(Node root, int k) { if(root == null) return f; if(root.data == k) return root.data; if(root.data > k) { return findMaxFork(root.left, k); } else { f = root.data; return findMaxFork(root.right, k); } }}How the Solution WorksWhenever:root.data < kthe node becomes a possible floor candidate.But there may exist a larger valid floor in the right subtree.So:Save current nodeMove rightDry RunInput 10 / \ 7 15 / \ / \ 2 8 11 16k = 14Step 1Current node:10Since:10 < 14Possible floor:10Move right.Step 2Current node:15Since:15 > 14Move left.Step 3Current node:11Since:11 < 14Update floor:11Move right.Step 4Right child is null.Return:11Final Answer11Optimized Iterative ApproachThe same problem can also be solved iteratively.Iterative Java Solutionclass Solution { int findFloor(Node root, int k) { int floor = -1; while(root != null) { if(root.data == k) { return root.data; } if(root.data > k) { root = root.left; } else { floor = root.data; root = root.right; } } return floor; }}Why Iterative Approach is BetterAdvantages:Avoids recursion stackMore memory efficientBetter for skewed treesPreferred in some interviewsTime Complexity AnalysisBest CaseO(log N)Balanced BST.Worst CaseO(N)Skewed BST.Space ComplexityRecursiveO(H)where H is tree height.IterativeO(1)extra space.Interview ExplanationIn interviews explain:Whenever we encounter a node smaller than k, it becomes a possible floor candidate. Then we move right to search for a larger valid floor.This demonstrates:BST property understandingSearch optimizationRecursive reasoningEfficient traversalCommon Mistakes1. Traversing Entire TreeBST ordering already helps reduce search space.2. Forgetting to Update FloorAlways update:floor = root.databefore moving right.3. Returning First Smaller ValueNeed the:largest smaller valuenot any smaller value.4. Ignoring Exact MatchIf:root.data == kreturn immediately.FAQsQ1. What is floor in BST?Largest value smaller than or equal to k.Q2. Why move right after finding smaller value?To search for a larger valid floor.Q3. Can this be solved iteratively?Yes.Iterative solution is highly optimized.Q4. What if floor does not exist?Return:-1Related BST ProblemsPractice these next:Ceil in BSTSearch in BSTInsert into BSTValidate BSTLowest Common Ancestor in BSTConclusionFloor in BST is an excellent problem for understanding:BST traversalRecursive searchingSearch space optimizationInterview tree conceptsThe key insight is:Whenever a node is smaller than k, it becomes a possible floor candidate, but a larger valid floor may still exist in the right subtree.Mastering this logic makes many BST interview problems much easier.

BSTBinary Search TreeJavaGFGRecursionTree Data StructureEasy
LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

IntroductionThe Letter Case Permutation problem is a classic example of recursion and backtracking, often asked in coding interviews and frequently searched by learners preparing for platforms like LeetCode.This problem helps in understanding:Decision-making at each stepRecursive branchingString manipulationIn this article, we’ll break down the intuition, visualize the decision process using your decision tree, and implement an efficient Java solution.🔗 Problem LinkLeetCode: Letter Case PermutationProblem StatementGiven a string s, you can transform each alphabet character into:LowercaseUppercaseDigits remain unchanged.👉 Return all possible strings formed by these transformations.ExamplesExample 1Input:s = "a1b2"Output:["a1b2","a1B2","A1b2","A1B2"]Example 2Input:s = "3z4"Output:["3z4","3Z4"]Key InsightAt each character:If it's a digit → only one choiceIf it's a letter → two choices:lowercase OR uppercaseSo total combinations:2^(number of letters)Intuition (Using Your Decision Tree)For input: "a1b2"Start from index 0: "" / \ "a" "A" | | "a1" "A1" / \ / \ "a1b" "a1B" "A1b" "A1B" | | | | "a1b2" "a1B2" "A1b2" "A1B2"Understanding the TreeAt 'a' → branch into 'a' and 'A''1' → no branching (digit)'b' → again branching'2' → no branching📌 Leaf nodes = final answersApproach: Recursion + BacktrackingIdeaTraverse the string character by characterIf digit → move forwardIf letter → branch into:lowercaseuppercaseJava Codeimport java.util.*;class Solution { // List to store all results List<String> lis = new ArrayList<>(); public void solve(String s, int ind, String ans) { // Base case: reached end of string if (ind == s.length()) { lis.add(ans); // store generated string return; } char ch = s.charAt(ind); // If character is a digit → only one option if (ch >= '0' && ch <= '9') { solve(s, ind + 1, ans + ch); } else { // Choice 1: convert to lowercase solve(s, ind + 1, ans + Character.toLowerCase(ch)); // Choice 2: convert to uppercase solve(s, ind + 1, ans + Character.toUpperCase(ch)); } } public List<String> letterCasePermutation(String s) { solve(s, 0, ""); // start recursion return lis; }}Step-by-Step ExecutionFor "a1b2":Start → ""'a' → "a", "A"'1' → "a1", "A1"'b' → "a1b", "a1B", "A1b", "A1B"'2' → final stringsComplexity AnalysisTime Complexity: O(2^n)(n = number of letters)Space Complexity: O(2^n)(for storing results)Why This Approach WorksRecursion explores all possibilitiesEach letter creates a branching pointDigits pass through unchangedBacktracking ensures all combinations are generatedKey TakeawaysThis is a binary decision recursion problemLetters → 2 choicesDigits → 1 choiceDecision tree directly maps to recursionPattern similar to:SubsetsPermutations with conditionsWhen This Problem Is AskedCommon in:Coding interviewsRecursion/backtracking roundsString manipulation problemsConclusionThe Letter Case Permutation problem is a perfect example of how recursion can be used to explore all possible combinations efficiently.Once the decision tree is clear, the implementation becomes straightforward. This pattern is widely used in many advanced problems, making it essential to master.Frequently Asked Questions (FAQs)1. Why don’t digits create branches?Because they have only one valid form.2. What is the main concept used?Recursion with decision-making (backtracking).3. Can this be solved iteratively?Yes, using BFS or iterative expansion, but recursion is more intuitive.

LeetCodeMediumJavaRecursion
LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

IntroductionLeetCode 3120 – Count the Number of Special Characters I is a beginner-friendly string and hashing problem.This problem focuses on:Character manipulationUppercase and lowercase conversionHashSet usageString traversalBasic optimization techniquesIt is a good interview problem for testing:Understanding of ASCII charactersJava Character methodsSet operationsProblem-solving logicProblem Link🔗 https://leetcode.com/problems/count-the-number-of-special-characters-i/Problem StatementYou are given a string:wordA character is called:specialif it appears in both:LowercaseUppercaseReturn:Total number of special charactersExample 1Inputword = "aaAbcBC"Output3ExplanationCharacters:'a' and 'A''b' and 'B''c' and 'C'All appear in both cases.So answer is:3Example 2Inputword = "abc"Output:0No uppercase letters exist.Example 3Inputword = "abBCab"Output:1Only:'b' and 'B'appear in both forms.IntuitionWe need to check:For every lowercase character:Does its uppercase version exist?Using HashSet makes lookup very fast.Brute Force ApproachIdeaFor every character:Traverse entire stringSearch for uppercase/lowercase pairCount valid matchesBrute Force ComplexityTime ComplexityO(N²)because nested traversal is required.Space ComplexityO(1)Optimized HashSet ApproachIdeaUse two sets:One for lowercase lettersOne for uppercase lettersThen check matching pairs.Java Solutionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(int i = 0; i < word.length(); i++) {if(word.charAt(i) >= 'a' && word.charAt(i) <= 'z') {lower.add(word.charAt(i));}else {upper.add(word.charAt(i));}}int ans = 0;for(int i = 0; i < word.length(); i++) {char up = Character.toUpperCase(word.charAt(i));if(lower.contains(word.charAt(i)) && upper.contains(up)) {ans++;lower.remove(word.charAt(i));upper.remove(up);}}return ans;}}Cleaner Optimized Versionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(char ch : word.toCharArray()) {if(Character.isLowerCase(ch)) {lower.add(ch);}else {upper.add(ch);}}int count = 0;for(char ch : lower) {if(upper.contains(Character.toUpperCase(ch))) {count++;}}return count;}}Why This WorksWe separate:Lowercase charactersUppercase charactersThen for every lowercase letter:We check whether uppercase version exists.HashSet lookup works in:O(1)average time.Dry RunInputword = "aaAbcBC"Step 1Lowercase set:[a, b, c]Uppercase set:[A, B, C]Step 2Check:'a' → 'A' exists'b' → 'B' exists'c' → 'C' existsCount becomes:3Final Answer3Time Complexity AnalysisOptimized HashSet SolutionTime ComplexityO(N)because string traversal happens only once.Space ComplexityO(1)Maximum alphabet size is fixed:26 lowercase + 26 uppercaseBrute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashSet ApproachO(N)O(1)Interview ExplanationIn interviews, explain:We use two HashSets to separately store lowercase and uppercase letters. Then we check whether a lowercase character has its uppercase counterpart.This demonstrates:Efficient lookup usageHashing knowledgeCharacter manipulation skillsCommon Mistakes1. Double Counting CharactersWithout removing counted characters:same letter may be counted multiple times2. Forgetting Case ConversionAlways convert:Character.toUpperCase(ch)before comparison.3. Using Nested Loops UnnecessarilyHashSet reduces lookup complexity significantly.FAQsQ1. Why use HashSet?Because lookup operations are very fast.Q2. Can this be solved without extra space?Yes.Using arrays of size 26 is also possible.Q3. Why remove characters after counting?To avoid duplicate counting.Q4. Is this problem important for interviews?Yes.It tests:String handlingCharacter conversionHashSet usageOptimization thinkingRelated ProblemsPractice these next:Valid AnagramFirst Unique Character in a StringRansom NoteConclusionLeetCode 3120 is a simple but effective problem for learning:HashSet operationsString traversalCase conversionEfficient lookup techniquesThe key idea is:Store lowercase and uppercase letters separately, then check matching pairs efficiently.Once this pattern becomes clear, many string hashing problems become much easier.

LeetCodeJavaHashSetStringEasy
LeetCode 2126: Destroying Asteroids – Java Greedy Algorithm Solution with Dry Run

LeetCode 2126: Destroying Asteroids – Java Greedy Algorithm Solution with Dry Run

IntroductionLeetCode 2126 – Destroying Asteroids is a classic greedy algorithm problem that tests your ability to:Recognize optimal orderingUse sorting effectivelyApply greedy decision-makingHandle large integer growthUnderstand simulation problemsThis is a very interview-friendly problem because the optimal strategy is not immediately obvious.Problem Link🔗 https://leetcode.com/problems/destroying-asteroids/Problem StatementYou are given:An integer mass representing the planet’s initial massAn array asteroidsRules:If planet mass ≥ asteroid mass → asteroid is destroyedPlanet gains asteroid massOtherwise → planet gets destroyedReturn:true -> if all asteroids can be destroyedfalse -> otherwiseExampleInputmass = 10asteroids = [3,9,19,5,21]OutputtrueKey ObservationThe most important insight:Destroy smaller asteroids first.Why?Because every destroyed asteroid increases planet mass.So destroying smaller asteroids early helps you grow enough to destroy larger ones later.IntuitionSuppose:mass = 5asteroids = [100,1,2]If you attack:100 firstYou instantly lose.But if you destroy:1 → 2Your mass becomes:5 + 1 + 2 = 8Still not enough for 100.So answer remains false.This demonstrates:Ordering matters.Greedy StrategyThe optimal strategy is:Step 1Sort asteroids in ascending order.Step 2Destroy the smallest asteroid possible first.Step 3Keep increasing mass.Why Sorting WorksIf you cannot destroy the smallest remaining asteroid:You definitely cannot destroy larger asteroids either.That is why sorting guarantees the optimal greedy order.Java Solutionclass Solution { public boolean asteroidsDestroyed(int mass, int[] asteroids) { Arrays.sort(asteroids); if(mass >= asteroids[asteroids.length - 1]) { return true; } for(int i = 0; i < asteroids.length; i++) { if(mass >= asteroids[asteroids.length - 1]) { return true; } if(asteroids[i] <= mass) { mass += asteroids[i]; } if(mass < asteroids[i]) { return false; } } return true; }}Cleaner Optimized VersionOne important improvement:Use long instead of int.Why?Because mass can grow very large.Optimized Java Solutionclass Solution { public boolean asteroidsDestroyed(int mass, int[] asteroids) { Arrays.sort(asteroids); long currentMass = mass; for(int asteroid : asteroids) { if(currentMass < asteroid) { return false; } currentMass += asteroid; } return true; }}Why Use Long?Constraints allow:1 <= asteroids.length <= 1000001 <= asteroid[i] <= 100000Mass can exceed:Integer.MAX_VALUEUsing long prevents overflow issues.Dry RunInputmass = 10asteroids = [3,9,19,5,21]Step 1: Sort[3,5,9,19,21]Step 2: Destroy AsteroidsDestroy 310 >= 3mass = 13Destroy 513 >= 5mass = 18Destroy 918 >= 9mass = 27Destroy 1927 >= 19mass = 46Destroy 2146 >= 21mass = 67All asteroids destroyed.Final OutputtrueBrute Force ApproachA brute force approach would try:All possible asteroid ordersThis means:N! permutationsWhich is impossible for:N = 100000So brute force is completely infeasible.Why Greedy Is OptimalGreedy works because:Smaller asteroids are easiest to destroyThey increase massIncreased mass helps destroy bigger asteroidsThis creates a natural optimal progression.Time Complexity AnalysisSortingO(N log N)TraversalO(N)Total Time ComplexityO(N log N)Space ComplexityO(1)Ignoring sorting space.Interview ExplanationIn interviews, explain:Since destroying an asteroid increases our mass, the optimal strategy is to destroy smaller asteroids first. Sorting ensures we always maximize future growth opportunities.This demonstrates:Greedy thinkingSorting optimizationSimulation handlingProof of correctnessCommon Mistakes1. Not SortingWithout sorting:You may attempt larger asteroids too early.2. Using int Instead of longMass can overflow.Always use:long currentMass3. Brute Force PermutationsTrying all orders leads to:O(N!)which is impossible.4. Incorrect Early ReturnYour logic should only fail when:currentMass < asteroidFAQsQ1. Why is sorting necessary?Sorting guarantees we always destroy the smallest possible asteroid first.Q2. Is this a greedy problem?Yes.The optimal local decision:Destroy smallest asteroid firstleads to global optimality.Q3. Why use long?Because mass can grow beyond integer limits.Q4. Is this asked in interviews?Yes.It is a common greedy + sorting interview problem.ConclusionLeetCode 2126 is an excellent greedy problem for mastering:Sorting-based optimizationGreedy decision-makingSimulation problemsOverflow handlingInterview reasoningThe key insight is:Always destroy smaller asteroids first to maximize future mass growth.Once this greedy intuition becomes natural, many scheduling and optimization problems become easier to solve.

LeetCodeGreedy AlgorithmJavaSortingArrayMedium
LeetCode 2657: Find the Prefix Common Array of Two Arrays – Java Hashing Solution Explained

LeetCode 2657: Find the Prefix Common Array of Two Arrays – Java Hashing Solution Explained

IntroductionLeetCode 2657 – Find the Prefix Common Array of Two Arrays is an interesting prefix and hashing problem that tests your understanding of:Prefix processingHashingFrequency countingSet operationsArray traversalAt first glance, the problem may look confusing because of the term:Prefix Common ArrayBut once you understand the meaning of prefixes and common elements, the problem becomes straightforward.This problem is useful for improving:Prefix-based thinkingHashing intuitionOptimization skillsInterview problem-solving abilityProblem Link🔗 Find the prefix Common Array of Two ArraysProblem StatementYou are given two permutations:A and BBoth arrays contain numbers:1 to nexactly once.You need to create an array:Cwhere:C[i]represents:Count of numbers present in both arrays from index 0 to i.Understanding Prefix Common ArraySuppose:A = [1,3,2,4]B = [3,1,2,4]Prefix at Index 0A Prefix = [1]B Prefix = [3]Common numbers:NoneSo:C[0] = 0Prefix at Index 1A Prefix = [1,3]B Prefix = [3,1]Common numbers:1, 3So:C[1] = 2Final Output[0,2,3,4]Key ObservationBoth arrays are permutations.This means:Every number appears exactly once.Once a number appears in both prefixes, it remains common forever.This simplifies the logic significantly.Brute Force ApproachIntuitionFor every index:Build prefixesCompare elementsCount common numbersBrute Force AlgorithmFor each index:Traverse all previous elementsCheck whether numbers exist in both prefixesCount matchesBrute Force ComplexityTime ComplexityO(N²)because for every index we may scan previous elements.Space ComplexityO(N)Understanding ApproachThis approach uses:HashMapPrefix trackingCounting common valuesThe idea is:Store prefix elements from BTraverse A prefixCount matching numbersThis works because prefixes gradually expand.Java Solutionclass Solution { public int[] findThePrefixCommonArray(int[] A, int[] B) { int j = 0; int[] ans = new int[A.length]; HashMap<Integer, Integer> map = new HashMap<>(); for(int i = 0; i < A.length; i++) { map.put(B[i], i); int counter = 0; int c = 0; for(int a : map.keySet()) { if(map.containsKey(A[c])) { counter++; } c++; } ans[j] = counter; j++; } return ans; }}Better Optimized ApproachWe can solve this more cleanly using:HashSetor frequency counting.Optimized IntuitionAt every index:Add A[i]Add B[i]Track which numbers appearedIf a number appears in both arrays, increase common countBest Optimized Approach Using Frequency ArrayBecause values are from:1 to nwe can use a frequency array.Optimized Java Solutionclass Solution { public int[] findThePrefixCommonArray(int[] A, int[] B) { int n = A.length; int[] ans = new int[n]; int[] freq = new int[n + 1]; int common = 0; for(int i = 0; i < n; i++) { freq[A[i]]++; if(freq[A[i]] == 2) common++; freq[B[i]]++; if(freq[B[i]] == 2) common++; ans[i] = common; } return ans; }}Why Does This Work?Every number appears once in A and once in B.So:First appearance → frequency becomes 1Second appearance → frequency becomes 2When frequency becomes:2it means the number has appeared in both prefixes.So we increase:commonDry RunInputA = [1,3,2,4]B = [3,1,2,4]Step 1Index:0Add:1 and 3Frequencies:1 → 13 → 1No common elements.ans[0] = 0Step 2Add:3 and 1Frequencies:1 → 23 → 2Two common elements found.ans[1] = 2Step 3Add:2 and 2Frequency:2 → 2Common becomes:3ans[2] = 3Step 4Add:4 and 4Frequency:4 → 2Common becomes:4ans[3] = 4Final Output[0,2,3,4]Time Complexity AnalysisTime ComplexityO(N²)Nested traversal inside loop.Space ComplexityO(N)Optimized Frequency ApproachTime ComplexityO(N)Single traversal.Space ComplexityO(N)Frequency array.HashMap vs Frequency ArrayApproachTime ComplexitySpace ComplexityHashMapO(N²)O(N)Frequency ArrayO(N)O(N)Interview ExplanationIn interviews, explain:Since both arrays are permutations, every number appears exactly twice overall — once in A and once in B. Using frequency counting, whenever a number’s frequency becomes 2, it means it has appeared in both prefixes.This demonstrates:Prefix understandingOptimization thinkingHashing skillsCommon Mistakes1. Recalculating Common Elements Every TimeThis causes:O(N²)complexity.2. Forgetting Arrays Are PermutationsThis special condition allows frequency optimization.3. Incorrect Prefix LogicRemember:Prefix means elements from 0 to i.FAQsQ1. Why is this called Prefix Common Array?Because:C[i]stores common elements between prefixes ending at index:iQ2. Why does frequency 2 mean common?Because every number appears once in each array.Q3. Which approach is best?Frequency array approach is the most optimized.Q4. Is this problem important for interviews?Yes.It tests:Prefix logicHashingOptimizationArray traversalRelated ProblemsAfter mastering this problem, practice:Intersection of Two ArraysIntersection of Two Arrays IIContains DuplicateSubarray Sum Equals KPrefix SumFind the Difference of Two ArraysConclusionLeetCode 2657 is an excellent prefix and hashing problem.It teaches:Prefix processingFrequency countingOptimization techniquesHashing fundamentalsThe key insight is:A number becomes common exactly when its frequency becomes 2.Once you understand this observation, the optimized solution becomes very simple and efficient.

LeetCodePrefix Common ArrayJavaHashMapHashSetArrayPrefixArrayMedium
LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

IntroductionSome problems test complex algorithms, while others focus on fundamental concepts done right.LeetCode 3783 – Mirror Distance of an Integer falls into the second category.This problem is simple yet important because it builds understanding of:Digit manipulationReversing numbersMathematical operationsIn this article, we’ll break down the problem in a clean and intuitive way, along with an optimized Java solution.🔗 Problem LinkLeetCode: Mirror Distance of an IntegerProblem StatementYou are given an integer n.The mirror distance is defined as:| n - reverse(n) |Where:reverse(n) = number formed by reversing digits of n|x| = absolute value👉 Return the mirror distance.ExamplesExample 1Input:n = 25Output:27Explanation:reverse(25) = 52|25 - 52| = 27Example 2Input:n = 10Output:9Explanation:reverse(10) = 1|10 - 1| = 9Example 3Input:n = 7Output:0Key InsightThe problem consists of two simple steps:1. Reverse the number2. Take absolute differenceIntuitionLet’s take an example:n = 120Step 1: Reverse digits120 → 021 → 21👉 Leading zeros are ignored automatically.Step 2: Compute difference|120 - 21| = 99ApproachStep-by-StepExtract digits using % 10Build reversed numberUse Math.abs() for final resultJava Codeclass Solution { // Function to reverse a number public int reverse(int k) { int rev = 0; while (k != 0) { int dig = k % 10; // get last digit k = k / 10; // remove last digit rev = rev * 10 + dig; // build reversed number } return rev; } public int mirrorDistance(int n) { // Calculate mirror distance return Math.abs(n - reverse(n)); }}Dry RunInput:n = 25Execution:Reverse → 52Difference → |25 - 52| = 27Complexity AnalysisTime ComplexityReversing number → O(d)(d = number of digits)👉 Overall: O(log n)Space Complexity👉 O(1) (no extra space used)Why This WorksDigit extraction ensures correct reversalLeading zeros automatically removedAbsolute difference ensures positive resultEdge Cases to ConsiderSingle digit → result = 0Numbers ending with zero (e.g., 10 → 1)Large numbers (up to 10⁹)Key TakeawaysSimple math problems can test core logicDigit manipulation is a must-know skillAlways handle leading zeros carefullyUse built-in functions like Math.abs() effectivelyReal-World RelevanceConcepts used here are helpful in:Number transformationsPalindrome problemsReverse integer problemsMathematical algorithmsConclusionThe Mirror Distance of an Integer problem is a great example of combining basic operations to form a meaningful solution.While simple, it reinforces important programming fundamentals that are widely used in more complex problems.Frequently Asked Questions (FAQs)1. What happens to leading zeros in reverse?They are automatically removed when stored as an integer.2. Can this be solved using strings?Yes, but integer-based approach is more efficient.3. What is the best approach?Using arithmetic operations (% and /) is optimal.

EasyArrayReverse NumberLeetCodeJava
LeetCode 496: Next Greater Element I — Java Solution With All Approaches Explained

LeetCode 496: Next Greater Element I — Java Solution With All Approaches Explained

IntroductionLeetCode 496 Next Greater Element I is your gateway into one of the most important and frequently tested patterns in coding interviews — the Monotonic Stack. Once you understand this problem deeply, problems like Next Greater Element II, Daily Temperatures, and Largest Rectangle in Histogram all start to make sense.Here is the Link of Question -: LeetCode 496This article covers plain English explanation, real life analogy, brute force and optimal approaches in Java, detailed dry runs, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You have two arrays. nums2 is the main array. nums1 is a smaller subset of nums2. For every element in nums1, find its position in nums2 and look to the right — what is the first element that is strictly greater? If none exists, return -1.Example:nums1 = [4,1,2], nums2 = [1,3,4,2]For 4 in nums2: elements to its right are [2], none greater → -1For 1 in nums2: elements to its right are [3,4,2], first greater is 3For 2 in nums2: no elements to its right → -1Output: [-1, 3, -1]Real Life Analogy — The Taller Person in a QueueImagine you are standing in a queue and you want to know — who is the first person taller than you standing somewhere behind you in the line?You look to your right one by one until you find someone taller. That person is your "next greater element." If everyone behind you is shorter, your answer is -1.Now imagine doing this for every person in the queue efficiently — instead of each person looking one by one, you use a smart system that processes everyone in a single pass. That smart system is the Monotonic Stack.Approach 1: Brute Force (Beginner Friendly)The IdeaFor each element in nums1, find its position in nums2, then scan everything to its right to find the first greater element.javapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { int found = -1; boolean seen = false; for (int j = 0; j < nums2.length; j++) { if (seen && nums2[j] > nums1[i]) { found = nums2[j]; break; } if (nums2[j] == nums1[i]) { seen = true; } } ans[i] = found; } return ans;}Simple to understand but inefficient. For each element in nums1 you scan the entire nums2.Time Complexity: O(m × n) — where m = nums1.length, n = nums2.length Space Complexity: O(1) — ignoring output arrayThis works for the given constraints (n ≤ 1000) but will not scale for larger inputs. The follow-up specifically asks for better.Approach 2: Monotonic Stack + HashMap (Optimal Solution) ✅The IdeaThis is your solution and the best one. The key insight is — instead of answering queries for nums1 elements one by one, precompute the next greater element for every element in nums2 and store results in a HashMap. Then answering nums1 queries becomes just a HashMap lookup.To precompute efficiently, we use a Monotonic Stack — a stack that always stays in decreasing order from bottom to top.Why traverse from right to left? Because we are looking for the next greater element to the right. Starting from the right end, by the time we process any element, we have already seen everything to its right.Algorithm:Traverse nums2 from right to leftMaintain a stack of "candidate" next greater elementsFor current element, pop all stack elements that are smaller or equal — they can never be the next greater for anything to the leftIf stack is empty → next greater is -1, else → top of stack is the answerPush current element onto stackStore result in HashMapLook up each nums1 element in the HashMapjavapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { Stack<Integer> st = new Stack<>(); HashMap<Integer, Integer> mp = new HashMap<>(); // Precompute next greater for every element in nums2 for (int i = nums2.length - 1; i >= 0; i--) { // Pop elements smaller than current — they are useless while (!st.empty() && nums2[i] >= st.peek()) { st.pop(); } // Top of stack is the next greater, or -1 if empty mp.put(nums2[i], st.empty() ? -1 : st.peek()); // Push current element as a candidate for elements to its left st.push(nums2[i]); } // Answer queries for nums1 int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { ans[i] = mp.get(nums1[i]); } return ans;}Why Is the Stack Monotonic?After popping smaller elements, the stack always maintains a decreasing order from bottom to top. This means the top of the stack at any point is always the smallest element seen so far to the right — making it the best candidate for "next greater."This is called a Monotonic Decreasing Stack and it is the heart of this entire pattern.Detailed Dry Run — nums2 = [1,3,4,2]We traverse from right to left:i = 3, nums2[3] = 2Stack is emptyNo elements to popStack empty → mp.put(2, -1)Push 2 → stack: [2]i = 2, nums2[2] = 4Stack top is 2, and 4 >= 2 → pop 2 → stack: []Stack empty → mp.put(4, -1)Push 4 → stack: [4]i = 1, nums2[1] = 3Stack top is 4, and 3 < 4 → stop poppingStack not empty → mp.put(3, 4)Push 3 → stack: [4, 3]i = 0, nums2[0] = 1Stack top is 3, and 1 < 3 → stop poppingStack not empty → mp.put(1, 3)Push 1 → stack: [4, 3, 1]HashMap after processing nums2:1 → 3, 2 → -1, 3 → 4, 4 → -1Now answer nums1 = [4, 1, 2]:nums1[0] = 4 → mp.get(4) = -1nums1[1] = 1 → mp.get(1) = 3nums1[2] = 2 → mp.get(2) = -1✅ Output: [-1, 3, -1]Time Complexity: O(n + m) — n for processing nums2, m for answering nums1 queries Space Complexity: O(n) — HashMap and Stack both store at most n elementsWhy Pop Elements Smaller Than Current?This is the most important thing to understand in this problem. When we are at element x and we see a stack element y where y < x, we pop y. Why?Because x is to the right of everything we will process next (we go right to left), and x is already greater than y. So for any element to the left of x, if they are greater than y, they are definitely also greater than y — meaning y would never be the "next greater" for anything. It becomes useless and gets discarded.This is why the stack stays decreasing — every element we keep is a legitimate candidate for being someone's next greater element.How This Differs From Previous Stack ProblemsYou have been solving stack problems with strings — backspace, stars, adjacent duplicates. This problem introduces the stack for arrays and searching, which is a step up in complexity.The pattern shift is: instead of using the stack to build or reduce a string, we use it to maintain a window of candidates while scanning. This monotonic stack idea is what powers many hard problems like Largest Rectangle in Histogram, Trapping Rain Water, and Daily Temperatures.Common Mistakes to AvoidUsing >= instead of > in the pop condition We pop when nums2[i] >= st.peek(). If you use only >, equal elements stay on the stack and give wrong answers since we need strictly greater.Traversing left to right instead of right to left Going left to right makes it hard to know what is to the right of the current element. Always go right to left for "next greater to the right" problems.Forgetting HashMap lookup handles the nums1 query efficiently Some people recompute inside the nums1 loop. Always precompute in a HashMap — that is the whole point of the optimization.FAQs — People Also AskQ1. What is a Monotonic Stack and why is it used in LeetCode 496? A Monotonic Stack is a stack that maintains its elements in either increasing or decreasing order. In LeetCode 496, a Monotonic Decreasing Stack is used to efficiently find the next greater element for every number in nums2 in a single pass, reducing time complexity from O(n²) to O(n).Q2. What is the time complexity of LeetCode 496 optimal solution? The optimal solution runs in O(n + m) time where n is the length of nums2 and m is the length of nums1. Processing nums2 takes O(n) and answering all nums1 queries via HashMap takes O(m).Q3. Why do we traverse nums2 from right to left? Because we are looking for the next greater element to the right. Starting from the right end means by the time we process any element, we have already seen all elements to its right and stored them in the stack as candidates.Q4. Is LeetCode 496 asked in coding interviews? Yes, it is commonly used as an introduction to the Monotonic Stack pattern at companies like Amazon, Google, and Microsoft. It often appears as a warmup before harder follow-ups like Next Greater Element II (circular array) or Daily Temperatures.Q5. What is the difference between LeetCode 496 and LeetCode 739 Daily Temperatures? Both use the same Monotonic Stack pattern. In 496 you return the actual next greater value. In 739 you return the number of days (index difference) until a warmer temperature. The core stack logic is identical.Similar LeetCode Problems to Practice Next739. Daily Temperatures — Medium — days until warmer temperature, same pattern503. Next Greater Element II — Medium — circular array version901. Online Stock Span — Medium — monotonic stack with span counting84. Largest Rectangle in Histogram — Hard — classic monotonic stack42. Trapping Rain Water — Hard — monotonic stack or two pointerConclusionLeetCode 496 Next Greater Element I is the perfect entry point into the Monotonic Stack pattern. The brute force is easy to understand, but the real learning happens when you see why the stack stays decreasing and how that single insight collapses an O(n²) problem into O(n).Once you truly understand why we pop smaller elements and how the HashMap bridges the gap between precomputation and query answering, the entire family of Next Greater Element problems becomes approachable — including the harder circular and histogram variants.

ArrayStackMonotonic StackHashMapEasyLeetCode
LeetCode 701: Insert into a Binary Search Tree – Java Recursive Solution with Dry Run

LeetCode 701: Insert into a Binary Search Tree – Java Recursive Solution with Dry Run

IntroductionLeetCode 701 – Insert into a Binary Search Tree is one of the most important Binary Search Tree problems for coding interviews.This problem helps developers understand:BST propertiesRecursive traversalTree modificationNode insertion logicDFS recursionIt is frequently asked because BST insertion is a foundational concept used in:Search operationsTree balancingDatabase indexingOrdered data structuresProblem Link🔗 https://leetcode.com/problems/insert-into-a-binary-search-tree/Problem StatementYou are given:Root of a Binary Search TreeA value to insertReturn:Root of BST after insertionThe inserted value is guaranteed to be unique.What is a Binary Search Tree?A BST follows this rule:Left subtree values < RootRight subtree values > RootExample: 4 / \ 2 7 / \ 1 3If we insert:5It becomes: 4 / \ 2 7 / \ / 1 3 5Key ObservationWhile traversing:If value is smaller → go leftIf value is larger → go rightEventually:We reach a null positionThat is the insertion point.IntuitionBST insertion behaves exactly like BST search.We recursively move:left or rightuntil we find:nullThen create the new node there.Brute Force ThinkingA beginner might think:Store tree in arrayInsert valueSort againRebuild BSTBut rebuilding the tree is unnecessary and inefficient.BST already provides ordered traversal naturally.Optimized Recursive ApproachIdeaAt every node:If value is smaller → insert into left subtreeElse → insert into right subtreeWhen root becomes:nullcreate a new node.Java Solutionclass Solution { public void solve(TreeNode root, TreeNode prevnode, int val) { if(root == null) { if(prevnode.val < val) { prevnode.right = new TreeNode(val); } else { prevnode.left = new TreeNode(val); } return; } if(root.val > val) { solve(root.left, root, val); } else { solve(root.right, root, val); } } public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } TreeNode originalRoot = root; solve(root, root, val); return originalRoot; }}Cleaner Recursive Versionclass Solution { public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } if(val < root.val) { root.left = insertIntoBST(root.left, val); } else { root.right = insertIntoBST(root.right, val); } return root; }}Why This WorksBST property guarantees:Smaller values go leftLarger values go rightSo recursion naturally finds the correct insertion position.When recursion reaches:nullwe create the new node.Dry RunInputroot = [4,2,7,1,3]val = 5Step 1Current node:4Since:5 > 4move right.Step 2Current node:7Since:5 < 7move left.Step 3Left child is:nullInsert:5Final Tree 4 / \ 2 7 / \ / 1 3 5Time Complexity AnalysisAverage CaseTime ComplexityO(log N)Balanced BST height remains logarithmic.Space ComplexityO(log N)due to recursion stack.Worst CaseIf BST becomes skewed:1 -> 2 -> 3 -> 4Then:Time ComplexityO(N)Space ComplexityO(N)Recursive vs IterativeApproachTime ComplexitySpace ComplexityRecursiveO(H)O(H)IterativeO(H)O(1)Where:H = height of BSTIterative Java Solutionclass Solution { public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } TreeNode curr = root; while(true) { if(val < curr.val) { if(curr.left == null) { curr.left = new TreeNode(val); break; } curr = curr.left; } else { if(curr.right == null) { curr.right = new TreeNode(val); break; } curr = curr.right; } } return root; }}Interview ExplanationIn interviews, explain:Binary Search Tree insertion follows BST ordering rules. We recursively traverse left or right depending on the value until we reach a null node, where the new node is inserted.This demonstrates:BST understandingRecursive traversalTree manipulationDFS logicCommon Mistakes1. Forgetting to Return RootAlways return original root after insertion.2. Breaking BST PropertyIncorrect comparisons can violate BST ordering.Correct logic:if(val < root.val)3. Missing Base CaseWithout:if(root == null)recursion never stops.4. Rebuilding Entire TreeInsertion should modify existing BST directly.FAQsQ1. Why use recursion?BST naturally divides into smaller subtrees.Recursion simplifies traversal logic.Q2. Can insertion be iterative?Yes.Using loops avoids recursion stack usage.Q3. Why does BST insertion work efficiently?Because BST reduces search space at every step.Q4. Is this problem important for interviews?Absolutely.BST insertion is one of the most frequently asked tree concepts.ConclusionLeetCode 701 is an excellent BST problem for learning:Recursive tree traversalBST propertiesNode insertion logicDFS recursionThe core insight is:Move left for smaller values and right for larger values until a null position is found.Once this becomes intuitive, most BST operations become much easier to solve.

LeetCodeBSTBinary Search TreeJavaRecursionTreeMedium
LeetCode 235: Lowest Common Ancestor of a Binary Search Tree – Java BST Solution with Dry Run

LeetCode 235: Lowest Common Ancestor of a Binary Search Tree – Java BST Solution with Dry Run

IntroductionLeetCode 235 – Lowest Common Ancestor of a Binary Search Tree is one of the most important BST interview problems.This problem helps you understand:Binary Search Tree propertiesRecursive traversalTree navigationAncestor relationshipsOptimized searchingIt is frequently asked in coding interviews because it combines tree traversal with BST optimization.Problem Link🔗 https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-search-tree/Problem StatementGiven:Root of a Binary Search TreeTwo nodes p and qReturn:The Lowest Common Ancestor (LCA) of p and qThe LCA is the lowest node in the tree that has both nodes as descendants.A node can also be a descendant of itself.Example 1Inputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 8Output6Example 2Inputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 4Output2Understanding the BST PropertyA Binary Search Tree follows:Left Subtree < RootRight Subtree > RootExample: 6 / \ 2 8 / \ / \ 0 4 7 9 / \ 3 5This property allows us to find the LCA efficiently.Key ObservationThere are only three possible cases:Case 1Both nodes are smaller than root.Move LeftCase 2Both nodes are greater than root.Move RightCase 3One node is on the left and the other is on the right.OROne node equals root.Then:Current root is the LCAIntuitionSuppose:p = 2q = 8root = 6Now:2 < 68 > 6This means:One node is in left subtreeOne node is in right subtreeSo:6 is the first common split pointHence:6 is the Lowest Common AncestorBrute Force ApproachIdeaFind path from root to pFind path from root to qCompare both pathsLast common node is the LCABrute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)Extra path storage required.Optimized BST ApproachUsing BST properties:No need to store pathsNo need to traverse entire treeMove intelligentlyThis gives a much cleaner solution.Java Solutionclass Solution { public TreeNode solve(TreeNode root, TreeNode p, TreeNode q) { if(root == null) return root; if(root.val < p.val && root.val < q.val) { return solve(root.right, p, q); } else if(root.val > p.val && root.val > q.val) { return solve(root.left, p, q); } else { return root; } } public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { if(root == null) return root; return solve(root, p, q); }}Cleaner Recursive Versionclass Solution { public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { if(root.val > p.val && root.val > q.val) { return lowestCommonAncestor(root.left, p, q); } if(root.val < p.val && root.val < q.val) { return lowestCommonAncestor(root.right, p, q); } return root; }}Iterative ApproachWe can also solve this without recursion.Iterative Java Solutionclass Solution { public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { while(root != null) { if(root.val > p.val && root.val > q.val) { root = root.left; } else if(root.val < p.val && root.val < q.val) { root = root.right; } else { return root; } } return null; }}Dry RunInputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 8Step 1Current root:6Check:2 < 68 > 6One node is on left.One node is on right.So:6 is the LCAFinal Output6Another Dry RunInputp = 2q = 4Step 1Current root:6Both nodes smaller than 6.Move left.Step 2Current root:2Now:p == rootSo:2 is the LCAWhy This WorksBST ordering helps us eliminate half the tree at every step.If:p and q both smallerthen LCA must exist in left subtree.If:p and q both greaterthen LCA must exist in right subtree.Otherwise:Current node is the split pointwhich becomes the Lowest Common Ancestor.Time Complexity AnalysisOptimized BST SolutionAverage Time ComplexityO(log N)Because BST halves search space.Worst Case Time ComplexityO(N)Occurs when BST becomes skewed.Space ComplexityRecursiveO(H)Where:H = height of treeIterativeO(1)No recursion stack used.Interview ExplanationIn interviews, explain:Since this is a BST, we can use node ordering to decide whether both nodes lie in the left subtree, right subtree, or on different sides. The first split point becomes the Lowest Common Ancestor.This demonstrates:BST understandingTree recursionSearch optimizationEfficient traversal logicCommon Mistakes1. Treating It Like a Normal Binary TreeThis problem becomes easier because it is a BST.Use BST properties.2. Forgetting Split Point LogicThe LCA occurs when:p <= root <= qor vice versa.3. Traversing Entire TreeUnnecessary.BST lets us eliminate half the tree.4. Confusing Ancestor DefinitionA node can be ancestor of itself.Important for cases like:p = 2q = 4Answer becomes:2FAQsQ1. Why is BST important here?BST ordering allows efficient searching.Without BST property, we need a completely different approach.Q2. Can this be solved iteratively?Yes.Iterative traversal is even more space-efficient.Q3. Is recursion necessary?No.Both recursive and iterative solutions work.Q4. What is the Lowest Common Ancestor?The deepest node that has both target nodes as descendants.ConclusionLeetCode 235 is an excellent BST problem for mastering:BST propertiesRecursive traversalTree navigationOptimized searchingAncestor-based reasoningThe main insight is:In a BST, the first node where paths to p and q split becomes the Lowest Common Ancestor.Once this concept becomes intuitive, many BST interview problems become much easier to solve.

LeetCodeBinary Search TreeBSTJavaTreeMedium
Inorder Successor in BST – Java Optimized BST Solution with Dry Run

Inorder Successor in BST – Java Optimized BST Solution with Dry Run

IntroductionThe Inorder Successor in BST problem is one of the most important Binary Search Tree interview questions asked in coding interviews and online coding platforms like GeeksforGeeks.This problem tests your understanding of:Binary Search Tree propertiesInorder traversalRecursive searchingTree optimization techniquesSuccessor logic in BSTUnderstanding this problem properly helps in solving many advanced BST questions efficiently.Problem Link🔗 GeeksforGeeks – Inorder Successor in BSTProblem StatementGiven:A Binary Search TreeA reference node kFind the:Inorder Successorof that node.What is Inorder Successor?The inorder successor of a node is:The next greater node in the inorder traversal of the BST.Example 1Inputroot = [2,1,3]k = 2Inorder Traversal1 2 3Output3Example 2Inputroot = [20,8,22,4,12,null,null,null,null,10,14]k = 8Inorder Traversal4 8 10 12 14 20 22Output10Key BST ObservationIn a BST:Left subtree -> smaller valuesRight subtree -> greater valuesThe inorder traversal of BST is always:Sorted orderThis property helps us optimize the search.IntuitionSuppose:k = 8and current node is:20Since:20 > 8this node can potentially be the inorder successor.But there may exist a smaller valid successor in the left subtree.So:Store current node as possible answerMove leftBrute Force ApproachIdeaPerform inorder traversalStore traversal in listFind node kReturn next elementBrute Force Java Solutionclass Solution { List<Integer> inorder = new ArrayList<>(); void traverse(Node root) { if(root == null) return; traverse(root.left); inorder.add(root.data); traverse(root.right); } public int inOrderSuccessor(Node root, Node k) { traverse(root); for(int i = 0; i < inorder.size() - 1; i++) { if(inorder.get(i) == k.data) { return inorder.get(i + 1); } } return -1; }}Brute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)because of traversal list.Optimized BST ApproachInstead of traversing the entire tree:Use BST propertiesReduce unnecessary traversalSearch efficientlyOptimized Java Solutionclass Solution { int c = -1; int solve(Node root, Node x, int c) { if(root == null) return c; if(root.data > x.data) { c = root.data; return solve(root.left, x, c); } else { return solve(root.right, x, c); } } public int inOrderSuccessor(Node root, Node k) { return solve(root, k, c); }}How This Solution WorksWhenever:root.data > k.datathe current node becomes a possible successor candidate.But there may exist a smaller valid successor in the left subtree.So:Store current nodeMove leftWhy Move Right Otherwise?If:root.data <= k.datathen current node cannot be successor.Move right to search for larger values.Dry RunInput 20 / \ 8 22 / \ 4 12 / \ 10 14k = 8Step 1Current node:20Since:20 > 8possible successor:20Move left.Step 2Current node:8Since:8 <= 8Move right.Step 3Current node:12Since:12 > 8update successor:12Move left.Step 4Current node:10Since:10 > 8update successor:10Move left.Step 5Node becomes null.Return:10Final Answer10Alternative Inorder Traversal ApproachAnother common approach:Perform inorder traversalTrack previous nodeWhen previous node becomes k, current node is successorAlternative Recursive Solutionclass Solution { Node prev = null; Node succ = null; void solve(Node root, Node k) { if(root == null || succ != null) return; solve(root.left, k); if(prev != null && prev.data == k.data) { succ = root; } prev = root; solve(root.right, k); } public int inOrderSuccessor(Node root, Node k) { solve(root, k); return succ != null ? succ.data : -1; }}Time Complexity AnalysisOptimized BST SolutionBest CaseO(log N)Balanced BST.Worst CaseO(N)Skewed BST.Space ComplexityRecursive StackO(H)where:H = height of treeInterview ExplanationIn interviews explain:Whenever we encounter a node greater than k, it becomes a possible inorder successor candidate. Then we move left to search for a smaller valid successor.This demonstrates:BST optimization understandingRecursive traversal logicEfficient searching skillsCommon Mistakes1. Traversing Entire Tree UnnecessarilyBST property already reduces search space.2. Returning First Greater NodeNeed the:smallest greater nodenot any greater node.3. Forgetting Candidate UpdateAlways update candidate before moving left.4. Confusing Floor/Ceil LogicSuccessor logic is different from:FloorCeilPredecessorFAQsQ1. What is inorder successor?The next greater node in inorder traversal.Q2. Why BST helps optimization?BST ordering allows skipping unnecessary branches.Q3. Can inorder successor be absent?Yes.If node is largest element, answer is:-1Q4. Can this be solved iteratively?Yes.Iterative solution is also common in interviews.Related BST ProblemsPractice these next:Search in BSTCeil in BSTFloor in BSTValidate BSTLowest Common Ancestor in BSTKth Smallest Element in BSTConclusionInorder Successor in BST is a very important interview problem because it teaches:BST optimizationRecursive searchingSuccessor logicTree traversal efficiencyThe key idea is:Whenever a node is greater than k, it becomes a possible successor candidate, but a smaller valid successor may still exist in the left subtree.Mastering this logic makes advanced BST problems significantly easier.

BSTGFGTreeBinary Search TreeJavaTree TraversalRecursionEasy
LeetCode 154: Find Minimum in Rotated Sorted Array II – Java Binary Search Solution Explained

LeetCode 154: Find Minimum in Rotated Sorted Array II – Java Binary Search Solution Explained

IntroductionLeetCode 154 – Find Minimum in Rotated Sorted Array II is a classic binary search interview problem.This problem is an advanced version of:Find Minimum in Rotated Sorted ArrayThe major difference is:The array may contain duplicates.That small change makes the problem much harder because duplicates can break normal binary search logic.This problem teaches:Modified binary searchRotated array conceptsHandling duplicatesEdge case optimizationInterview problem-solving techniquesProblem Link🔗 ProblemLeetCode 154: Find Minimum in Rotated Sorted Array IIOfficial Problem: LeetCode Problem LinkProblem StatementAn ascending sorted array is rotated between 1 and n times.Example:[0,1,4,4,5,6,7]may become:[4,5,6,7,0,1,4]or[0,1,4,4,5,6,7]Given the rotated sorted array nums that may contain duplicates, return the minimum element.ExampleExample 1Input:nums = [1,3,5]Output:1Example 2Input:nums = [2,2,2,0,1]Output:0Understanding Rotated Sorted ArraysNormally a sorted array looks like:[1,2,3,4,5]After rotation:[4,5,1,2,3]The minimum element becomes the pivot point.Our goal is to efficiently find this pivot.Brute Force ApproachIntuitionTraverse the entire array and keep track of the smallest element.AlgorithmInitialize minimum as first element.Traverse the array.Update minimum whenever a smaller element appears.Return minimum.Java Code – Brute Forceclass Solution { public int findMin(int[] nums) { int min = nums[0]; for(int num : nums) { min = Math.min(min, num); } return min; }}Dry Run – Brute ForceInput:[2,2,2,0,1]Traversal:ElementMinimum2222220010Final answer:0Complexity Analysis – Brute ForceTime ComplexityO(N)Space ComplexityO(1)Can We Do Better?Yes.Since the array is sorted and rotated, we can use Binary Search.However, duplicates make the problem tricky.Binary Search IntuitionIn a rotated sorted array:One half is always sorted.The minimum lies in the unsorted half.Without duplicates, binary search becomes straightforward.But duplicates create ambiguity.Example:[2,2,2,0,2]If:nums[mid] == nums[right]we cannot determine which side contains the minimum.So we shrink the search space carefully.Key Binary Search ObservationsCase 1If:nums[mid]<nums[right]nums[mid] < nums[right]nums[mid]<nums[right]then the right half is sorted, and minimum may lie at mid or left side.Move:right = midCase 2If:nums[mid]>nums[right]nums[mid] > nums[right]nums[mid]>nums[right]then minimum lies in the right half.Move:left = mid + 1Case 3If:nums[mid]=nums[right]nums[mid] = nums[right]nums[mid]=nums[right]we cannot identify the correct side.Safely reduce search space:right--Optimized Binary Search ApproachStepsInitialize two pointers:leftrightFind middle element.Compare nums[mid] with nums[right].Narrow the search space accordingly.Continue until pointers meet.Java Binary Search Solutionclass Solution { public int findMin(int[] nums) { if(nums.length == 1) return nums[0]; int left = 0; int right = nums.length - 1; int min = Integer.MAX_VALUE; while(left <= right) { int mid = left + (right - left) / 2; if(nums[mid] < nums[right]) { right = mid; min = Math.min(min, nums[right]); } else if(nums[mid] > nums[right]) { min = Math.min(min, nums[right]); left = mid + 1; } else { right--; } min = Math.min(min, nums[mid]); } return min; }}Dry Run – Binary SearchInputnums = [2,2,2,0,1]Initial StateLeftRight04Iteration 1Midmid = 2Value:nums[mid] = 2nums[right] = 1Since:2>12 > 12>1Move:left = mid + 1Now:LeftRight34Iteration 2Midmid = 3Value:nums[mid] = 0nums[right] = 1Since:0<10 < 10<1Move:right = midNow:LeftRight33Final Answer0Time Complexity AnalysisAverage CaseO(log N)Worst CaseDue to duplicates:O(N)Why Worst Case Becomes O(N)Consider:[1,1,1,1,1]Every comparison becomes:nums[mid] == nums[right]We can only shrink by one element:right--This degrades binary search to linear complexity.Interview ExplanationIn interviews, explain:Duplicates destroy the ability to always determine the sorted half uniquely. When nums[mid] == nums[right], we cannot confidently eliminate one side, so we reduce the search space by one element.This is the key insight interviewers look for.Common Mistakes1. Using Standard Binary Search LogicStandard rotated-array logic fails with duplicates.2. Ignoring Duplicate CaseThis condition is essential:else { right--;}3. Infinite Loop ErrorsAlways update pointers carefully.Alternative Simpler Binary SearchA cleaner version:class Solution { public int findMin(int[] nums) { int left = 0; int right = nums.length - 1; while(left < right) { int mid = left + (right - left) / 2; if(nums[mid] < nums[right]) { right = mid; } else if(nums[mid] > nums[right]) { left = mid + 1; } else { right--; } } return nums[left]; }}This is the most common interview solution.FAQsQ1. Why does binary search become O(N)?Duplicates prevent us from discarding half the search space confidently.Q2. Why compare with nums[right]?It helps identify whether the minimum lies on the left or right side.Q3. Is this problem important for interviews?Yes.It is a very popular advanced binary search interview problem.ConclusionLeetCode 154 is an excellent problem for mastering:Modified binary searchRotated sorted arraysDuplicate handlingSearch optimizationThe key challenge is handling:nums[mid]=nums[right]nums[mid] = nums[right]nums[mid]=nums[right]correctly.Once you understand this pattern, many advanced binary search interview problems become much easier.

HardBinary SearchRotated Sorted ArrayJavaLeetCode
LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium
LeetCode 3761 Minimum Absolute Distance Between Mirror Pairs | Java HashMap Solution

LeetCode 3761 Minimum Absolute Distance Between Mirror Pairs | Java HashMap Solution

IntroductionSome problems look simple at first—but hide a clever trick inside.LeetCode 3761 – Minimum Absolute Distance Between Mirror Pairs is one such problem. It combines:Number manipulation (digit reversal)HashingEfficient searchingIf approached naively, this problem can easily lead to O(n²) time complexity—which is not feasible for large inputs.In this article, we will walk through:Problem intuitionNaive approach (and why it fails)Optimized HashMap solutionStep-by-step explanationClean Java code with comments🔗 Problem LinkLeetCode: Minimum Absolute Distance Between Mirror PairsTo gain a deeper understanding of the problem, it is highly recommended that you review this similar problem Closest Equal Element Queries here is the link of the article. Both cases follow a nearly identical pattern, and studying the initial example will provide valuable context for the current task.Problem StatementYou are given an integer array nums.A mirror pair (i, j) satisfies:0 ≤ i < j < nums.lengthreverse(nums[i]) == nums[j]👉 Your task is to find:The minimum absolute distance between such pairsIf no mirror pair exists, return -1.ExamplesExample 1Input:nums = [12, 21, 45, 33, 54]Output:1Explanation:(0,1) → reverse(12) = 21 → distance = 1(2,4) → reverse(45) = 54 → distance = 2✔ Minimum = 1Example 2Input:nums = [120, 21]Output:1Example 3Input:nums = [21, 120]Output:-1Key InsightThe core idea is:Instead of checking every pair,store reversed values and match on the fly.❌ Naive Approach (Brute Force)IdeaCheck all pairs (i, j)Reverse nums[i]Compare with nums[j]ComplexityTime: O(n²) ❌Space: O(1)ProblemWith n ≤ 100000, this approach will definitely cause TLE.✅ Optimized Approach (HashMap)IntuitionWhile iterating through the array:Reverse the current numberCheck if this number was already seen as a reversed valueIf yes → we found a mirror pairKey TrickInstead of storing original numbers:👉 Store reversed values as keysThis allows instant lookup.Java Code (With Detailed Comments)import java.util.*;class Solution {// Function to reverse digits of a numberpublic int reverse(int m) {int rev = 0;while (m != 0) {int dig = m % 10; // extract last digitm = m / 10; // remove last digitrev = rev * 10 + dig; // build reversed number}return rev;}public int minMirrorPairDistance(int[] nums) {// Map to store reversed values and their indicesHashMap<Integer, Integer> mp = new HashMap<>();int min = Integer.MAX_VALUE;for (int i = 0; i < nums.length; i++) {// Check if current number exists in map// Meaning: some previous number had reverse equal to thisif (mp.containsKey(nums[i])) {// Calculate distanceint prevIndex = mp.get(nums[i]);min = Math.min(min, Math.abs(i - prevIndex));}// Reverse current numberint revVal = reverse(nums[i]);// Store reversed value with indexmp.put(revVal, i);}// If no pair found, return -1return min == Integer.MAX_VALUE ? -1 : min;}}Step-by-Step Dry RunInput:nums = [12, 21, 45, 33, 54]Execution:IndexValueReverseMap CheckAction01221not foundstore (21 → 0)12112founddistance = 124554not foundstore (54 → 2)33333not foundstore (33 → 3)45445founddistance = 2👉 Minimum = 1Complexity AnalysisTime ComplexityReversing number → O(digits) ≈ O(log n)Loop → O(n)👉 Overall: O(n)Space ComplexityHashMap stores at most n elements👉 O(n)Why This Approach WorksAvoids unnecessary pair comparisonsUses hashing for constant-time lookupProcesses array in a single passKey TakeawaysAlways think of hashing when matching conditions existReversing numbers can convert the problem into a lookup problemAvoid brute force when constraints are largeThis is a classic “store & check” patternCommon Interview PatternThis problem is similar to:Two Sum (hashing)Reverse pairsMatching transformationsConclusionThe Minimum Absolute Distance Between Mirror Pairs problem is a great example of how a simple optimization (using a HashMap) can reduce complexity from O(n²) → O(n).Understanding this pattern will help you solve many similar problems involving:TransformationsMatching conditionsEfficient lookupsFrequently Asked Questions (FAQs)1. Why store reversed value instead of original?Because we want to quickly check if a number matches the reverse of a previous number.2. What if multiple same reversed values exist?The map stores the latest index, ensuring minimum distance is considered.3. Can this be solved without HashMap?Yes, but it will result in inefficient O(n²) time.

LeetCodeArrayJavaMediumHashMap
All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

IntroductionThe Power Set problem for strings is a classic question in recursion and backtracking, frequently asked in coding interviews and platforms like GeeksforGeeks.In this problem, instead of numbers, we deal with strings and generate all possible subsequences (not substrings). This makes it slightly more interesting and practical for real-world applications like pattern matching, text processing, and combinatorics.In this article, we will cover:Intuition behind subsequencesRecursive (backtracking) approachSorting for lexicographical orderAlternative approachesComplexity analysisProblem StatementGiven a string s of length n, generate all non-empty subsequences of the string.RequirementsReturn only non-empty subsequencesOutput must be in lexicographically sorted orderExamplesExample 1Input:s = "abc"Output:a ab abc ac b bc cExample 2Input:s = "aa"Output:a a aaSubsequence vs Substring (Important)Substring: Continuous charactersSubsequence: Characters can be skippedExample for "abc":Subsequences → a, b, c, ab, ac, bc, abcKey InsightFor every character, we have two choices:Include it OR Exclude itSo total subsequences:2^nWe generate all and then remove the empty string.Approach 1: Recursion (Backtracking)IntuitionAt each index:Skip the characterInclude the characterBuild all combinations recursivelyJava Code (With Explanation)import java.util.*;class Solution { // List to store all subsequences List<String> a = new ArrayList<>(); void sub(String s, int ind, String curr) { // Base case: reached end of string if (ind == s.length()) { a.add(curr); // add current subsequence return; } // Choice 1: Exclude current character sub(s, ind + 1, curr); // Choice 2: Include current character sub(s, ind + 1, curr + s.charAt(ind)); } public List<String> AllPossibleStrings(String s) { // Start recursion sub(s, 0, ""); // Remove empty string (not allowed) a.remove(""); // Sort lexicographically Collections.sort(a); return a; }}Step-by-Step Dry Run (s = "abc")Start: ""→ Exclude 'a' → "" → Exclude 'b' → "" → Exclude 'c' → "" → Include 'c' → "c" → Include 'b' → "b" → Exclude 'c' → "b" → Include 'c' → "bc"→ Include 'a' → "a" → Exclude 'b' → "a" → Exclude 'c' → "a" → Include 'c' → "ac" → Include 'b' → "ab" → Exclude 'c' → "ab" → Include 'c' → "abc"Final Output (After Sorting)a ab abc ac b bc cApproach 2: Bit ManipulationIntuitionEach subsequence can be represented using binary numbers:0 → exclude1 → includeCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); int n = s.length(); int total = 1 << n; // 2^n for (int i = 1; i < total; i++) { // start from 1 to avoid empty StringBuilder sb = new StringBuilder(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { sb.append(s.charAt(j)); } } result.add(sb.toString()); } Collections.sort(result); return result; }}Approach 3: Iterative (Expanding List)IdeaStart with empty listFor each character:Add it to all existing subsequencesCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); result.add(""); for (char ch : s.toCharArray()) { int size = result.size(); for (int i = 0; i < size; i++) { result.add(result.get(i) + ch); } } result.remove(""); Collections.sort(result); return result; }}Complexity AnalysisTime Complexity: O(n × 2ⁿ)Space Complexity: O(n × 2ⁿ)Why?Total subsequences = 2ⁿEach subsequence takes O(n) to buildWhy Sorting is RequiredThe recursion generates subsequences in random order, so we sort them:Collections.sort(result);This ensures lexicographical order as required.Key TakeawaysThis is a power set problem for stringsEach character → 2 choicesRecursion = most intuitive approachBit manipulation = most optimized thinkingAlways remove empty string if requiredCommon Interview VariationsSubsets of arrayPermutations of stringCombination sumSubsequence with conditionsConclusionThe Power Set problem is a fundamental building block in recursion and combinatorics. Once you understand the include/exclude pattern, you can solve a wide range of problems efficiently.Mastering this will significantly improve your ability to tackle backtracking and decision tree problems.Frequently Asked Questions (FAQs)1. Why is the empty string removed?Because the problem requires only non-empty subsequences.2. Why is time complexity O(n × 2ⁿ)?Because there are 2ⁿ subsequences and each takes O(n) time to construct.3. Which approach is best?Recursion → best for understandingBit manipulation → best for optimization

GeeksforGeeksRecursionJavaBacktrackingMedium
LeetCode 55: Jump Game – Java Greedy Solution with Explanation and Dry Run

LeetCode 55: Jump Game – Java Greedy Solution with Explanation and Dry Run

Problem StatementYou are given an integer array nums, where nums[i] represents the maximum number of steps you can jump forward from index i.You start at the first index of the array.Your task is to determine whether you can reach the last index.Return true if the last index is reachable; otherwise, return false.Problem Link -: Jump GameExample 1Input: nums = [2,3,1,1,4]Output: trueOne possible sequence is:Index 0 → Index 1 → Index 4From index 0, we can jump up to 2 positions.From index 1, we can jump up to 3 positions, which allows us to reach the last index.Example 2Input: nums = [3,2,1,0,4]Output: falseWe can reach index 3, but:nums[3] = 0Therefore, we cannot move any further and the last index cannot be reached.Understanding the ProblemThe important thing to understand is that we do not need to find the exact sequence of jumps.We only need to answer:"How far can I reach from all the positions I have been able to reach so far?"For example:nums = [2,3,1,1,4]index: 0 1 2 3 4value: 2 3 1 1 4Initially, we are at index 0.Since:nums[0] = 2we can reach:index 0, 1, 2So our current farthest reachable index is:2When we reach index 1, it allows us to jump 3 positions.Therefore:1 + 3 = 4Now we can reach index 4, which is the last index.The key idea is therefore to continuously maintain the farthest index we can reach.Greedy ApproachWe maintain a variable:jwhich represents the farthest index that we can currently reach.Initially:j = nums[0];At every index i, we first check:Can we even reach index i?If:i > jthen index i is unreachable.That means the answer must be:falseOtherwise, index i is reachable, so we can use its jump length to potentially extend our reachable range.The new farthest position becomes:max(current farthest, i + nums[i])In Java:j = Math.max(j, i + nums[i]);If this reaches the last index, we can immediately return true.Java Solutionclass Solution {public boolean canJump(int[] nums) {if (nums.length == 1) {return true;}int j = nums[0];for (int i = 1; i < nums.length; i++) {// Current index cannot be reachedif (i > j) {return false;}// Update the farthest reachable indexj = Math.max(j, i + nums[i]);// Last index is reachableif (j >= nums.length - 1) {return true;}}return false;}}Step-by-Step ExplanationLet's break the important part of the algorithm down.1. Start with the first reachable positionint j = nums[0];If:nums[0] = 2then from index 0, we can initially reach index 2.So:j = 22. Iterate through the arrayfor (int i = 1; i < nums.length; i++)We examine every index that we potentially can reach.3. Check whether the current index is reachableif (i > j) {return false;}Suppose:i = 4j = 3This means:4 > 3We can only reach up to index 3, so index 4 is unreachable.There is no way to continue.Therefore:return false;4. Extend the reachable rangeIf the current index is reachable, we calculate how far we can jump from it:i + nums[i]But this might not necessarily be better than our existing reachable position.Therefore we take the maximum:j = Math.max(j, i + nums[i]);This is the core greedy step.Dry RunConsider:nums = [2,3,1,1,4]Initially:j = nums[0]j = 2Now iterate.i = 1Current reachable range:j = 2Can we reach index 1?1 <= 2Yes.From index 1:1 + nums[1]= 1 + 3= 4Update:j = max(2, 4)j = 4Since:j >= last index4 >= 4we can reach the last index.Therefore:trueAnother Dry Run: Impossible CaseConsider:nums = [3,2,1,0,4]Initially:j = 3i = 11 <= 3Reachable.From index 1:1 + 2 = 3So:j = max(3,3)j = 3i = 22 <= 3Reachable.2 + 1 = 3So:j = 3i = 33 <= 3Reachable.But:3 + nums[3]= 3 + 0= 3We are still stuck at:j = 3i = 4Now:4 > 3Index 4 cannot be reached.Therefore:falseWhy Does the Greedy Approach Work?The important observation is that we don't care which particular jump we take.We care only about the farthest position that can be reached from the positions already available to us.Suppose we can reach index i.From there, we can reach:i + nums[i]If this is farther than our previous maximum, we update our reachable boundary.Therefore, at every step:farthest reachable positioncontains all the information we need.We don't need to remember every possible path.This is what makes the solution greedy rather than recursive or dynamic programming based.Why Not Try Every Possible Jump?A straightforward recursive approach might try:index 0├── jump 1│ ├── jump 1│ └── jump 2│└── jump 2├── jump 1└── jump 2The number of possible paths can grow very quickly.We don't actually need to explore these paths.For example, if we can reach:0 → 1and:0 → 2we don't need to separately remember both paths.What matters is simply:Farthest reachable index = 2That removes a huge amount of unnecessary work.A Slightly Cleaner VersionThe same greedy logic can be written using a more descriptive variable name:class Solution {public boolean canJump(int[] nums) {int farthest = 0;for (int i = 0; i < nums.length; i++) {if (i > farthest) {return false;}farthest = Math.max(farthest, i + nums[i]);if (farthest >= nums.length - 1) {return true;}}return true;}}Here:farthestmakes the purpose of the variable clearer than j.The logic is exactly the same.Complexity AnalysisLet n be the length of the array.Time ComplexityWe traverse the array only once:O(n)Space ComplexityWe use only a few variables:O(1)So the final complexity is:Time: O(n)Space: O(1)Important Edge Cases1. Array contains only one elementnums = [0]We are already at the last index.Answer:true2. First position cannot movenums = [0,1]We cannot reach index 1.Answer:false3. Last index is directly reachablenums = [5,0,0,0,0]The first position can jump directly to the end.Answer:true4. Zeros in the middleZeros are not necessarily a problem.For example:[2,0,2]We can jump from index 0 directly to index 2.So the answer is:trueA zero only becomes a problem when it prevents our reachable boundary from extending far enough.Key TakeawayThe most important idea behind Jump Game is:Don't try to decide which jump to make. Track how far you can reach.At every index:Check whether the index is reachable.Calculate how far this index can take us.Update the farthest reachable position.If the last index becomes reachable, return true.If we encounter an index beyond the reachable boundary, return false.The pattern can be summarized as:Reachable?↓Calculate new reach↓Update farthest↓Can we reach the end?This is a classic example of a Greedy Array Traversal problem and is an important pattern to recognize in coding interviews.Final ComplexityApproachTimeSpaceBrute Force / RecursionPotentially exponentialO(n) recursionGreedyO(n)O(1)The greedy solution is optimal because we only need to maintain the farthest position reachable at each point rather than exploring every possible jump sequence.

JavaLeetcodeArrayGreedy ApproachMedium
LeetCode 2144: Minimum Cost of Buying Candies With Discount – Java Greedy Approach Explained

LeetCode 2144: Minimum Cost of Buying Candies With Discount – Java Greedy Approach Explained

IntroductionLeetCode 2144 – Minimum Cost of Buying Candies With Discount is a classic greedy + sorting problem.The question looks simple initially, but the key challenge is understanding:Which candies should be free?How can we minimize the total payment?Why sorting helps?This is a good beginner-friendly greedy interview problem that teaches how to maximize discounts strategically.Problem Link🔗 Minimum Cost of Buying Candies With DiscountProblem StatementA candy shop offers a discount:For every two candies bought, you can get one additional candy for free.Condition:The free candy’s price must be less than or equal to the cheaper purchased candy.You are given an array:cost[i]representing candy prices.Return the minimum total amount needed to buy all candies.Example 1Inputcost = [1,2,3]Output5ExplanationBuy:3 and 2Get:1 freeTotal:3 + 2 = 5Example 2Inputcost = [6,5,7,9,2,2]Output23IntuitionTo maximize savings:The most expensive candies should be grouped together.Why?Because every third candy becomes free.So we want:Expensive candies paidCheapest among the group freeKey Greedy ObservationIf we sort candies in descending order:9, 7, 6, 5, 2, 2Then:Pay 9Pay 7Get 6 freeThen:Pay 5Pay 2Get 2 freeThis produces maximum discount.Brute Force ApproachIdeaTry every grouping combination:Select 2 candiesChoose possible free candyCompute total minimumWhy Brute Force is BadThe number of combinations becomes huge.Time complexity becomes exponential.Not suitable for interviews.Optimized Greedy ApproachStepsSort candies in descending orderTraverse arraySkip every 3rd candyAdd remaining candies to answerJava Solutionclass Solution {public int minimumCost(int[] cost) {if(cost.length == 1) return cost[0];if(cost.length == 2) return cost[0] + cost[1];Arrays.sort(cost);int[] arr = new int[cost.length];int o = 0;for(int j = cost.length - 1; j >= 0; j--) {arr[o] = cost[j];o++;}int sum = 0;int c = 0;for(int i = 0; i < arr.length; i++) {c = i + 1;if(c % 3 == 0) continue;sum += arr[i];}return sum;}}Cleaner Optimized VersionYou can simplify the logic further:class Solution {public int minimumCost(int[] cost) {Arrays.sort(cost);int sum = 0;int count = 0;for(int i = cost.length - 1; i >= 0; i--) {count++;if(count % 3 == 0) continue;sum += cost[i];}return sum;}}Why This WorksAfter descending sorting:Most expensive candies appear firstEvery 3rd candy becomes free.This guarantees:Maximum discount possibleDry RunInputcost = [6,5,7,9,2,2]Step 1: Sort Descending9,7,6,5,2,2Step 2: TraverseGroup 19 -> pay7 -> pay6 -> freeTotal:16Group 25 -> pay2 -> pay2 -> freeTotal:16 + 7 = 23Final Answer23Time Complexity AnalysisSortingO(N log N)TraversalO(N)Total ComplexityO(N log N)Space ComplexityO(N)Because of extra reversed array.Optimized VersionO(1)Ignoring sorting space.Interview ExplanationIn interviews explain:To maximize savings, we should make the free candies as expensive as possible. Sorting in descending order ensures every third candy is the maximum eligible free candy.This demonstrates:Greedy thinkingSorting optimizationMathematical observation skillsCommon Mistakes1. Sorting AscendingAscending order gives smaller discounts.Descending order is necessary.2. Forgetting Every 3rd Candy is FreeCorrect pattern:Pay, Pay, Free3. Using Extra Arrays UnnecessarilyYou can directly traverse sorted array backward.4. Incorrect GroupingAlways group expensive candies together.FAQsQ1. Why descending sorting?To maximize free candy value.Q2. Why skip every third candy?Because the offer gives:1 free candy after buying 2Q3. Can this be solved without sorting?Not optimally.Sorting guarantees best grouping.Q4. Is this a greedy problem?Yes.This is a classic greedy sorting optimization problem.ConclusionLeetCode 2144 is an excellent beginner greedy problem.Main learning points:Sorting strategyGreedy groupingMaximizing discountsEfficient array traversalThe core insight is:Sort candies from largest to smallest and make every third candy free.Once this pattern becomes intuitive, many greedy interview problems become easier to solve.

LeetCodeJavaSortingArrayGreedy ApproachEasy
LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

IntroductionThe Generate Parentheses problem is one of the most important and frequently asked backtracking questions in coding interviews.At first glance, it may look like a simple string generation problem—but the real challenge is to generate only valid (well-formed) parentheses combinations.This problem is a perfect example of:Constraint-based recursionBacktracking with conditionsDecision tree pruningIn this article, we’ll break down the intuition, understand the constraints, and implement a clean and efficient solution.🔗 Problem LinkLeetCode: Generate ParenthesesProblem StatementGiven n pairs of parentheses:👉 Generate all combinations of well-formed parenthesesExamplesExample 1Input:n = 3Output:["((()))","(()())","(())()","()(())","()()()"]Example 2Input:n = 1Output:["()"]Key InsightWe are not generating all possible strings—we are generating only valid parentheses.Rules of Valid ParenthesesNumber of ( must equal number of )At any point:closing brackets should never exceed opening bracketsIntuition (Decision Making)At every step, we have two choices:Add "(" OR Add ")"But we cannot always take both choices.Valid ConditionsWhen can we add "("?If open > 0When can we add ")"?If close > open👉 This ensures the string always remains valid.Decision Tree (n = 3)👉 You can add your tree diagram here for better visualization.Conceptual FlowStart: ""→ "(" → "(("→ "(((" → "((()"→ ...Invalid paths like ")(" are never explored because of constraints.Approach: Backtracking with ConstraintsIdeaKeep track of:Remaining open bracketsRemaining close bracketsBuild string step by stepOnly take valid decisionsJava Codeimport java.util.*;class Solution {// List to store all valid combinationsList<String> lis = new ArrayList<>();public void solve(int open, int close, String curr) {// Base case: no brackets leftif (open == 0 && close == 0) {lis.add(curr); // valid combinationreturn;}// Choice 1: Add opening bracket "("// Allowed only if we still have opening brackets leftif (open > 0) {solve(open - 1, close, curr + "(");}// Choice 2: Add closing bracket ")"// Allowed only if closing brackets > opening bracketsif (open < close) {solve(open, close - 1, curr + ")");}}public List<String> generateParenthesis(int n) {solve(n, n, ""); // start recursionreturn lis;}}Step-by-Step Execution (n = 2)Start: ""→ "("→ "(("→ "(())"→ "()"→ "()()"Complexity AnalysisTime Complexity: O(4ⁿ / √n) (Catalan Number)Space Complexity: O(n) recursion stackWhy Catalan Number?The number of valid parentheses combinations is:Cn = (1 / (n+1)) * (2n choose n)Why This Approach WorksIt avoids invalid combinations earlyUses constraints to prune recursion treeGenerates only valid resultsEfficient compared to brute force❌ Naive Approach (Why It Fails)Generate all combinations of ( and ):Total combinations = 2^(2n)Then filter valid ones👉 Very inefficient → TLEKey TakeawaysThis is a constraint-based recursion problemAlways:Add "(" if availableAdd ")" only if validBacktracking avoids invalid pathsImportant pattern for interviewsCommon Interview VariationsValid parentheses checkingLongest valid parenthesesRemove invalid parenthesesBalanced expressionsConclusionThe Generate Parentheses problem is a must-know backtracking problem. It teaches how to apply constraints during recursion to efficiently generate valid combinations.Once mastered, this pattern becomes extremely useful in solving many advanced recursion problems.Frequently Asked Questions (FAQs)1. Why can’t we add ")" anytime?Because it may create invalid sequences like ")(".2. What is the key trick?Ensure:close > open3. Is recursion the best approach?Yes, it is the most intuitive and efficient method.

MediumLeetCodeJavaRecursion
LeetCode 124: Binary Tree Maximum Path Sum – Java DFS Solution Explained

LeetCode 124: Binary Tree Maximum Path Sum – Java DFS Solution Explained

IntroductionLeetCode 124 – Binary Tree Maximum Path Sum is one of the most important and frequently asked hard-level binary tree interview problems.This problem teaches:Depth First Search (DFS)Bottom-up recursionTree Dynamic ProgrammingRecursive optimizationGlobal answer trackingIt is considered a classic interview problem because it combines:Tree traversalRecursive decision makingPath optimizationNegative value handlingMastering this problem helps in understanding advanced binary tree patterns used in:Diameter problemsTree DPMaximum path problemsGraph recursion problemsProblem Link🔗 https://leetcode.com/problems/binary-tree-maximum-path-sum/Problem StatementGiven the root of a binary tree:Return:Maximum path sum of any non-empty pathA path:Can start from any nodeCan end at any nodeMust follow parent-child connectionsCannot visit a node more than onceImportant:Path does NOT need to pass through rootExample 1Inputroot = [1,2,3]Tree: 1 / \ 2 3Output6Explanation:Best path:2 → 1 → 3Path sum:2 + 1 + 3 = 6Example 2Inputroot = [-10,9,20,null,null,15,7]Tree: -10 / \ 9 20 / \ 15 7Output42Explanation:Best path:15 → 20 → 7Sum:15 + 20 + 7 = 42Key ObservationAt every node:We have two important possibilities.Possibility 1Path continues upward to parent.In this case:We can choose only:ONE sidebecause path cannot split upward.Return value becomes:node + max(left, right)Possibility 2Current node becomes:Highest point of pathThen we can use:left + node + rightThis candidate updates global maximum answer.Core Recursive IdeaAt every node:Calculate left maximum contributionCalculate right maximum contributionIgnore negative pathsUpdate global answerReturn best single-side path upwardWhy Ignore Negative Paths?Negative paths reduce total sum.So:Math.max(path, 0)ensures:Negative contribution is discardedOnly profitable paths are consideredThis is the most important optimization.Your Java Solutionclass Solution { int max = Integer.MIN_VALUE; public int solve(TreeNode roo) { if(roo == null) return 0; int left = Math.max(solve(roo.left), 0); int right = Math.max(solve(roo.right), 0); max = Math.max(max, roo.val + left + right); return roo.val + Math.max(left, right); } public int maxPathSum(TreeNode root) { solve(root); return max; }}Why This WorksFor every node:We calculate:Best path passing through current nodewhich is:left + node + rightThis path may become global maximum.But while returning upward:We can only choose:one directionbecause paths cannot split.Dry RunInput -10 / \ 9 20 / \ 15 7Step 1Leaf nodes:9 → return 915 → return 157 → return 7Step 2At node:20Left:15Right:7Current best path:15 + 20 + 7 = 42Update:max = 42Return upward:20 + max(15,7)= 35Step 3At node:-10Left:9Right:35Candidate:9 + (-10) + 35 = 34Global maximum remains:42Final Answer42Recursive Visualizationsolve(-10) ├── solve(9) │ └── solve(20) ├── solve(15) └── solve(7)Global maximum gets updated during return phase.Brute Force ApproachA brute force approach would:Generate all possible pathsCalculate sumsTrack maximumBut number of paths becomes extremely large.This is inefficient.Brute Force ComplexityTime ComplexityCan become:O(N²)or worse depending on implementation.Optimized DFS ComplexityTime ComplexityO(N)because every node is visited once.Space ComplexityO(H)where:H = height of treeWorst case:O(N)for skewed tree.Important InsightTwo values exist at every node.1. Value Returned UpwardOnly one side allowed:node + max(left, right)2. Value Used for Global MaximumBoth sides allowed:left + node + rightThis distinction is the heart of the problem.Interview ExplanationIn interviews, explain:Every node acts as a potential highest point of a path. We compute the best path through that node while recursively returning the best single-side contribution upward.This demonstrates:Advanced DFS understandingTree DP conceptsRecursive optimizationHandling negative pathsCommon Mistakes1. Returning Both Sides UpwardIncorrect:left + node + rightA path cannot branch upward.2. Forgetting Negative Path HandlingAlways use:Math.max(value, 0)3. Assuming Path Must Pass RootThe path can exist entirely inside a subtree.4. Not Using Global VariableMaximum path may occur anywhere.FAQsQ1. Does path need to start from root?No.It can start and end anywhere.Q2. Why ignore negative sums?Negative paths reduce overall answer.Q3. Why can we return only one side?Because a path moving upward cannot split into two directions.Q4. Is this problem important for interviews?Extremely important.It is one of the most famous hard-level tree problems.Related ProblemsAfter mastering this problem, practice:Diameter of Binary TreeBalanced Binary TreeMaximum Depth of Binary TreeConclusionLeetCode 124 is one of the best problems for learning advanced binary tree recursion.It teaches:DFS optimizationTree dynamic programmingRecursive decision makingNegative path handlingGlobal answer trackingThe key insight is:Every node can become the highest point of a maximum path.Once this recursive pattern becomes clear, many advanced tree and graph problems become much easier to solve.

LeetCodeBinary Tree Maximum Path SumJavaBinary TreeDFSTreeRecursionDynamic Programming on TreesHard
LeetCode 1344: Angle Between Hands of a Clock – Java Mathematical Solution Explained

LeetCode 1344: Angle Between Hands of a Clock – Java Mathematical Solution Explained

IntroductionLeetCode 1344, Angle Between Hands of a Clock, is a classic mathematics and geometry problem frequently asked in coding interviews.Unlike many algorithmic problems involving arrays, trees, or dynamic programming, this challenge focuses entirely on understanding how an analog clock works and converting that understanding into a simple mathematical formula.The goal is to determine the smaller angle formed between the hour hand and the minute hand for a given time.This problem is an excellent example of how mathematical observation can transform what appears to be a simulation problem into a constant-time solution.Problem Link - Angle Between Hands of a ClockProblem StatementGiven:An integer hourAn integer minutesReturn the smaller angle formed between:The hour handThe minute handof an analog clock.The answer should be accurate within 10^-5.Example 1Inputhour = 12minutes = 30Output165ExplanationAt 12:30:Minute hand points at 6Hour hand lies halfway between 12 and 1The smaller angle between them is:165°Example 2Inputhour = 3minutes = 30Output75Example 3Inputhour = 3minutes = 15Output7.5Understanding Clock MathematicsTo solve this problem efficiently, we first need to understand how clock hands move.Minute Hand MovementA clock contains:360°and60 minutesTherefore:360 / 60 = 6°The minute hand moves:6° per minuteFormula:Minute Angle = 6 × minutesExample:30 minutes6 × 30 = 180°Hour Hand MovementThe clock has:12 hoursand360°Therefore:360 / 12 = 30°The hour hand moves:30° per hourFormula:Hour Angle = 30 × hourHowever, most beginners miss one important detail.The Hour Hand Never Stays StillAt 3:30, the hour hand is not exactly at 3.It moves continuously as minutes pass.Since:30° per hourand60 minutes per hourthe hour hand moves:30 / 60 = 0.5°per minute.Therefore:Hour Angle =(30 × hour) + (0.5 × minutes)Deriving the Final FormulaMinute hand angle:6 × minutesHour hand angle:30 × hour + 0.5 × minutesDifference:|Hour Angle − Minute Angle|Substituting:|(30 × hour + 0.5 × minutes)− (6 × minutes)|Simplifying:|30 × hour − 5.5 × minutes|This gives one angle.But clocks always form two angles.Choosing the Smaller AngleSuppose:Difference = 250°The other angle would be:360 − 250 = 110°Since the problem asks for the smaller angle:Math.min(diff, 360 - diff)Optimal Java Solutionclass Solution { public double angleClock(int hour, int minutes) { double angle = Math.abs((30 * hour) - (5.5 * minutes)); return angle > 180 ? 360 - angle : angle; }}Dry RunInputhour = 3minutes = 15Hour Hand Angle30 × 3 = 900.5 × 15 = 7.5Total = 97.5°Minute Hand Angle6 × 15 = 90°Difference|97.5 - 90|=7.5°Smaller Angle7.5°Output:7.5Dry Run 2Inputhour = 12minutes = 30Formula|30 × 12 − 5.5 × 30||360 − 165|195°Since:195 > 180Choose:360 − 195=165°Output:165Why This Solution Is OptimalMany beginners attempt to:Simulate clock positionsCreate arraysUse loopsNone of these are required.The entire problem can be solved using a direct mathematical formula.No iteration is needed.No additional data structures are needed.Complexity AnalysisTime ComplexityO(1)Only a few arithmetic operations are performed.Space ComplexityO(1)No extra memory is used.Common Interview MistakesMistake 1Ignoring minute movement of the hour hand.Wrong:Hour Angle = 30 × hourCorrect:Hour Angle =30 × hour + 0.5 × minutesMistake 2Returning the larger angle.The problem asks for:Smaller AngleAlways compare:angleand360 - angleMistake 3Forgetting absolute value.Without:Math.abs()negative angles may occur.Key TakeawaysMinute hand moves 6° every minute.Hour hand moves 30° every hour.Hour hand also moves 0.5° every minute.The formula simplifies to:|30 × hour − 5.5 × minutes|Always return the smaller of the two possible angles.The solution runs in O(1) time and O(1) space.ConclusionLeetCode 1344: Angle Between Hands of a Clock is a beautiful mathematical problem that demonstrates how understanding the underlying mechanics of a clock leads to an elegant constant-time solution.Instead of simulating movement, we directly calculate the positions of both hands using geometry and arithmetic. This results in a clean, interview-friendly solution with optimal performance.Problems like this highlight an important lesson in programming:Sometimes the best algorithm is not an algorithm at all—it is mathematics.

LeetcodeJavaMediumClock AngleMaths
Ai Assistant Kas