Search Blogs

Showing results for "hashing"

Found 5 results

Understanding HashMap and Hashing Techniques: A Complete Guide

Understanding HashMap and Hashing Techniques: A Complete Guide

What is HashMap?HashMap is a non-linear data structure that lives inside Java's collection framework, alongside other structures like Trees and Graphs (see the generated image above). What makes it special? It uses a clever technique called hashing to store and retrieve data at blazing speeds.Think of hashing as a smart address system. It converts large keys (like long strings or big numbers) into smaller values that work as array indices. This simple trick transforms your data lookup from slow O(n)O(n) or O(log⁡n)O(logn) operations into lightning-fast O(1)O(1) access times!Understanding Hashing MappingsBefore diving deeper, let's understand the four types of hashing mappings:One-to-one mapping — Each key maps to exactly one indexMany-to-one mapping — Multiple keys can map to the same indexOne-to-many mapping — One key maps to multiple indicesMany-to-many mapping — Multiple keys map to multiple indicesHashMap primarily uses one-to-one and many-to-one mapping strategies to achieve its performance goals.The Problem: Why Not Just Use Arrays?Let's say you want to store 7 elements with keys: 1, 5, 23, 57, 234, 678, and 1000.Using direct indexing (where key = array index), you'd need an array of size 1000 just to store 7 items! That leaves 993 empty slots wasting precious memory. Imagine having a parking lot with 1000 spaces for just 7 cars — totally inefficient!This is the exact problem hash functions solve.Hash Functions: The SolutionA hash function takes your key and calculates which array index to use. The beauty? You can now store those same 7 elements in an array of just size 10!The most common hash function uses the modulus operator:hash(key)=keymod array sizehash(key)=keymodarray sizeExample: With array size = 10:Key 57 → Index: 57mod 10=757mod10=7Key 234 → Index: 234mod 10=4234mod10=4Key 1000 → Index: 1000mod 10=01000mod10=0Now you only need an array of size 10 instead of 1000. Problem solved!Three Popular Hash Function TypesModulus MethodThe most widely used technique. Divide the key by array size (or a prime number) and use the remainder as the index.index=keymod sizeindex=keymodsizeMid Square MethodSquare the key value, then extract the middle digits to form your hash value.Example: Key = 57 → 572=3249572=3249 → Extract middle digits "24"Folding HashingDivide the key into equal parts, add them together, then apply modulus.Example: Key = 123456Split into: 12, 34, 56Sum: 12+34+56=10212+34+56=102Apply modulus: 102mod 10=2102mod10=2The Collision ProblemHere's the catch: sometimes two different keys produce the same index. This is called a collision.Example:Key 27 → 27mod 10=727mod10=7Key 57 → 57mod 10=757mod10=7Both keys want index 7! We need smart strategies to handle this.Collision Resolution: Two Main TechniquesTechnique 1: Open Chaining (Separate Chaining)Mapping Type: Many-to-oneWhen a collision happens, create a linked list at that index and store all colliding values in sorted order.Example: Keys 22 and 32 both map to index 2:Index 2: [22] → [32] → nullAdvantage: Simple and works well in practiceDrawback: If too many collisions occur, the linked list becomes long and searching degrades to O(n)O(n). However, Java's collection framework uses highly optimized hash functions that achieve amortized O(1)O(1) time complexity.Technique 2: Closed Addressing (Open Addressing)Mapping Type: One-to-manyInstead of creating a list, find another empty slot in the array. There are three approaches:Linear ProbingWhen collision occurs, check the next index. If it's occupied, keep checking the next one until you find an empty slot.Hash Function:h(x)=xmod sizeh(x)=xmodsizeOn Collision:h(x)=(h(x)+i)mod sizeh(x)=(h(x)+i)modsizewhere i=0,1,2,3,…i=0,1,2,3,…Example: Keys 22 and 32 both map to index 2:Store 22 at index 2Try 32 at index 2 → occupiedCheck index 3 → empty, store 32 thereProblems:Clustering: Keys bunch together in adjacent indices, slowing down searchesDeleted Slot Problem: When you delete a key, it creates an empty slot that breaks the search chainThe Deleted Slot Problem Explained:Keys 22 and 32 are at indices 2 and 3Delete key 22 from index 2Now when searching for key 32, the algorithm reaches index 2 (empty), thinks key 32 doesn't exist, and stops searching!Solution: Mark deleted slots with a special marker (like -1) or perform rehashing after deletions.Quadratic ProbingSame concept as linear probing, but instead of checking consecutive slots, jump in quadratic increments: 1, 4, 9, 16, 25...Hash Function:h(x)=xmod sizeh(x)=xmodsizeOn Collision:h(x)=(h(x)+i2)mod sizeh(x)=(h(x)+i2)modsizewhere i=0,1,2,3,…i=0,1,2,3,…Advantage: Significantly reduces clusteringDrawback: Still suffers from the deleted slot problemDouble HashingThe most sophisticated approach! Uses two different hash functions to create unique probe sequences for each key.First Hash Function:h1(x)=xmod sizeh1(x)=xmodsizeSecond Hash Function:h2(x)=prime−(xmod prime)h2(x)=prime−(xmodprime)On Collision:h(x)=(h1(x)+i×h2(x))mod sizeh(x)=(h1(x)+i×h2(x))modsizewhere i=0,1,2,3,…i=0,1,2,3,…Advantage: Effectively avoids clustering and provides the best performance among probing techniquesLoad Factor: The Performance IndicatorThe load factor tells you how full your hash table is:Load Factor=Number of elementsArray sizeLoad Factor=Array sizeNumber of elementsPerformance GuidelinesLoad Factor ≤ 0.5 → Good performance, fast operations Load Factor > 0.7 → Poor performance, time to rehash ExamplesBad Load Factor:Array size = 10, Elements = 8Load Factor = 8/10=0.88/10=0.8Action: Rehash the array (typically double the size)Good Load Factor:Array size = 200, Elements = 100Load Factor = 100/200=0.5100/200=0.5Action: No changes needed, performing optimallyWhat is Rehashing?When the load factor exceeds the threshold (usually 0.7), the hash table is resized — typically doubled in size. All existing elements are then rehashed and redistributed into the new larger array. This maintains optimal performance as your data grows.Performance SummaryHashMap delivers exceptional average-case performance:Insertion: O(1)O(1)Deletion: O(1)O(1)Search: O(1)O(1)However, in the worst case (many collisions with poor hash functions), operations can degrade to O(n)O(n).The key to maintaining O(1)O(1) performance:Use a good hash functionChoose an appropriate collision resolution strategyMonitor and maintain a healthy load factorRehash when necessaryConclusionHashMap is one of the most powerful and frequently used data structures in programming. By understanding hashing techniques, collision resolution strategies, and load factors, you can write more efficient code and make better design decisions.Whether you're building a cache, implementing a frequency counter, or solving complex algorithm problems, HashMap is your go-to tool for fast data access!

hashmapdata-structureshashingjavaalgorithmscollision-resolutiontime-complexity
LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

Try the ProblemYou can solve the problem here:https://leetcode.com/problems/find-unique-binary-string/Problem DescriptionYou are given an array nums containing n unique binary strings, where each string has length n.Your task is to return any binary string of length n that does not appear in the array.Important ConditionsEach string consists only of '0' and '1'.Every string in the array is unique.The output must be a binary string of length n.If multiple valid answers exist, any one of them is acceptable.ExamplesExample 1Inputnums = ["01","10"]Output"11"ExplanationPossible binary strings of length 2:00011011Since "01" and "10" are already present, valid answers could be:00 or 11Example 2Inputnums = ["00","01"]Output"11"Another valid output could be:10Example 3Inputnums = ["111","011","001"]Output101Other valid answers include:000010100110Constraintsn == nums.length1 <= n <= 16nums[i].length == nnums[i] consists only of '0' and '1'All strings in nums are uniqueImportant ObservationThe total number of binary strings of length n is:2^nBut the array contains only:n stringsSince 2^n grows very quickly and n ≤ 16, there are many possible binary strings missing from the array. Our goal is simply to construct one of those missing strings.Thinking About the ProblemBefore jumping into coding, it's useful to think about different strategies that could help us generate a binary string that does not appear in the array.Possible Ways to Think About the ProblemWhen approaching this problem, several ideas may come to mind:Generate all possible binary strings of length n and check which one is missing.Store all strings in a HashSet or HashMap and construct a candidate string to verify whether it exists.Manipulate existing strings by flipping bits to create new combinations.Use a mathematical trick that guarantees the new string is different from every string in the list.Each of these approaches leads to a different solution strategy.In this article, we will walk through these approaches and understand how they work.Approach 1: Brute Force – Generate All Binary StringsIdeaThe simplest idea is to generate every possible binary string of length n and check whether it exists in the given array.Since there are:2^n possible binary stringsWe can generate them one by one and return the first string that does not appear in nums.StepsConvert numbers from 0 to (2^n - 1) into binary strings.Pad the binary string with leading zeros so its length becomes n.Check if that string exists in the array.If not, return it.Time ComplexityO(2^n * n)This works because n is at most 16, but it is still not the most elegant approach.Approach 2: HashMap + Bit Flipping (My Approach)IdeaWhile solving this problem, another idea is to store all given binary strings inside a HashMap for quick lookup.Then we can try to construct a new binary string by flipping bits from the existing strings.The intuition is simple:If the current character is '0', change it to '1'.If the current character is '1', change it to '0'.By flipping bits at different positions, we attempt to build a new binary combination.Once the string is constructed, we check whether it already exists in the map.If the generated string does not exist, we return it as our answer.Java Implementation (My Solution)class Solution { public String findDifferentBinaryString(String[] nums) { int len = nums[0].length(); // HashMap to store all given binary strings HashMap<String, Integer> mp = new HashMap<>(); for(int i = 0; i < nums.length; i++){ mp.put(nums[i], i); } int cou = 0; String ans = ""; for(int i = 0; i < nums.length; i++){ if(cou < len){ // Flip the current bit if(nums[i].charAt(cou) == '0'){ ans += '1'; cou++; } else{ ans += '0'; cou++; } }else{ // If generated string does not exist in map if(!mp.containsKey(ans)){ return ans; } // Reset and try building again ans = ""; cou = 0; } } return ans; }}Time ComplexityO(n²)Because we iterate through the array and perform string operations.Space ComplexityO(n)For storing the strings in the HashMap.Approach 3: Cantor’s Diagonalization (Optimal Solution)IdeaA clever mathematical observation allows us to construct a string that must differ from every string in the array.We build a new string such that:The first character differs from the first string.The second character differs from the second string.The third character differs from the third string.And so on.By ensuring that the generated string differs from each string at least at one position, it is guaranteed not to exist in the array.This technique is known as Cantor’s Diagonalization.Java Implementationclass Solution { public String findDifferentBinaryString(String[] nums) { int n = nums.length; StringBuilder result = new StringBuilder(); for(int i = 0; i < n; i++){ // Flip the diagonal bit if(nums[i].charAt(i) == '0'){ result.append('1'); } else{ result.append('0'); } } return result.toString(); }}Time ComplexityO(n)We only traverse the array once.Space ComplexityO(n)For storing the resulting string.Comparison of ApproachesApproachTime ComplexitySpace ComplexityNotesBrute ForceO(2^n * n)O(n)Simple but inefficientHashMap + Bit FlippingO(n²)O(n)Constructive approachCantor DiagonalizationO(n)O(n)Optimal and elegantKey TakeawaysThis problem highlights an interesting concept in algorithm design:Sometimes the best solution is not searching for the answer but constructing one directly.By understanding the structure of the input, we can generate a result that is guaranteed to be unique.ConclusionThe Find Unique Binary String problem can be solved using multiple strategies, ranging from brute force enumeration to clever mathematical construction.While brute force works due to the small constraint (n ≤ 16), more elegant solutions exist. Using hashing or constructive approaches improves efficiency and demonstrates deeper algorithmic thinking.Among all approaches, the Cantor Diagonalization technique provides the most efficient and mathematically guaranteed solution.Understanding problems like this helps strengthen skills in string manipulation, hashing, and constructive algorithms, which are commonly tested in coding interviews.

Binary StringsHashingCantor DiagonalizationLeetCodeMedium
LeetCode 3761 Minimum Absolute Distance Between Mirror Pairs | Java HashMap Solution

LeetCode 3761 Minimum Absolute Distance Between Mirror Pairs | Java HashMap Solution

IntroductionSome problems look simple at first—but hide a clever trick inside.LeetCode 3761 – Minimum Absolute Distance Between Mirror Pairs is one such problem. It combines:Number manipulation (digit reversal)HashingEfficient searchingIf approached naively, this problem can easily lead to O(n²) time complexity—which is not feasible for large inputs.In this article, we will walk through:Problem intuitionNaive approach (and why it fails)Optimized HashMap solutionStep-by-step explanationClean Java code with comments🔗 Problem LinkLeetCode: Minimum Absolute Distance Between Mirror PairsTo gain a deeper understanding of the problem, it is highly recommended that you review this similar problem Closest Equal Element Queries here is the link of the article. Both cases follow a nearly identical pattern, and studying the initial example will provide valuable context for the current task.Problem StatementYou are given an integer array nums.A mirror pair (i, j) satisfies:0 ≤ i < j < nums.lengthreverse(nums[i]) == nums[j]👉 Your task is to find:The minimum absolute distance between such pairsIf no mirror pair exists, return -1.ExamplesExample 1Input:nums = [12, 21, 45, 33, 54]Output:1Explanation:(0,1) → reverse(12) = 21 → distance = 1(2,4) → reverse(45) = 54 → distance = 2✔ Minimum = 1Example 2Input:nums = [120, 21]Output:1Example 3Input:nums = [21, 120]Output:-1Key InsightThe core idea is:Instead of checking every pair,store reversed values and match on the fly.❌ Naive Approach (Brute Force)IdeaCheck all pairs (i, j)Reverse nums[i]Compare with nums[j]ComplexityTime: O(n²) ❌Space: O(1)ProblemWith n ≤ 100000, this approach will definitely cause TLE.✅ Optimized Approach (HashMap)IntuitionWhile iterating through the array:Reverse the current numberCheck if this number was already seen as a reversed valueIf yes → we found a mirror pairKey TrickInstead of storing original numbers:👉 Store reversed values as keysThis allows instant lookup.Java Code (With Detailed Comments)import java.util.*;class Solution {// Function to reverse digits of a numberpublic int reverse(int m) {int rev = 0;while (m != 0) {int dig = m % 10; // extract last digitm = m / 10; // remove last digitrev = rev * 10 + dig; // build reversed number}return rev;}public int minMirrorPairDistance(int[] nums) {// Map to store reversed values and their indicesHashMap<Integer, Integer> mp = new HashMap<>();int min = Integer.MAX_VALUE;for (int i = 0; i < nums.length; i++) {// Check if current number exists in map// Meaning: some previous number had reverse equal to thisif (mp.containsKey(nums[i])) {// Calculate distanceint prevIndex = mp.get(nums[i]);min = Math.min(min, Math.abs(i - prevIndex));}// Reverse current numberint revVal = reverse(nums[i]);// Store reversed value with indexmp.put(revVal, i);}// If no pair found, return -1return min == Integer.MAX_VALUE ? -1 : min;}}Step-by-Step Dry RunInput:nums = [12, 21, 45, 33, 54]Execution:IndexValueReverseMap CheckAction01221not foundstore (21 → 0)12112founddistance = 124554not foundstore (54 → 2)33333not foundstore (33 → 3)45445founddistance = 2👉 Minimum = 1Complexity AnalysisTime ComplexityReversing number → O(digits) ≈ O(log n)Loop → O(n)👉 Overall: O(n)Space ComplexityHashMap stores at most n elements👉 O(n)Why This Approach WorksAvoids unnecessary pair comparisonsUses hashing for constant-time lookupProcesses array in a single passKey TakeawaysAlways think of hashing when matching conditions existReversing numbers can convert the problem into a lookup problemAvoid brute force when constraints are largeThis is a classic “store & check” patternCommon Interview PatternThis problem is similar to:Two Sum (hashing)Reverse pairsMatching transformationsConclusionThe Minimum Absolute Distance Between Mirror Pairs problem is a great example of how a simple optimization (using a HashMap) can reduce complexity from O(n²) → O(n).Understanding this pattern will help you solve many similar problems involving:TransformationsMatching conditionsEfficient lookupsFrequently Asked Questions (FAQs)1. Why store reversed value instead of original?Because we want to quickly check if a number matches the reverse of a previous number.2. What if multiple same reversed values exist?The map stores the latest index, ensuring minimum distance is considered.3. Can this be solved without HashMap?Yes, but it will result in inefficient O(n²) time.

LeetCodeArrayJavaMediumHashMap
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium
Ai Assistant Kas