Search Blogs

Showing results for "Java"

Found 30 results

OOPs in Java - Complete Guide With Simple Examples

IntroductionObject Oriented Programming — or OOPs — is the foundation of Java. Almost every Java program you will ever write or read is built around OOPs concepts. The good news is these concepts are not complicated at all. They are actually modeled after how we think about real life things.By the end of this article you will understand every core OOPs concept clearly — not just enough to answer interview questions, but enough to actually use them confidently in your code.What Is Object Oriented Programming?Before OOPs, programmers wrote procedural code — a long sequence of instructions executed top to bottom. As programs grew bigger, this became a nightmare to manage. You could not organize related data and behavior together, reuse code cleanly, or model real world things naturally.OOPs solved this by organizing code around objects — just like the real world is organized around things. A car, a person, a bank account — each is a thing with properties and behaviors. OOPs lets you model these things directly in code.Java is a purely object oriented language (almost everything in Java is an object). That is why understanding OOPs is not optional in Java — it is essential.Class — The BlueprintA class is a blueprint or template. It defines what properties and behaviors an object of that type will have. The class itself is not an actual thing — it is just the design.Think of a class like an architectural blueprint of a house. The blueprint is not a house. But from one blueprint you can build many houses.class Car { // properties (what a car HAS) String brand; String color; int speed; // behaviors (what a car DOES) void accelerate() { System.out.println(brand + " is speeding up!"); } void brake() { System.out.println(brand + " is slowing down!"); }}Car is the blueprint. It defines that every car has a brand, color, speed, and can accelerate and brake. No actual car exists yet — this is just the design.Object — The Real ThingAn object is an actual instance created from a class. When you create an object, you are building a real house from the blueprint.public class Main { public static void main(String[] args) { // creating objects from the Car class Car car1 = new Car(); car1.brand = "Toyota"; car1.color = "Red"; car1.speed = 120; Car car2 = new Car(); car2.brand = "BMW"; car2.color = "Black"; car2.speed = 200; car1.accelerate(); // Toyota is speeding up! car2.brake(); // BMW is slowing down! }}car1 and car2 are two different objects from the same Car blueprint. Each has its own data but shares the same structure and behaviors.Constructor — The Object InitializerA constructor is a special method that runs automatically when an object is created. It is used to set initial values.class Car { String brand; String color; int speed; // constructor — same name as class, no return type Car(String brand, String color, int speed) { this.brand = brand; this.color = color; this.speed = speed; } void accelerate() { System.out.println(brand + " is speeding up!"); }}// Now creating objects is cleanerCar car1 = new Car("Toyota", "Red", 120);Car car2 = new Car("BMW", "Black", 200);The this keyword refers to the current object — it distinguishes between the parameter brand and the object's field brand.The Four Pillars of OOPsEverything in OOPs builds on four core concepts. These are what interviewers ask about and what real code is organized around.Pillar 1: Encapsulation — Wrapping and Protecting DataEncapsulation means bundling data (fields) and the methods that work on that data together in one class — and controlling access from outside.Think of a capsule pill. The medicine inside is protected by the outer shell. You do not mess with the medicine directly — you just swallow the capsule.In Java, encapsulation is achieved using access modifiers (private, public) and getters/setters.class BankAccount { private double balance; // private — no direct access from outside private String owner; BankAccount(String owner, double initialBalance) { this.owner = owner; this.balance = initialBalance; } // getter — read the balance public double getBalance() { return balance; } // setter with validation — controlled access public void deposit(double amount) { if (amount > 0) { balance += amount; System.out.println("Deposited: " + amount); } else { System.out.println("Invalid amount!"); } } public void withdraw(double amount) { if (amount > 0 && amount <= balance) { balance -= amount; } else { System.out.println("Insufficient funds!"); } }}BankAccount account = new BankAccount("Alice", 1000);// account.balance = -5000; // ERROR — private, cannot access directlyaccount.deposit(500); // controlled access through methodSystem.out.println(account.getBalance()); // 1500.0Why encapsulation matters: Without it, anyone could set balance = -999999 directly. With it, you control exactly how data can be changed — protecting your object's integrity.Pillar 2: Inheritance — Reusing Code Through Parent-Child RelationshipInheritance allows one class to acquire the properties and behaviors of another class. The child class gets everything the parent has and can add its own things on top.Think of it like genetics. A child inherits traits from their parents but also develops their own unique characteristics.In Java, inheritance uses the extends keyword.// Parent classclass Animal { String name; Animal(String name) { this.name = name; } void eat() { System.out.println(name + " is eating."); } void sleep() { System.out.println(name + " is sleeping."); }}// Child class inherits from Animalclass Dog extends Animal { String breed; Dog(String name, String breed) { super(name); // calls Animal's constructor this.breed = breed; } // Dog's own behavior void bark() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } void meow() { System.out.println(name + " says: Meow!"); }}Dog dog = new Dog("Buddy", "Labrador");dog.eat(); // inherited from Animal — Buddy is eating.dog.sleep(); // inherited from Animal — Buddy is sleeping.dog.bark(); // Dog's own method — Buddy says: Woof!Cat cat = new Cat("Whiskers");cat.eat(); // inherited — Whiskers is eating.cat.meow(); // Cat's own — Whiskers says: Meow!super() calls the parent class constructor. super.methodName() calls a parent class method.Why inheritance matters: You write eat() and sleep() once in Animal and every animal class gets them for free. No repetition, clean organization.Pillar 3: Polymorphism — One Interface, Many FormsPolymorphism means the same method name behaves differently depending on the object calling it. It comes in two flavors.The word itself means "many forms" — same action, different results based on who is doing it.Think of a "speak" command given to different animals. You tell a dog to speak — it barks. You tell a cat to speak — it meows. Same command, different behavior.Method Overriding (Runtime Polymorphism)A child class provides its own version of a method already defined in the parent class.class Animal { String name; Animal(String name) { this.name = name; } void makeSound() { System.out.println(name + " makes a sound."); }}class Dog extends Animal { Dog(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Meow!"); }}class Cow extends Animal { Cow(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Moo!"); }}Animal[] animals = { new Dog("Buddy"), new Cat("Whiskers"), new Cow("Bella")};for (Animal a : animals) { a.makeSound(); // different behavior for each!}// Buddy says: Woof!// Whiskers says: Meow!// Bella says: Moo!Same makeSound() call on an Animal reference — but the actual behavior depends on what the object really is at runtime. That is runtime polymorphism.Method Overloading (Compile-Time Polymorphism)Same method name, different parameters in the same class.class Calculator { int add(int a, int b) { return a + b; } double add(double a, double b) { return a + b; } int add(int a, int b, int c) { return a + b + c; }}Calculator calc = new Calculator();calc.add(2, 3); // calls first method — 5calc.add(2.5, 3.5); // calls second method — 6.0calc.add(1, 2, 3); // calls third method — 6Java decides which version to call at compile time based on the argument types and count.Pillar 4: Abstraction — Hiding Complexity, Showing EssentialsAbstraction means showing only the necessary details to the user and hiding the internal complexity. You expose what something does, not how it does it.Think of driving a car. You know the steering wheel turns the car and the pedal accelerates it. You do not need to know how the engine combustion works internally. The complexity is hidden — only what you need to use is exposed.Java achieves abstraction through abstract classes and interfaces.Abstract ClassAn abstract class cannot be instantiated directly. It can have abstract methods (no body — child must implement) and regular methods (with body).abstract class Shape { String color; Shape(String color) { this.color = color; } // abstract method — no body, child MUST implement abstract double calculateArea(); // regular method — shared behavior void displayColor() { System.out.println("Color: " + color); }}class Circle extends Shape { double radius; Circle(String color, double radius) { super(color); this.radius = radius; } @Override double calculateArea() { return Math.PI * radius * radius; }}class Rectangle extends Shape { double width, height; Rectangle(String color, double width, double height) { super(color); this.width = width; this.height = height; } @Override double calculateArea() { return width * height; }}Shape circle = new Circle("Red", 5);Shape rect = new Rectangle("Blue", 4, 6);circle.displayColor(); // Color: RedSystem.out.println(circle.calculateArea()); // 78.53...System.out.println(rect.calculateArea()); // 24.0InterfaceAn interface is a 100% abstract contract — it only defines what methods a class must have, with no implementation (in older Java). A class can implement multiple interfaces.interface Flyable { void fly(); // every class implementing this MUST define fly()}interface Swimmable { void swim();}class Duck implements Flyable, Swimmable { @Override public void fly() { System.out.println("Duck is flying!"); } @Override public void swim() { System.out.println("Duck is swimming!"); }}Duck duck = new Duck();duck.fly(); // Duck is flying!duck.swim(); // Duck is swimming!Key difference between abstract class and interface:A class can extend only one abstract class but can implement multiple interfaces. Use abstract class when classes share common code. Use interface when you want to define a contract that unrelated classes can follow.Access Modifiers — Quick ReferenceAccess modifiers control who can access your class members:ModifierSame ClassSame PackageSubclassEverywhereprivate✅❌❌❌default✅✅❌❌protected✅✅✅❌public✅✅✅✅General rule — make fields private, make methods public unless there is a reason not to. This is encapsulation in practice.Quick Summary — All OOPs Concepts in One PlaceClass — Blueprint/template that defines structure and behaviorObject — Real instance created from a class using newConstructor — Special method that initializes an object when createdEncapsulation — Bundle data and methods together, control access with private/publicInheritance — Child class gets parent's properties and behaviors using extendsPolymorphism — Same method name behaves differently (overriding = runtime, overloading = compile time)Abstraction — Hide complexity, show only essentials using abstract class or interfaceFAQs — People Also AskQ1. What is the difference between a class and an object in Java? A class is the blueprint — it defines structure but does not exist in memory as a usable thing. An object is a real instance created from that blueprint using new. You can create many objects from one class, just like building many houses from one blueprint.Q2. What is the difference between abstract class and interface in Java? An abstract class can have both abstract (no body) and concrete (with body) methods, and a class can extend only one. An interface traditionally has only abstract methods and a class can implement multiple interfaces. Use abstract class for shared code, interface for defining contracts.Q3. What is the difference between method overriding and overloading? Overriding happens in a parent-child relationship — the child redefines a parent method with the same name and parameters. Overloading happens in the same class — same method name but different parameters. Overriding is resolved at runtime, overloading at compile time.Q4. Why is OOPs important in Java? Java is built entirely around OOPs. Every piece of Java code lives inside a class. OOPs enables code reuse through inheritance, data protection through encapsulation, flexibility through polymorphism, and simplicity through abstraction — all essential for building large, maintainable applications.ConclusionOOPs in Java is not a collection of confusing terms — it is a natural way of thinking about and organizing code. Classes are blueprints, objects are real things, encapsulation protects data, inheritance reuses code, polymorphism provides flexibility, and abstraction hides complexity.Once these four pillars feel natural, you will start seeing them everywhere — in every Java library, every framework, every codebase. That is when Java truly starts to click.

OOPsJavaClassesObjectsInheritancePolymorphismEncapsulationAbstraction

Queue Data Structure Complete Guide - Java Explained With All Operations

IntroductionIf you have been learning Data Structures and Algorithms, you have probably already spent time with arrays, linked lists, and stacks. Now it is time to meet one of the most important and widely used data structures in computer science — the Queue.Queue is not just a theoretical concept. It powers some of the most critical systems you use every day — from how your printer handles jobs, to how your CPU schedules tasks, to how Google Maps finds the shortest path between two locations. Understanding Queue deeply means understanding how real systems work.In this complete guide we will cover absolutely everything — what a Queue is, how it differs from a Stack, every type of Queue, all operations with code, Java implementations, time and space complexity, common interview questions, and the most important LeetCode problems that use Queue.What Is a Queue?A Queue is a linear data structure that follows the FIFO principle — First In First Out. This means the element that was added first is the one that gets removed first.Think of it exactly like a real-world queue (a line of people). The person who joined the line first gets served first. No cutting in line, no serving from the back — strict order from front to back.This is the fundamental difference between a Queue and a Stack:Stack → LIFO (Last In First Out) — like a stack of plates, you take from the topQueue → FIFO (First In First Out) — like a line of people, you serve from the frontReal Life Examples of QueueBefore writing a single line of code, let us understand where queues appear in real life. This will make every technical concept feel natural.Printer Queue — when you send multiple documents to print, they print in the order they were sent. The first document sent prints first.CPU Task Scheduling — your operating system manages running processes in a queue. Tasks get CPU time in the order they arrive (in basic scheduling).Customer Service Call Center — when you call a helpline and are put on hold, you are placed in a queue. The first caller on hold gets connected first.WhatsApp Messages — messages are delivered in the order they are sent. The first message sent is the first one received.BFS (Breadth First Search) — every time you use Google Maps or any navigation app to find the shortest path, it uses BFS internally which is entirely powered by a Queue.Ticket Booking Systems — online booking portals process requests in the order they arrive. First come first served.Queue Terminology — Key Terms You Must KnowBefore diving into code, let us get the vocabulary right:Front — the end from which elements are removed (dequeued). This is where the "first person in line" stands.Rear (or Back) — the end at which elements are added (enqueued). New arrivals join here.Enqueue — the operation of adding an element to the rear of the queue. Like joining the back of a line.Dequeue — the operation of removing an element from the front of the queue. Like the first person in line being served and leaving.Peek (or Front) — looking at the front element without removing it. Like seeing who is first in line without serving them yet.isEmpty — checking whether the queue has no elements.isFull — relevant for fixed-size queues, checking whether no more elements can be added.Types of QueuesThis is where most beginners get confused. There is not just one type of Queue — there are several variations each designed to solve specific problems.1. Simple Queue (Linear Queue)The most basic form. Elements enter from the rear and leave from the front. Strict FIFO, nothing fancy.Enqueue → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue rear frontProblem with Simple Queue: In array-based implementation, once elements are dequeued from the front, those slots cannot be reused even if there is space. This wastes memory. This is why Circular Queue was invented.2. Circular QueueIn a Circular Queue, the rear wraps around to the front when it reaches the end of the array. The last position connects back to the first, forming a circle. This solves the wasted space problem of simple queues. [1] [2] [3] / \ [6] [4] \ / [5] ← rearUsed in: CPU scheduling, memory management, traffic light systems, streaming buffers.3. Double Ended Queue (Deque)A Deque (pronounced "deck") allows insertion and deletion from both ends — front and rear. It is the most flexible queue type.Enqueue Front → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue FrontEnqueue Rear → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue RearTwo subtypes:Input Restricted Deque — insertion only at rear, deletion from both endsOutput Restricted Deque — deletion only at front, insertion at both endsUsed in: browser history (back and forward), undo-redo operations, sliding window problems.4. Priority QueueElements are not served in FIFO order — instead each element has a priority and the element with the highest priority is served first regardless of when it was added.Think of an emergency room. A patient with a critical injury jumps ahead of someone with a minor cut even if they arrived later.Two types:Max Priority Queue — highest value = highest priorityMin Priority Queue — lowest value = highest priorityUsed in: Dijkstra's shortest path, Huffman encoding, A* search algorithm, task scheduling with priorities.5. Blocking QueueA thread-safe queue used in multi-threading. If the queue is empty, a thread trying to dequeue will wait (block) until an element is available. If the queue is full, a thread trying to enqueue will wait until space is available.Used in: Producer-Consumer problems, thread pool implementations, Java's java.util.concurrent package.Queue Operations and Time ComplexityEvery queue operation has a specific time complexity that you must know cold for interviews.OperationDescriptionTime ComplexityEnqueueAdd element to rearO(1)DequeueRemove element from frontO(1)Peek/FrontView front elementO(1)isEmptyCheck if queue is emptyO(1)SizeNumber of elementsO(1)SearchFind a specific elementO(n)Space Complexity: O(n) — where n is the number of elements stored.All core queue operations are O(1). This is what makes Queue so powerful — no matter how many elements are in the queue, adding and removing always takes constant time.Implementing Queue in Java — All WaysJava gives you multiple ways to use a Queue. Let us go through each one.Way 1: Using LinkedList (Most Common)LinkedList implements the Queue interface in Java. This is the most commonly used Queue implementation.import java.util.LinkedList;import java.util.Queue;Queue<Integer> queue = new LinkedList<>();// Enqueue — add to rearqueue.offer(10);queue.offer(20);queue.offer(30);// Peek — view front without removingSystem.out.println(queue.peek()); // 10// Dequeue — remove from frontSystem.out.println(queue.poll()); // 10System.out.println(queue.poll()); // 20// Check emptySystem.out.println(queue.isEmpty()); // false// SizeSystem.out.println(queue.size()); // 1offer() vs add() — both add to the queue. add() throws an exception if the queue is full (for bounded queues). offer() returns false instead. Always prefer offer().poll() vs remove() — both remove from front. remove() throws an exception if queue is empty. poll() returns null. Always prefer poll().peek() vs element() — both view the front. element() throws exception if empty. peek() returns null. Always prefer peek().Way 2: Using ArrayDeque (Fastest)ArrayDeque is faster than LinkedList for Queue operations because it uses a resizable array internally with no node allocation overhead.import java.util.ArrayDeque;import java.util.Queue;Queue<Integer> queue = new ArrayDeque<>();queue.offer(1);queue.offer(2);queue.offer(3);System.out.println(queue.peek()); // 1System.out.println(queue.poll()); // 1System.out.println(queue.size()); // 2When to use ArrayDeque over LinkedList? Use ArrayDeque whenever possible for Queue or Stack operations. It is faster because it avoids the overhead of node objects that LinkedList creates for every element. In competitive programming and interviews, ArrayDeque is the preferred choice.Way 3: Using Deque (Double Ended Queue)import java.util.ArrayDeque;import java.util.Deque;Deque<Integer> deque = new ArrayDeque<>();// Add to frontdeque.offerFirst(10);// Add to reardeque.offerLast(20);deque.offerLast(30);// Remove from frontSystem.out.println(deque.pollFirst()); // 10// Remove from rearSystem.out.println(deque.pollLast()); // 30// Peek front and rearSystem.out.println(deque.peekFirst()); // 20System.out.println(deque.peekLast()); // 20Way 4: Using PriorityQueueimport java.util.PriorityQueue;// Min Heap — smallest element has highest priorityPriorityQueue<Integer> minPQ = new PriorityQueue<>();minPQ.offer(30);minPQ.offer(10);minPQ.offer(20);System.out.println(minPQ.poll()); // 10 — smallest comes out first// Max Heap — largest element has highest priorityPriorityQueue<Integer> maxPQ = new PriorityQueue<>((a, b) -> b - a);maxPQ.offer(30);maxPQ.offer(10);maxPQ.offer(20);System.out.println(maxPQ.poll()); // 30 — largest comes out firstWay 5: Implementing Queue From Scratch Using ArrayUnderstanding the underlying implementation helps you in interviews when asked to build one from scratch.class MyQueue { private int[] arr; private int front; private int rear; private int size; private int capacity; public MyQueue(int capacity) { this.capacity = capacity; arr = new int[capacity]; front = 0; rear = -1; size = 0; } public void enqueue(int val) { if (size == capacity) { System.out.println("Queue is full!"); return; } rear = (rear + 1) % capacity; // circular wrapping arr[rear] = val; size++; } public int dequeue() { if (isEmpty()) { System.out.println("Queue is empty!"); return -1; } int val = arr[front]; front = (front + 1) % capacity; // circular wrapping size--; return val; } public int peek() { if (isEmpty()) return -1; return arr[front]; } public boolean isEmpty() { return size == 0; } public int size() { return size; }}Notice the % capacity in enqueue and dequeue — that is what makes it a Circular Queue. Without this, once the rear reaches the end of the array, you cannot add more even if front has moved forward and freed up space.Way 6: Implementing Queue Using Two StacksThis is a very popular interview question — implement a Queue using two stacks. The idea is to use one stack for enqueue and another for dequeue.class QueueUsingTwoStacks { Stack<Integer> s1 = new Stack<>(); // for enqueue Stack<Integer> s2 = new Stack<>(); // for dequeue public void enqueue(int val) { s1.push(val); // always push to s1 } public int dequeue() { if (s2.isEmpty()) { // transfer all elements from s1 to s2 // this reverses the order, giving FIFO behavior while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.pop(); } public int peek() { if (s2.isEmpty()) { while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.peek(); } public boolean isEmpty() { return s1.isEmpty() && s2.isEmpty(); }}Why does this work?When you transfer elements from s1 to s2, the order reverses. The element that was added first to s1 ends up on top of s2 — which means it gets dequeued first. FIFO achieved using two LIFOs!Amortized time complexity: Each element is pushed and popped at most twice (once in s1, once in s2). So dequeue is O(1) amortized even though individual calls might take O(n).This is LeetCode 232 — Implement Queue using Stacks.Queue vs Stack — Side by SideFeatureQueueStackPrincipleFIFO — First In First OutLIFO — Last In First OutInsert atRearTopRemove fromFrontTopReal lifeLine of peopleStack of platesJava classLinkedList, ArrayDequeStack, ArrayDequeMain useBFS, schedulingDFS, backtracking, parsingPeekFront elementTop elementBFS — The Most Important Application of QueueBreadth First Search (BFS) is the single most important algorithm that uses a Queue. Understanding BFS is why Queue matters so much in DSA.BFS explores a graph or tree level by level — all nodes at distance 1 first, then all at distance 2, and so on. A Queue naturally enforces this level-by-level behavior.public void bfs(int start, List<List<Integer>> graph) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[graph.size()]; queue.offer(start); visited[start] = true; while (!queue.isEmpty()) { int node = queue.poll(); // process front node System.out.print(node + " "); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); // add unvisited neighbors to rear } } }}Why Queue and not Stack for BFS? Queue ensures you process all neighbors of a node before going deeper. Stack would take you deep into one path first — that is DFS, not BFS. The FIFO property is what guarantees level-by-level exploration.BFS with Queue is used in:Shortest path in unweighted graphsLevel order traversal of treesFinding connected componentsWord ladder problemsRotten oranges, flood fill, and matrix BFS problemsLevel Order Traversal — BFS on TreesOne of the most common Queue problems in interviews is Level Order Traversal of a binary tree.public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> result = new ArrayList<>(); if (root == null) return result; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); while (!queue.isEmpty()) { int levelSize = queue.size(); // number of nodes at current level List<Integer> level = new ArrayList<>(); for (int i = 0; i < levelSize; i++) { TreeNode node = queue.poll(); level.add(node.val); if (node.left != null) queue.offer(node.left); if (node.right != null) queue.offer(node.right); } result.add(level); } return result;}The key trick here is using queue.size() at the start of each while loop iteration to know exactly how many nodes belong to the current level. Process exactly that many nodes, then move to the next level.This is LeetCode 102 — Binary Tree Level Order Traversal.Sliding Window Maximum — Monotonic DequeOne of the most impressive Queue applications is the Sliding Window Maximum problem using a Monotonic Deque. This is the queue equivalent of the Monotonic Stack pattern you saw in stack problems.The idea — maintain a deque that stores indices of elements in decreasing order. The front always holds the index of the maximum element in the current window.public int[] maxSlidingWindow(int[] nums, int k) { Deque<Integer> deque = new ArrayDeque<>(); // stores indices int[] result = new int[nums.length - k + 1]; int idx = 0; for (int i = 0; i < nums.length; i++) { // remove indices that are out of the current window while (!deque.isEmpty() && deque.peekFirst() < i - k + 1) { deque.pollFirst(); } // remove indices whose values are smaller than current // they can never be the maximum for any future window while (!deque.isEmpty() && nums[deque.peekLast()] < nums[i]) { deque.pollLast(); } deque.offerLast(i); // window is fully formed, record maximum (front of deque) if (i >= k - 1) { result[idx++] = nums[deque.peekFirst()]; } } return result;}This gives O(n) time for what would otherwise be an O(n×k) problem. This is LeetCode 239 — Sliding Window Maximum.Java Queue Interface — Complete Method ReferenceHere is every method you will ever need from Java's Queue and Deque interfaces:Queue Methods:offer(e) — add to rear, returns false if full (preferred over add) poll() — remove from front, returns null if empty (preferred over remove) peek() — view front without removing, returns null if empty (preferred over element) isEmpty() — returns true if no elements size() — returns number of elements contains(o) — returns true if element existsDeque Additional Methods:offerFirst(e) — add to front offerLast(e) — add to rear pollFirst() — remove from front pollLast() — remove from rear peekFirst() — view front peekLast() — view rearPriorityQueue Specific:offer(e) — add with natural ordering or custom comparator poll() — remove element with highest priority peek() — view highest priority element without removingCommon Interview Questions About QueueThese are the questions interviewers ask to test your understanding of queues conceptually — not just coding.Q1. What is the difference between Queue and Stack? Queue is FIFO — elements are removed in the order they were added. Stack is LIFO — the most recently added element is removed first. Queue removes from the front, Stack removes from the top.Q2. Why is ArrayDeque preferred over LinkedList for Queue in Java? ArrayDeque uses a resizable array internally and has better cache locality and no node allocation overhead. LinkedList creates a new node object for every element added, which means more garbage collection pressure. ArrayDeque is faster in practice for most Queue use cases.Q3. When would you use a PriorityQueue instead of a regular Queue? When the order of processing depends on priority rather than arrival order. For example in a hospital, critical patients are treated before minor cases regardless of when they arrived. Or in Dijkstra's algorithm, always processing the shortest known distance first.Q4. How is Queue used in BFS? BFS uses a Queue to explore nodes level by level. The starting node is enqueued first. Each time a node is dequeued, all its unvisited neighbors are enqueued. Since Queue is FIFO, all neighbors of a node are processed before going deeper — guaranteeing level-by-level exploration.Q5. What is the difference between poll() and remove() in Java Queue? Both remove the front element. remove() throws NoSuchElementException if the queue is empty. poll() returns null instead of throwing. Always use poll() for safer code.Q6. Can a Queue have duplicates? Yes. Queue does not have any restriction on duplicate values unlike Sets. The same value can appear multiple times in a Queue.Q7. What is a Blocking Queue and when is it used? A Blocking Queue is a thread-safe Queue used in multi-threaded applications. When a thread tries to dequeue from an empty queue, it blocks (waits) until an element is available. When a thread tries to enqueue into a full queue, it blocks until space is available. Used in Producer-Consumer patterns.Top LeetCode Problems on QueueHere are the most important LeetCode problems that use Queue — organized from beginner to advanced:Beginner Level:232. Implement Queue using Stacks — implement Queue with two stacks, classic interview question225. Implement Stack using Queues — reverse of 232, implement Stack using Queue933. Number of Recent Calls — sliding window with QueueIntermediate Level:102. Binary Tree Level Order Traversal — BFS on tree, must know107. Binary Tree Level Order Traversal II — same but bottom up994. Rotting Oranges — multi-source BFS on grid1091. Shortest Path in Binary Matrix — BFS shortest path542. 01 Matrix — multi-source BFS, distance to nearest 0127. Word Ladder — BFS on word graph, classicAdvanced Level:239. Sliding Window Maximum — monotonic deque, must know862. Shortest Subarray with Sum at Least K — monotonic deque with prefix sums407. Trapping Rain Water II — 3D BFS with priority queue787. Cheapest Flights Within K Stops — BFS with constraintsQueue Cheat Sheet — Everything at a GlanceCreate a Queue:Queue<Integer> q = new LinkedList<>(); // standardQueue<Integer> q = new ArrayDeque<>(); // faster, preferredDeque<Integer> dq = new ArrayDeque<>(); // double endedPriorityQueue<Integer> pq = new PriorityQueue<>(); // min heapPriorityQueue<Integer> pq = new PriorityQueue<>((a,b) -> b-a); // max heapCore Operations:q.offer(x); // enqueueq.poll(); // dequeueq.peek(); // front elementq.isEmpty(); // check emptyq.size(); // number of elementsDeque Operations:dq.offerFirst(x); // add to frontdq.offerLast(x); // add to reardq.pollFirst(); // remove from frontdq.pollLast(); // remove from reardq.peekFirst(); // view frontdq.peekLast(); // view rearBFS Template:Queue<Integer> queue = new LinkedList<>();queue.offer(start);visited[start] = true;while (!queue.isEmpty()) { int node = queue.poll(); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); } }}ConclusionQueue is one of those data structures that appears simple on the surface but has incredible depth once you start exploring its variations and applications. From the basic FIFO concept to Circular Queues, Deques, Priority Queues, Monotonic Deques, and BFS — each layer adds a new tool to your problem-solving arsenal.Here is the learning path to follow based on everything covered in this guide:Start with understanding FIFO vs LIFO and when each applies. Then get comfortable with Java's Queue interface — offer, poll, peek. Practice the BFS template until it feels automatic. Then move to Level Order Traversal problems. Once BFS clicks, tackle multi-source BFS problems like Rotting Oranges. Finally learn the Monotonic Deque pattern for sliding window problems.Master these and you will handle every Queue problem in any coding interview with confidence.

QueueData StructureJavaBFSDequePriority QueueCircular Queue

Stack Data Structure in Java: The Complete In-Depth Guide

1. What Is a Stack?A Stack is a linear data structure that stores elements in a sequential order, but with one strict rule — you can only insert or remove elements from one end, called the top.It is one of the simplest yet most powerful data structures in computer science. Its strength comes from its constraint. Because everything happens at one end, the behavior of a stack is completely predictable.The formal definition: A Stack is a linear data structure that follows the Last In, First Out (LIFO) principle — the element inserted last is the first one to be removed.Here is what a stack looks like visually: ┌──────────┐ │ 50 │ ← TOP (last inserted, first removed) ├──────────┤ │ 40 │ ├──────────┤ │ 30 │ ├──────────┤ │ 20 │ ├──────────┤ │ 10 │ ← BOTTOM (first inserted, last removed) └──────────┘When you push 60 onto this stack, it goes on top. When you pop, 60 comes out first. That is LIFO.2. Real-World AnalogiesBefore writing a single line of code, it helps to see stacks in the real world. These analogies will make the concept permanently stick.A Pile of Plates In a cafeteria, clean plates are stacked on top of each other. You always pick the top plate. You always place a new plate on top. You never reach into the middle. This is a stack.Browser Back Button Every time you visit a new webpage, it gets pushed onto a history stack. When you press the Back button, the browser pops the most recent page off the stack and takes you there. The page you visited first is at the bottom — you only reach it after going back through everything else.Undo Feature in Text Editors When you type in a document and press Ctrl+Z, the most recent action is undone first. That is because every action you perform is pushed onto a stack. Undo simply pops from that stack.Call Stack in Programming When a function calls another function, the current function's state is pushed onto the call stack. When the inner function finishes, it is popped off and execution returns to the outer function. This is the literal stack your programs run on.A Stack of Books Put five books on a table, one on top of another. You can only take the top book without knocking the pile over. That is a stack.3. The LIFO Principle ExplainedLIFO stands for Last In, First Out.It means whatever you put in last is the first thing to come out. This is the exact opposite of a Queue (which is FIFO — First In, First Out).Let us trace through an example step by step:Start: Stack is empty → []Push 10 → [10] (10 is at the top)Push 20 → [10, 20] (20 is at the top)Push 30 → [10, 20, 30] (30 is at the top)Pop → returns 30 (30 was last in, first out) Stack: [10, 20]Pop → returns 20 Stack: [10]Peek → returns 10 (just looks, does not remove) Stack: [10]Pop → returns 10 Stack: [] (stack is now empty)Every single operation happens only at the top. The bottom of the stack is never directly accessible.4. Stack Operations & Time ComplexityA stack supports the following core operations:OperationDescriptionTime Complexitypush(x)Insert element x onto the top of the stackO(1)pop()Remove and return the top elementO(1)peek() / top()Return the top element without removing itO(1)isEmpty()Check if the stack has no elementsO(1)isFull()Check if the stack has reached its capacity (Array only)O(1)size()Return the number of elements in the stackO(1)search(x)Find position of element from top (Java built-in only)O(n)All primary stack operations — push, pop, peek, isEmpty — run in O(1) constant time. This is what makes the stack so efficient. It does not matter whether the stack has 10 elements or 10 million — these operations are always instant.Space complexity for a stack holding n elements is O(n).5. Implementation 1 — Using a Static ArrayThis is the most fundamental way to implement a stack. We use a fixed-size array and a variable called top to track where the top of the stack currently is.How it works:top starts at -1 (stack is empty)On push: increment top, then place the element at arr[top]On pop: return arr[top], then decrement topOn peek: return arr[top] without changing it// StackUsingArray.javapublic class StackUsingArray { private int[] arr; private int top; private int capacity; // Constructor — initialize with a fixed capacity public StackUsingArray(int capacity) { this.capacity = capacity; arr = new int[capacity]; top = -1; } // Push: add element to the top public void push(int value) { if (isFull()) { System.out.println("Stack Overflow! Cannot push " + value); return; } arr[++top] = value; System.out.println("Pushed: " + value); } // Pop: remove and return top element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } return arr[top--]; } // Peek: view the top element without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return arr[top]; } // Check if stack is empty public boolean isEmpty() { return top == -1; } // Check if stack is full public boolean isFull() { return top == capacity - 1; } // Return current size public int size() { return top + 1; } // Display all elements public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = top; i >= 0; i--) { System.out.print(arr[i] + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArray stack = new StackUsingArray(5); stack.push(10); stack.push(20); stack.push(30); stack.push(40); stack.push(50); stack.push(60); // This will trigger Stack Overflow stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 10Pushed: 20Pushed: 30Pushed: 40Pushed: 50Stack Overflow! Cannot push 60Stack (top → bottom): 50 40 30 20 10Peek: 50Pop: 50Pop: 40Stack (top → bottom): 30 20 10Size: 3Key Points about Array Implementation:Fixed size — you must declare capacity upfrontVery fast — direct array index accessStack Overflow is possible if capacity is exceededMemory is pre-allocated even if stack is not full6. Implementation 2 — Using an ArrayListAn ArrayList-based stack removes the fixed-size limitation. The ArrayList grows dynamically, so you never have to worry about stack overflow due to capacity.How it works:The end of the ArrayList acts as the topadd() is used for pushremove(size - 1) is used for popget(size - 1) is used for peek// StackUsingArrayList.javaimport java.util.ArrayList;public class StackUsingArrayList { private ArrayList<Integer> list; // Constructor public StackUsingArrayList() { list = new ArrayList<>(); } // Push: add to the end (which is our top) public void push(int value) { list.add(value); System.out.println("Pushed: " + value); } // Pop: remove and return the last element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int top = list.get(list.size() - 1); list.remove(list.size() - 1); return top; } // Peek: view the last element public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return list.get(list.size() - 1); } // Check if stack is empty public boolean isEmpty() { return list.isEmpty(); } // Return size public int size() { return list.size(); } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = list.size() - 1; i >= 0; i--) { System.out.print(list.get(i) + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArrayList stack = new StackUsingArrayList(); stack.push(5); stack.push(15); stack.push(25); stack.push(35); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Is Empty: " + stack.isEmpty()); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 5Pushed: 15Pushed: 25Pushed: 35Stack (top → bottom): 35 25 15 5Peek: 35Pop: 35Pop: 25Stack (top → bottom): 15 5Is Empty: falseSize: 2Key Points about ArrayList Implementation:Dynamic size — grows automatically as neededNo overflow riskSlight overhead compared to raw array due to ArrayList internalsExcellent for most practical use cases7. Implementation 3 — Using a LinkedListA LinkedList-based stack is the most memory-efficient approach when you do not know the stack size in advance. Each element (node) holds data and a pointer to the next node. The head of the LinkedList acts as the top of the stack.How it works:Each node stores a value and a reference to the node below itPush creates a new node and makes it the new headPop removes the head node and returns its valuePeek returns the head node's value without removing it// StackUsingLinkedList.javapublic class StackUsingLinkedList { // Inner Node class private static class Node { int data; Node next; Node(int data) { this.data = data; this.next = null; } } private Node top; // Head of the linked list = top of stack private int size; // Constructor public StackUsingLinkedList() { top = null; size = 0; } // Push: create new node and link it to top public void push(int value) { Node newNode = new Node(value); newNode.next = top; // new node points to current top top = newNode; // new node becomes the new top size++; System.out.println("Pushed: " + value); } // Pop: remove and return top node's data public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int value = top.data; top = top.next; // move top pointer to next node size--; return value; } // Peek: return top node's data without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return top.data; } // Check if empty public boolean isEmpty() { return top == null; } // Return size public int size() { return size; } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); Node current = top; while (current != null) { System.out.print(current.data + " "); current = current.next; } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingLinkedList stack = new StackUsingLinkedList(); stack.push(100); stack.push(200); stack.push(300); stack.push(400); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 100Pushed: 200Pushed: 300Pushed: 400Stack (top → bottom): 400 300 200 100Peek: 400Pop: 400Pop: 300Stack (top → bottom): 200 100Size: 2Key Points about LinkedList Implementation:Truly dynamic — each node allocated only when neededNo wasted memory from pre-allocationSlightly more memory per element (each node carries a pointer)Ideal for stacks where size is completely unknown8. Java's Built-in Stack ClassJava provides a ready-made Stack class inside java.util. It extends Vector and is thread-safe by default.// JavaBuiltinStack.javaimport java.util.Stack;public class JavaBuiltinStack { public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); // Push elements stack.push(10); stack.push(20); stack.push(30); stack.push(40); System.out.println("Stack: " + stack); // Peek — look at top without removing System.out.println("Peek: " + stack.peek()); // Pop — remove top System.out.println("Pop: " + stack.pop()); System.out.println("After pop: " + stack); // Search — returns 1-based position from top System.out.println("Search 20: position " + stack.search(20)); // isEmpty System.out.println("Is Empty: " + stack.isEmpty()); // Size System.out.println("Size: " + stack.size()); }}```**Output:**```Stack: [10, 20, 30, 40]Peek: 40Pop: 40After pop: [10, 20, 30]Search 20: position 2Is Empty: falseSize: 3Important Note: In modern Java development, it is often recommended to use Deque (specifically ArrayDeque) instead of Stack for better performance, since Stack is synchronized and carries the overhead of Vector.// Using ArrayDeque as a stack (modern preferred approach)import java.util.ArrayDeque;import java.util.Deque;public class ModernStack { public static void main(String[] args) { Deque<Integer> stack = new ArrayDeque<>(); stack.push(10); // pushes to front stack.push(20); stack.push(30); System.out.println("Top: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Stack: " + stack); }}9. Comparison of All ImplementationsFeatureArrayArrayListLinkedListJava StackArrayDequeSizeFixedDynamicDynamicDynamicDynamicStack Overflow RiskYesNoNoNoNoMemory UsagePre-allocatedAuto-growsPer-node overheadAuto-growsAuto-growsPush TimeO(1)O(1) amortizedO(1)O(1)O(1)Pop TimeO(1)O(1)O(1)O(1)O(1)Peek TimeO(1)O(1)O(1)O(1)O(1)Thread SafeNoNoNoYesNoBest ForKnown size, max speedGeneral useUnknown/huge sizeLegacy codeModern Java10. Advantages & DisadvantagesAdvantagesAdvantageExplanationSimple to implementVery few rules and operations to worry aboutO(1) operationsPush, pop, and peek are all constant timeMemory efficientNo extra pointers needed (array-based)Supports recursionThe call stack is itself a stackEasy undo/redoNatural fit for reversible action trackingBacktrackingPerfectly suited for maze, puzzle, and game solvingExpression evaluationPowers compilers and calculatorsDisadvantagesDisadvantageExplanationLimited accessCannot access elements in the middle directlyFixed size (array)Array-based stacks overflow if size is exceededNo random accessYou cannot do stack[2] — only top is accessibleMemory waste (array)Pre-allocated array wastes space if underusedNot suitable for all problemsMany problems need queues, trees, or graphs insteadStack overflow in recursionVery deep recursion can overflow the JVM call stack11. Real-World Use Cases of StackUnderstanding when to use a stack is just as important as knowing how to implement one. Here is where stacks show up in real software:Function Call Management (Call Stack) Every time your Java program calls a method, the JVM pushes that method's frame onto the call stack. When the method returns, the frame is popped. This is why you see "StackOverflowError" when you write infinite recursion.Undo and Redo Operations Text editors, image editors (Photoshop), and IDEs use two stacks — one for undo history and one for redo history. Every action pushes onto the undo stack. Ctrl+Z pops from it and pushes to the redo stack.Browser Navigation Your browser maintains a back-stack and a forward-stack. Visiting a new page pushes to the back-stack. Pressing Back pops from it and pushes to the forward-stack.Expression Evaluation and Conversion Compilers use stacks to evaluate arithmetic expressions and convert between infix, prefix, and postfix notations. For example: 3 + 4 * 2 must be evaluated considering operator precedence — this is done with a stack.Balanced Parentheses Checking Linters, compilers, and IDEs use stacks to check if brackets are balanced: {[()]} is valid, {[(])} is not.Backtracking Algorithms Maze solving, N-Queens, Sudoku solvers, and depth-first search all use stacks (explicitly or via recursion) to backtrack to previous states when a path fails.Syntax Parsing Compilers parse source code using stacks to match opening and closing constructs like if/else, try/catch, { and }.12. Practice Problems with Full SolutionsHere is where things get really interesting. These problems will sharpen your stack intuition and prepare you for coding interviews.Problem 1 — Reverse a String Using a StackDifficulty: EasyProblem: Write a Java program to reverse a string using a Stack.Approach: Push every character of the string onto a stack, then pop them all. Since LIFO reverses the order, the characters come out reversed.// ReverseString.javaimport java.util.Stack;public class ReverseString { public static String reverse(String str) { Stack<Character> stack = new Stack<>(); // Push all characters for (char c : str.toCharArray()) { stack.push(c); } // Pop all characters to build reversed string StringBuilder reversed = new StringBuilder(); while (!stack.isEmpty()) { reversed.append(stack.pop()); } return reversed.toString(); } public static void main(String[] args) { System.out.println(reverse("hello")); // olleh System.out.println(reverse("java")); // avaj System.out.println(reverse("racecar")); // racecar (palindrome) System.out.println(reverse("datastructure")); // erutcurtasatad }}Problem 2 — Check Balanced ParenthesesDifficulty: Easy–MediumProblem: Given a string containing (, ), {, }, [, ], determine if the brackets are balanced.Approach: Push every opening bracket onto the stack. When you see a closing bracket, check if it matches the top of the stack. If it does, pop. If it does not, the string is unbalanced.// BalancedParentheses.javaimport java.util.Stack;public class BalancedParentheses { public static boolean isBalanced(String expr) { Stack<Character> stack = new Stack<>(); for (char c : expr.toCharArray()) { // Push all opening brackets if (c == '(' || c == '{' || c == '[') { stack.push(c); } // For closing brackets, check the top of stack else if (c == ')' || c == '}' || c == ']') { if (stack.isEmpty()) return false; char top = stack.pop(); if (c == ')' && top != '(') return false; if (c == '}' && top != '{') return false; if (c == ']' && top != '[') return false; } } // Stack must be empty at the end for a balanced expression return stack.isEmpty(); } public static void main(String[] args) { System.out.println(isBalanced("{[()]}")); // true System.out.println(isBalanced("{[(])}")); // false System.out.println(isBalanced("((()))")); // true System.out.println(isBalanced("{]")); // false System.out.println(isBalanced("")); // true (empty is balanced) }}Problem 3 — Reverse a Stack (Without Extra Data Structure)Difficulty: Medium–HardProblem: Reverse all elements of a stack using only recursion — no array or extra stack allowed.Approach: This is a classic recursion problem. You need two recursive functions:insertAtBottom(stack, item) — inserts an element at the very bottom of the stackreverseStack(stack) — pops all elements, reverses, and uses insertAtBottom to rebuild// ReverseStack.javaimport java.util.Stack;public class ReverseStack { // Insert an element at the bottom of the stack public static void insertAtBottom(Stack<Integer> stack, int item) { if (stack.isEmpty()) { stack.push(item); return; } int top = stack.pop(); insertAtBottom(stack, item); stack.push(top); } // Reverse the stack using insertAtBottom public static void reverseStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); reverseStack(stack); // reverse the remaining stack insertAtBottom(stack, top); // insert popped element at bottom } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(1); stack.push(2); stack.push(3); stack.push(4); stack.push(5); System.out.println("Before: " + stack); // [1, 2, 3, 4, 5] reverseStack(stack); System.out.println("After: " + stack); // [5, 4, 3, 2, 1] }}Problem 4 — Evaluate a Postfix ExpressionDifficulty: MediumProblem: Evaluate a postfix (Reverse Polish Notation) expression. Example: "2 3 4 * +" should return 14 because it is 2 + (3 * 4).Approach: Scan left to right. If you see a number, push it. If you see an operator, pop two numbers, apply the operator, and push the result.// PostfixEvaluation.javaimport java.util.Stack;public class PostfixEvaluation { public static int evaluate(String expression) { Stack<Integer> stack = new Stack<>(); String[] tokens = expression.split(" "); for (String token : tokens) { // If it's a number, push it if (token.matches("-?\\d+")) { stack.push(Integer.parseInt(token)); } // If it's an operator, pop two and apply else { int b = stack.pop(); // second operand int a = stack.pop(); // first operand switch (token) { case "+": stack.push(a + b); break; case "-": stack.push(a - b); break; case "*": stack.push(a * b); break; case "/": stack.push(a / b); break; } } } return stack.pop(); } public static void main(String[] args) { System.out.println(evaluate("2 3 4 * +")); // 14 → 2 + (3*4) System.out.println(evaluate("5 1 2 + 4 * + 3 -")); // 14 → 5+((1+2)*4)-3 System.out.println(evaluate("3 4 +")); // 7 }}Problem 5 — Next Greater ElementDifficulty: MediumProblem: For each element in an array, find the next greater element to its right. If none exists, output -1.Example: Input: [4, 5, 2, 10, 8] → Output: [5, 10, 10, -1, -1]Approach: Iterate right to left. Maintain a stack of candidates. For each element, pop all stack elements that are smaller than or equal to it — they can never be the answer for any element to the left. The top of the stack (if not empty) is the next greater element.// NextGreaterElement.javaimport java.util.Stack;import java.util.Arrays;public class NextGreaterElement { public static int[] nextGreater(int[] arr) { int n = arr.length; int[] result = new int[n]; Stack<Integer> stack = new Stack<>(); // stores elements, not indices // Traverse from right to left for (int i = n - 1; i >= 0; i--) { // Pop elements smaller than or equal to current while (!stack.isEmpty() && stack.peek() <= arr[i]) { stack.pop(); } // Next greater element result[i] = stack.isEmpty() ? -1 : stack.peek(); // Push current element for future comparisons stack.push(arr[i]); } return result; } public static void main(String[] args) { int[] arr1 = {4, 5, 2, 10, 8}; System.out.println(Arrays.toString(nextGreater(arr1))); // [5, 10, 10, -1, -1] int[] arr2 = {1, 3, 2, 4}; System.out.println(Arrays.toString(nextGreater(arr2))); // [3, 4, 4, -1] int[] arr3 = {5, 4, 3, 2, 1}; System.out.println(Arrays.toString(nextGreater(arr3))); // [-1, -1, -1, -1, -1] }}Problem 6 — Sort a Stack Using RecursionDifficulty: HardProblem: Sort a stack in ascending order (smallest on top) using only recursion — no loops, no extra data structure.// SortStack.javaimport java.util.Stack;public class SortStack { // Insert element in correct sorted position public static void sortedInsert(Stack<Integer> stack, int item) { if (stack.isEmpty() || item > stack.peek()) { stack.push(item); return; } int top = stack.pop(); sortedInsert(stack, item); stack.push(top); } // Sort the stack public static void sortStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); sortStack(stack); // sort remaining sortedInsert(stack, top); // insert top in sorted position } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(34); stack.push(3); stack.push(31); stack.push(98); stack.push(92); stack.push(23); System.out.println("Before sort: " + stack); sortStack(stack); System.out.println("After sort: " + stack); // smallest on top }}13. Summary & Key TakeawaysA stack is a simple, elegant, and powerful data structure. Here is everything in one place:What it is: A linear data structure that follows LIFO — Last In, First Out.Core operations: push (add to top), pop (remove from top), peek (view top), isEmpty — all in O(1) time.Three ways to implement it in Java:Array-based: fast, fixed size, risk of overflowArrayList-based: dynamic, easy, slightly more overheadLinkedList-based: truly dynamic, memory-efficient per-element, best for unknown sizesWhen to use it:Undo/redo systemsBrowser navigationBalancing brackets and parenthesesEvaluating mathematical expressionsBacktracking problemsManaging recursive function callsDepth-first searchWhen NOT to use it:When you need random access to elementsWhen insertion/deletion is needed from both ends (use Deque)When you need to search efficiently (use HashMap or BST)Modern Java recommendation: Prefer ArrayDeque over the legacy Stack class for non-thread-safe scenarios. Use Stack only when you need synchronized access.The stack is one of those data structures that once you truly understand, you start seeing it everywhere — in your browser, in your IDE, in recursive algorithms, and deep within the operating system itself.This article covered everything from the fundamentals of the Stack data structure to multiple Java implementations, time complexity analysis, real-world applications, and six practice problems of increasing difficulty. Bookmark it as a reference and revisit the practice problems regularly — they are the real test of your understanding.

DataStructuresJavaStackDataStructureLIFO

Recursion in Java - Complete Guide With Examples and Practice Problems

IntroductionIf there is one topic in programming that confuses beginners more than anything else, it is recursion. Most people read the definition, nod their head, and then immediately freeze when they have to write recursive code themselves.The problem is not that recursion is genuinely hard. The problem is that most explanations start with code before building the right mental model. Once you have the right mental model, recursion clicks permanently and you start seeing it everywhere — in tree problems, graph problems, backtracking, dynamic programming, divide and conquer, and more.This guide covers everything from the ground up. What recursion is, how the call stack works, how to identify base cases and recursive cases, every type of recursion, common patterns, time and space complexity analysis, the most common mistakes, and the top LeetCode problems to practice.By the end of this article, recursion will not feel like magic anymore. It will feel like a natural tool you reach for confidently.What Is Recursion?Recursion is when a function calls itself to solve a smaller version of the same problem.That is the complete definition. But let us make it concrete.Imagine you want to count down from 5 to 1. One way is a loop. Another way is — print 5, then solve the exact same problem for counting down from 4 to 1. Then print 4, solve for 3. And so on until you reach the base — there is nothing left to count down.void countDown(int n) { if (n == 0) return; // stop here System.out.println(n); countDown(n - 1); // solve the smaller version}The function countDown calls itself with a smaller input each time. Eventually it reaches 0 and stops. That stopping condition is the most important part of any recursive function — the base case.The Two Parts Every Recursive Function Must HaveEvery correctly written recursive function has exactly two parts. Without both, the function either gives wrong answers or runs forever.Part 1: Base CaseThe base case is the condition under which the function stops calling itself and returns a direct answer. It is the smallest version of the problem that you can solve without any further recursion.Without a base case, recursion never stops and you get a StackOverflowError — Java's way of telling you the call stack ran out of memory.Part 2: Recursive CaseThe recursive case is where the function calls itself with a smaller or simpler input — moving closer to the base case with each call. If your recursive case does not make the problem smaller, you have an infinite loop.Think of it like a staircase. The base case is the ground floor. The recursive case is each step going down. Every step must genuinely bring you one level closer to the ground.How Recursion Works — The Call StackThis is the mental model that most explanations skip, and it is the reason recursion confuses people.Every time a function is called in Java, a new stack frame is created and pushed onto the call stack. This frame stores the function's local variables, parameters, and where to return to when the function finishes.When a recursive function calls itself, a new frame is pushed on top. When that call finishes, its frame is popped and execution returns to the previous frame.Let us trace countDown(3) through the call stack:countDown(3) called → frame pushed prints 3 calls countDown(2) → frame pushed prints 2 calls countDown(1) → frame pushed prints 1 calls countDown(0) → frame pushed n == 0, return → frame popped back in countDown(1), return → frame popped back in countDown(2), return → frame popped back in countDown(3), return → frame poppedOutput: 3, 2, 1The call stack grows as calls go deeper, then shrinks as calls return. This is why recursion uses O(n) space for n levels deep — each level occupies one stack frame in memory.Your First Real Recursive Function — FactorialFactorial is the classic first recursion example. n! = n × (n-1) × (n-2) × ... × 1Notice the pattern — n! = n × (n-1)!. The factorial of n is n times the factorial of n-1. That recursive structure makes it perfect for recursion.public int factorial(int n) { // base case if (n == 0 || n == 1) return 1; // recursive case return n * factorial(n - 1);}Dry Run — factorial(4)factorial(4)= 4 * factorial(3)= 4 * 3 * factorial(2)= 4 * 3 * 2 * factorial(1)= 4 * 3 * 2 * 1= 24The call stack builds up going in, then multiplications happen coming back out. This "coming back out" phase is called the return phase or unwinding of the stack.Time Complexity: O(n) — n recursive calls Space Complexity: O(n) — n frames on the call stackThe Two Phases of RecursionEvery recursive function has two phases and understanding both is critical.Phase 1: The Call Phase (Going In)This happens as the function keeps calling itself with smaller inputs. Things you do before the recursive call happen in this phase — in order from the outermost call to the innermost.Phase 2: The Return Phase (Coming Back Out)This happens as each call finishes and returns to its caller. Things you do after the recursive call happen in this phase — in reverse order, from the innermost call back to the outermost.This distinction explains why the output order can be surprising:void printBothPhases(int n) { if (n == 0) return; System.out.println("Going in: " + n); // call phase printBothPhases(n - 1); System.out.println("Coming out: " + n); // return phase}For printBothPhases(3):Going in: 3Going in: 2Going in: 1Coming out: 1Coming out: 2Coming out: 3This two-phase understanding is what makes problems like reversing a string or printing a linked list backwards via recursion feel natural.Types of RecursionRecursion is not one-size-fits-all. There are several distinct types and knowing which type applies to a problem shapes how you write the solution.1. Direct RecursionThe function calls itself directly. This is the most common type — what we have seen so far.void direct(int n) { if (n == 0) return; direct(n - 1); // calls itself}2. Indirect RecursionFunction A calls Function B which calls Function A. They form a cycle.void funcA(int n) { if (n <= 0) return; System.out.println("A: " + n); funcB(n - 1);}void funcB(int n) { if (n <= 0) return; System.out.println("B: " + n); funcA(n - 1);}Used in: state machines, mutual recursion in parsers, certain mathematical sequences.3. Tail RecursionThe recursive call is the last operation in the function. Nothing happens after the recursive call returns — no multiplication, no addition, nothing.// NOT tail recursive — multiplication happens after returnint factorial(int n) { if (n == 1) return 1; return n * factorial(n - 1); // multiply after return — not tail}// Tail recursive — recursive call is the last thingint factorialTail(int n, int accumulator) { if (n == 1) return accumulator; return factorialTail(n - 1, n * accumulator); // last operation}Why does tail recursion matter? In languages that support tail call optimization (like Scala, Kotlin, and many functional languages), tail recursive functions can be converted to iteration internally — no stack frame accumulation, O(1) space. Java does NOT perform tail call optimization, but understanding tail recursion is still important for interviews and functional programming concepts.4. Head RecursionThe recursive call happens first, before any other processing. All processing happens in the return phase.void headRecursion(int n) { if (n == 0) return; headRecursion(n - 1); // call first System.out.println(n); // process after}// Output: 1 2 3 4 5 (processes in reverse order of calls)5. Tree RecursionThe function makes more than one recursive call per invocation. This creates a tree of calls rather than a linear chain. Fibonacci is the classic example.int fibonacci(int n) { if (n <= 1) return n; return fibonacci(n - 1) + fibonacci(n - 2); // TWO recursive calls}The call tree for fibonacci(4): fib(4) / \ fib(3) fib(2) / \ / \ fib(2) fib(1) fib(1) fib(0) / \ fib(1) fib(0)Time Complexity: O(2ⁿ) — exponential! Each call spawns two more. Space Complexity: O(n) — maximum depth of the call treeThis is why memoization (caching results) is so important for tree recursion — it converts O(2ⁿ) to O(n) by never recomputing the same subproblem twice.6. Mutual RecursionA specific form of indirect recursion where two functions call each other alternately to solve a problem. Different from indirect recursion in that the mutual calls are the core mechanism of the solution.// Check if a number is even or odd using mutual recursionboolean isEven(int n) { if (n == 0) return true; return isOdd(n - 1);}boolean isOdd(int n) { if (n == 0) return false; return isEven(n - 1);}Common Recursion Patterns in DSAThese are the patterns you will see over and over in interview problems. Recognizing them is more important than memorizing solutions.Pattern 1: Linear Recursion (Do Something, Recurse on Rest)Process the current element, then recurse on the remaining problem.// Sum of arrayint arraySum(int[] arr, int index) { if (index == arr.length) return 0; // base case return arr[index] + arraySum(arr, index + 1); // current + rest}Pattern 2: Divide and Conquer (Split Into Two Halves)Split the problem into two halves, solve each recursively, combine results.// Merge Sortvoid mergeSort(int[] arr, int left, int right) { if (left >= right) return; // base case — single element int mid = (left + right) / 2; mergeSort(arr, left, mid); // sort left half mergeSort(arr, mid + 1, right); // sort right half merge(arr, left, mid, right); // combine}Pattern 3: Backtracking (Try, Recurse, Undo)Try a choice, recurse to explore it, undo the choice when backtracking.// Generate all subsetsvoid subsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { if (index == nums.length) { result.add(new ArrayList<>(current)); return; } // Choice 1: include nums[index] current.add(nums[index]); subsets(nums, index + 1, current, result); current.remove(current.size() - 1); // undo // Choice 2: exclude nums[index] subsets(nums, index + 1, current, result);}Pattern 4: Tree Recursion (Left, Right, Combine)Recurse on left subtree, recurse on right subtree, combine or process results.// Height of binary treeint height(TreeNode root) { if (root == null) return 0; // base case int leftHeight = height(root.left); // solve left int rightHeight = height(root.right); // solve right return 1 + Math.max(leftHeight, rightHeight); // combine}Pattern 5: Memoization (Cache Recursive Results)Store results of recursive calls so the same subproblem is never solved twice.Map<Integer, Integer> memo = new HashMap<>();int fibonacci(int n) { if (n <= 1) return n; if (memo.containsKey(n)) return memo.get(n); // return cached int result = fibonacci(n - 1) + fibonacci(n - 2); memo.put(n, result); // cache before returning return result;}This converts Fibonacci from O(2ⁿ) to O(n) time with O(n) space — a massive improvement.Recursion vs Iteration — When to Use WhichThis is one of the most common interview questions about recursion. Here is a clear breakdown:Use Recursion when:The problem has a naturally recursive structure (trees, graphs, divide and conquer)The solution is significantly cleaner and easier to understand recursivelyThe problem involves exploring multiple paths or choices (backtracking)The depth of recursion is manageable (not too deep to cause stack overflow)Use Iteration when:The problem is linear and a loop is equally clearMemory is a concern (iteration uses O(1) stack space vs O(n) for recursion)Performance is critical and function call overhead mattersJava's stack size limit could be hit (default around 500-1000 frames for deep recursion)The key rule: Every recursive solution can be converted to an iterative one (usually using an explicit stack). But recursive solutions for tree and graph problems are almost always cleaner to write and understand.Time and Space Complexity of Recursive FunctionsAnalyzing complexity for recursive functions requires a specific approach.The Recurrence Relation MethodExpress the time complexity as a recurrence relation and solve it.Factorial:T(n) = T(n-1) + O(1) = T(n-2) + O(1) + O(1) = T(1) + n×O(1) = O(n)Fibonacci (naive):T(n) = T(n-1) + T(n-2) + O(1) ≈ 2×T(n-1) = O(2ⁿ)Binary Search:T(n) = T(n/2) + O(1) = O(log n) [by Master Theorem]Merge Sort:T(n) = 2×T(n/2) + O(n) = O(n log n) [by Master Theorem]Space Complexity Rule for RecursionSpace complexity of a recursive function = maximum depth of the call stack × space per frameLinear recursion (factorial, sum): O(n) spaceBinary recursion (Fibonacci naive): O(n) space (maximum depth, not number of nodes)Divide and conquer (merge sort): O(log n) space (depth of recursion tree)Memoized Fibonacci: O(n) space (memo table + call stack)Classic Recursive Problems With SolutionsProblem 1: Reverse a StringString reverse(String s) { if (s.length() <= 1) return s; // base case // last char + reverse of everything before last char return s.charAt(s.length() - 1) + reverse(s.substring(0, s.length() - 1));}Dry run for "hello":reverse("hello") = 'o' + reverse("hell")reverse("hell") = 'l' + reverse("hel")reverse("hel") = 'l' + reverse("he")reverse("he") = 'e' + reverse("h")reverse("h") = "h"Unwinding: "h" → "he" → "leh" → "lleh" → "olleh" ✅Problem 2: Power Function (x^n)double power(double x, int n) { if (n == 0) return 1; // base case if (n < 0) return 1.0 / power(x, -n); // handle negative if (n % 2 == 0) { double half = power(x, n / 2); return half * half; // x^n = (x^(n/2))^2 } else { return x * power(x, n - 1); }}This is the fast power algorithm — O(log n) time instead of O(n).Problem 3: Fibonacci With Memoizationint[] memo = new int[100];Arrays.fill(memo, -1);int fib(int n) { if (n <= 1) return n; if (memo[n] != -1) return memo[n]; memo[n] = fib(n - 1) + fib(n - 2); return memo[n];}Time: O(n) — each value computed once Space: O(n) — memo array + call stackProblem 4: Tower of HanoiThe classic recursion teaching problem. Move n disks from source to destination using a helper rod.void hanoi(int n, char source, char destination, char helper) { if (n == 1) { System.out.println("Move disk 1 from " + source + " to " + destination); return; } // Move n-1 disks from source to helper hanoi(n - 1, source, helper, destination); // Move the largest disk from source to destination System.out.println("Move disk " + n + " from " + source + " to " + destination); // Move n-1 disks from helper to destination hanoi(n - 1, helper, destination, source);}Time Complexity: O(2ⁿ) — minimum moves required is 2ⁿ - 1 Space Complexity: O(n) — call stack depthProblem 5: Generate All Subsets (Power Set)void generateSubsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { result.add(new ArrayList<>(current)); // add current subset for (int i = index; i < nums.length; i++) { current.add(nums[i]); // include generateSubsets(nums, i + 1, current, result); // recurse current.remove(current.size() - 1); // exclude (backtrack) }}For [1, 2, 3] — generates all 8 subsets: [], [1], [1,2], [1,2,3], [1,3], [2], [2,3], [3]Time: O(2ⁿ) — 2ⁿ subsets Space: O(n) — recursion depthProblem 6: Binary Search Recursivelyint binarySearch(int[] arr, int target, int left, int right) { if (left > right) return -1; // base case — not found int mid = left + (right - left) / 2; if (arr[mid] == target) return mid; else if (arr[mid] < target) return binarySearch(arr, target, mid + 1, right); else return binarySearch(arr, target, left, mid - 1);}Time: O(log n) — halving the search space each time Space: O(log n) — log n frames on the call stackRecursion on Trees — The Natural HabitatTrees are where recursion truly shines. Every tree problem becomes elegant with recursion because a tree is itself a recursive structure — each node's left and right children are trees themselves.// Maximum depth of binary treeint maxDepth(TreeNode root) { if (root == null) return 0; return 1 + Math.max(maxDepth(root.left), maxDepth(root.right));}// Check if tree is symmetricboolean isSymmetric(TreeNode left, TreeNode right) { if (left == null && right == null) return true; if (left == null || right == null) return false; return left.val == right.val && isSymmetric(left.left, right.right) && isSymmetric(left.right, right.left);}// Path sum — does any root-to-leaf path sum to target?boolean hasPathSum(TreeNode root, int target) { if (root == null) return false; if (root.left == null && root.right == null) return root.val == target; return hasPathSum(root.left, target - root.val) || hasPathSum(root.right, target - root.val);}Notice the pattern in all three — base case handles null, recursive case handles left and right subtrees, result combines both.How to Think About Any Recursive Problem — Step by StepThis is the framework you should apply to every new recursive problem you encounter:Step 1 — Identify the base case What is the smallest input where you know the answer directly without any recursion? For arrays it is usually empty array or single element. For trees it is null node. For numbers it is 0 or 1.Step 2 — Trust the recursive call Assume your function already works correctly for smaller inputs. Do not trace through the entire recursion mentally — just trust it. This is the Leap of Faith and it is what makes recursion feel natural.Step 3 — Express the current problem in terms of smaller problems How does the answer for size n relate to the answer for size n-1 (or n/2, or subtrees)? This relationship is your recursive case.Step 4 — Make sure each call moves toward the base case The input must become strictly smaller with each call. If it does not, you have infinite recursion.Step 5 — Write the base case first, then the recursive case Always. Writing the recursive case first leads to bugs because you have not defined when to stop.Common Mistakes and How to Avoid ThemMistake 1: Missing or wrong base case The most common mistake. Missing the base case causes StackOverflowError. Wrong base case causes wrong answers.Always ask — what is the simplest possible input, and what should the function return for it? Write that case first.Mistake 2: Not moving toward the base case If you call factorial(n) inside factorial(n) without reducing n, you loop forever. Every recursive call must make the problem strictly smaller.Mistake 3: Trusting your brain to trace deep recursion Do not try to trace 10 levels of recursion in your head. Trust the recursive call, verify the base case, and check that each call reduces the problem. That is all you need.Mistake 4: Forgetting to return the recursive result// WRONG — result is computed but not returnedint sum(int n) { if (n == 0) return 0; sum(n - 1) + n; // computed but discarded!}// CORRECTint sum(int n) { if (n == 0) return 0; return sum(n - 1) + n;}Mistake 5: Modifying shared state without backtracking In backtracking problems, if you add something to a list before a recursive call, you must remove it after the call returns. Forgetting to backtrack leads to incorrect results and is one of the trickiest bugs to find.Mistake 6: Recomputing the same subproblems Naive Fibonacci computes fib(3) multiple times when computing fib(5). Use memoization whenever you notice overlapping subproblems in your recursion tree.Top LeetCode Problems on RecursionThese are organized by pattern — work through them in this order for maximum learning:Pure Recursion Basics:509. Fibonacci Number — Easy — start here, implement with and without memoization344. Reverse String — Easy — recursion on arrays206. Reverse Linked List — Easy — recursion on linked list50. Pow(x, n) — Medium — fast power with recursionTree Recursion (Most Important):104. Maximum Depth of Binary Tree — Easy — simplest tree recursion112. Path Sum — Easy — decision recursion on tree101. Symmetric Tree — Easy — mutual recursion on tree110. Balanced Binary Tree — Easy — bottom-up recursion236. Lowest Common Ancestor of a Binary Tree — Medium — classic tree recursion124. Binary Tree Maximum Path Sum — Hard — advanced tree recursionDivide and Conquer:148. Sort List — Medium — merge sort on linked list240. Search a 2D Matrix II — Medium — divide and conquerBacktracking:78. Subsets — Medium — generate all subsets46. Permutations — Medium — generate all permutations77. Combinations — Medium — generate combinations79. Word Search — Medium — backtracking on grid51. N-Queens — Hard — classic backtrackingMemoization / Dynamic Programming:70. Climbing Stairs — Easy — Fibonacci variant with memoization322. Coin Change — Medium — recursion with memoization to DP139. Word Break — Medium — memoized recursionRecursion Cheat Sheet// Linear recursion templatereturnType solve(input) { if (baseCase) return directAnswer; // process current return solve(smallerInput);}// Tree recursion templatereturnType solve(TreeNode root) { if (root == null) return baseValue; returnType left = solve(root.left); returnType right = solve(root.right); return combine(left, right, root.val);}// Backtracking templatevoid backtrack(choices, current, result) { if (goalReached) { result.add(copy of current); return; } for (choice : choices) { make(choice); // add to current backtrack(...); // recurse undo(choice); // remove from current }}// Memoization templateMap<Input, Output> memo = new HashMap<>();returnType solve(input) { if (baseCase) return directAnswer; if (memo.containsKey(input)) return memo.get(input); returnType result = solve(smallerInput); memo.put(input, result); return result;}FAQs — People Also AskQ1. What is recursion in Java with a simple example? Recursion is when a function calls itself to solve a smaller version of the same problem. A simple example is factorial — factorial(5) = 5 × factorial(4) = 5 × 4 × factorial(3) and so on until factorial(1) returns 1 directly.Q2. What is the difference between recursion and iteration? Iteration uses loops (for, while) and runs in O(1) space. Recursion uses function calls and uses O(n) stack space for n levels deep. Recursion is often cleaner for tree and graph problems. Iteration is better when memory is a concern or the problem is inherently linear.Q3. What causes StackOverflowError in Java recursion? StackOverflowError happens when recursion goes too deep — too many frames accumulate on the call stack before any of them return. This is caused by missing base case, wrong base case, or input too large for Java's default stack size limit.Q4. What is the difference between recursion and dynamic programming? Recursion solves a problem by breaking it into subproblems. Dynamic programming is recursion plus memoization — storing results of subproblems so they are never computed twice. DP converts exponential recursive solutions into polynomial ones by eliminating redundant computation.Q5. What is tail recursion and does Java support tail call optimization? Tail recursion is when the recursive call is the absolute last operation in the function. Java does NOT support tail call optimization — Java always creates a new stack frame for each call even if it is tail recursive. Languages like Scala and Kotlin (on the JVM) do support it with the tailrec keyword.Q6. How do you convert recursion to iteration? Every recursive solution can be converted to iterative using an explicit stack data structure. The call stack's behavior is replicated manually — push the initial call, loop while stack is not empty, pop, process, and push sub-calls. Tree traversals are a common example of this conversion.ConclusionRecursion is not magic. It is a systematic way of solving problems by expressing them in terms of smaller versions of themselves. Once you internalize the two parts (base case and recursive case), understand the call stack mentally, and learn to trust the recursive call rather than trace it completely, everything clicks.The learning path from here is clear — start with simple problems like Fibonacci and array sum. Move to tree problems where recursion is most natural. Then tackle backtracking. Finally add memoization to bridge into dynamic programming.Every hour you spend understanding recursion deeply pays dividends across the entire rest of your DSA journey. Trees, graphs, divide and conquer, backtracking, dynamic programming — all of them build on this foundation.

RecursionJavaBase CaseCall StackBacktrackingDynamic Programming

LeetCode 2390: Removing Stars From a String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 2390 Removing Stars From a String?If you are preparing for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 2390 Removing Stars From a String is a must-solve problem. It tests your understanding of the stack data structure and string manipulation — two of the most frequently tested topics in technical interviews.In this article, we will cover:What the problem is asking in plain English3 different Java approaches (Brute Force, Stack, StringBuilder)Step-by-step dry run with examplesTime and space complexity for each approachCommon mistakes to avoidFAQs that appear in Google's People Also AskLet's dive in!Problem Statement SummaryYou are given a string s containing lowercase letters and stars *. In one operation:Choose any * in the stringRemove the * itself AND the closest non-star character to its leftRepeat until all stars are removed and return the final string.Example:Input: s = "leet**cod*e"Output: "lecoe"Real Life Analogy — Think of It as a Backspace KeyImagine you are typing on a keyboard. Every * acts as your backspace key — it deletes itself and the character just before it.You type "leet" and press backspace twice:Backspace 1 → deletes t → "lee"Backspace 2 → deletes e → "le"That is exactly what this problem simulates! Once you see it this way, the solution becomes very obvious.Approach 1: Brute Force Simulation (Beginner Friendly)IdeaDirectly simulate the process the problem describes:Scan the string from left to rightFind the first *Remove it and the character just before itRepeat until no stars remainJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder(s);int i = 0;while (i < sb.length()) {if (sb.charAt(i) == '*') {sb.deleteCharAt(i); // remove the starif (i > 0) {sb.deleteCharAt(i - 1); // remove closest left characteri--;}} else {i++;}}return sb.toString();}Time and Space ComplexityComplexityValueReasonTimeO(n²)Each deletion shifts all remaining charactersSpaceO(n)StringBuilder storage⚠️ Important WarningThis problem has n up to 100,000. Brute force will get Time Limit Exceeded (TLE) on LeetCode. Use this only to understand the concept, never in production or interviews.Approach 2: Stack Based Solution (Interview Favorite)IdeaA stack is the perfect data structure here because:We always remove the most recently added letter when a * appearsThat is the definition of Last In First Out (LIFO) — exactly what a stack doesAlgorithm:Letter → push onto stack* → pop from stack (removes closest left character)At the end, build result from stack contentsJava Codepublic String removeStars(String s) {Stack<Character> st = new Stack<>();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (!st.empty()) {st.pop();}} else {st.push(c);}}StringBuilder sb = new StringBuilder();while (!st.empty()) {sb.append(st.pop());}return sb.reverse().toString();}Step-by-Step Dry Run — "leet**cod*e"StepCharacterActionStack State1lpush[l]2epush[l,e]3epush[l,e,e]4tpush[l,e,e,t]5*pop t[l,e,e]6*pop e[l,e]7cpush[l,e,c]8opush[l,e,c,o]9dpush[l,e,c,o,d]10*pop d[l,e,c,o]11epush[l,e,c,o,e]✅ Final Answer: "lecoe"Time and Space ComplexityComplexityValueReasonTimeO(n)Single pass through the stringSpaceO(n)Stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅IdeaThis is the best and most optimized approach. A StringBuilder can act as a stack:append(c) → works like pushdeleteCharAt(sb.length() - 1) → works like popNo reverse needed at the end unlike the Stack approachJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (sb.length() > 0) {sb.deleteCharAt(sb.length() - 1);}} else {sb.append(c);}}return sb.toString();}Step-by-Step Dry Run — "erase*****"StepCharacterActionStringBuilder1eappend"e"2rappend"er"3aappend"era"4sappend"eras"5eappend"erase"6*delete last"eras"7*delete last"era"8*delete last"er"9*delete last"e"10*delete last""✅ Final Answer: ""Why StringBuilder Beats Stack in JavaFactorStack<Character>StringBuilderMemoryBoxes char → Character objectWorks on primitives directlyReverse neededYesNoCode lengthMore verboseCleaner and shorterPerformanceSlightly slowerFasterTime and Space ComplexityComplexityValueReasonTimeO(n)One pass, each character processed onceSpaceO(n)StringBuilder storageAll Approaches Comparison TableApproachTimeSpacePasses LeetCode?Best ForBrute ForceO(n²)O(n)❌ TLEUnderstanding conceptStackO(n)O(n)✅ YesInterview explanationStringBuilderO(n)O(n)✅ YesBest solutionHow This Relates to LeetCode 3174 Clear DigitsIf you have already solved LeetCode 3174 Clear Digits, you will notice this problem is nearly identical:Feature3174 Clear Digits2390 Removing StarsTriggerDigit 0-9Star *RemovesClosest left non-digitClosest left non-starDifficultyEasyMediumBest approachStringBuilderStringBuilderThe exact same solution pattern works for both. This is why learning patterns matters more than memorizing individual solutions!Common Mistakes to Avoid1. Not checking sb.length() > 0 before deleting Even though the problem guarantees valid input, always add this guard. It shows clean, defensive coding in interviews.2. Forgetting to reverse when using Stack Stack gives you characters in reverse order. If you forget .reverse(), your answer will be backwards.3. Using Brute Force for large inputs With n up to 100,000, O(n²) will time out. Always use the O(n) approach.FAQs — People Also AskQ1. What data structure is best for LeetCode 2390? A Stack or StringBuilder used as a stack is the best data structure. Both give O(n) time complexity. StringBuilder is slightly more optimal in Java because it avoids object boxing overhead.Q2. Why does a star remove the closest left character? Because the problem defines it that way — think of * as a backspace key on a keyboard. It always deletes the character immediately before the cursor position.Q3. What is the time complexity of LeetCode 2390? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 2390 asked in Google interviews? Yes, this type of stack simulation problem is commonly asked at Google, Amazon, Microsoft, and Meta interviews as it tests understanding of LIFO operations and string manipulation.Q5. What is the difference between LeetCode 2390 and LeetCode 844? Both use the same backspace simulation pattern. In 844 Backspace String Compare, # is the backspace character and you compare two strings. In 2390, * is the backspace and you return the final string.Similar LeetCode Problems to Practice NextProblemDifficultyPattern844. Backspace String CompareEasyStack simulation1047. Remove All Adjacent Duplicates In StringEasyStack simulation3174. Clear DigitsEasyStack simulation20. Valid ParenthesesEasyClassic stack735. Asteroid CollisionMediumStack simulationConclusionLeetCode 2390 Removing Stars From a String is a classic stack simulation problem that every developer preparing for coding interviews should master. The key insight is recognizing that * behaves exactly like a backspace key, which makes a stack or StringBuilder the perfect tool.Quick Recap:Brute force works conceptually but TLEs on large inputsStack solution is clean and great for explaining in interviewsStringBuilder solution is the most optimal in Java — no boxing, no reversal

StringStackMediumLeetCode

LeetCode 682 Baseball Game - Java Solution Explained

IntroductionLeetCode 682 Baseball Game is one of the cleanest and most beginner-friendly stack simulation problems on LeetCode. It does not require any fancy algorithm or deep insight — it purely tests whether you can carefully read the rules and simulate them faithfully using the right data structure.But do not let "Easy" fool you. This problem is a great place to practice thinking about which data structure fits best and why. We will solve it three different ways — Stack, ArrayList, and Deque — so you can see the tradeoffs and pick the one that makes most sense to you.You can find the problem here — LeetCode 682 Baseball Game.What Is the Problem Really Asking?You are keeping score for a baseball game with four special rules. You process a list of operations one by one and maintain a record of scores. At the end, return the total sum of all scores in the record.The four operations are:A number (like "5" or "-2") — just add that number as a new score to the record."C" — the last score was invalid, remove it from the record."D" — add a new score that is double the most recent score."+" — add a new score that is the sum of the two most recent scores.That is it. Four rules, simulate them in order, sum up what is left.Real Life Analogy — A Scoreboard With CorrectionsImagine a scoreboard operator at a sports event. They write scores on a whiteboard as the game progresses:A player scores 5 points → write 5Another player scores 2 → write 2Referee says last score was invalid → erase the last number (C)Special bonus rule kicks in → double the last valid score (D)Two scores combine → add the last two scores as one entry (+)At the end, add up everything on the whiteboard. The stack is your whiteboard — you write on top and erase from the top.Why Stack Is the Natural FitAll four operations only ever look at or modify the most recently added scores. C removes the last one. D doubles the last one. + uses the last two. This "most recent first" access pattern is the definition of LIFO — Last In First Out — which is exactly what a Stack provides.Any time a problem says "the previous score" or "the last two scores," your brain should immediately think Stack.Approach 1: Stack (Your Solution) ✅The IdeaUse a Stack of integers. For each operation:Number → parse and pushC → pop the topD → peek the top, push doubled value+ → pop top two, push both back, push their sumpublic int calPoints(String[] operations) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < operations.length; i++) { String op = operations[i]; if (op.equals("C")) { st.pop(); // remove last score } else if (op.equals("D")) { st.push(st.peek() * 2); // double of last score } else if (op.equals("+")) { int prev1 = st.pop(); // most recent score int prev2 = st.pop(); // second most recent score int sum = prev1 + prev2; st.push(prev2); // put them back st.push(prev1); st.push(sum); // push the new score } else { st.push(Integer.parseInt(op)); // regular number } } // sum all remaining scores int total = 0; while (!st.empty()) { total += st.pop(); } return total;}One small improvement over your original solution — using op.equals("C") instead of op.charAt(0) == 'C'. This is cleaner and handles edge cases better since negative numbers like "-2" also start with - not a digit, so charAt(0) comparisons can get tricky. Using equals is always safer for string operations.Why the + Operation Needs Pop-Push-PopThe trickiest part is the + operation. You need the two most recent scores. Stack only lets you see the top. So you pop the first, then the second, compute the sum, then push both back before pushing the sum. This restores the record correctly — the previous two scores stay, and the new sum score is added on top.Detailed Dry Run — ops = ["5","2","C","D","+"]Let us trace every step carefully:"5" → number, parse and push Stack: [5]"2" → number, parse and push Stack: [5, 2]"C" → remove last score, pop Stack: [5]"D" → double last score, peek=5, push 10 Stack: [5, 10]"+" → sum of last two:pop prev1 = 10pop prev2 = 5sum = 15push prev2=5, push prev1=10, push sum=15 Stack: [5, 10, 15]Sum all: 5 + 10 + 15 = 30 ✅Detailed Dry Run — ops = ["5","-2","4","C","D","9","+","+"]"5" → push 5. Stack: [5]"-2" → push -2. Stack: [5, -2]"4" → push 4. Stack: [5, -2, 4]"C" → pop 4. Stack: [5, -2]"D" → peek=-2, push -4. Stack: [5, -2, -4]"9" → push 9. Stack: [5, -2, -4, 9]"+" → prev1=9, prev2=-4, sum=5. Push -4, 9, 5. Stack: [5, -2, -4, 9, 5]"+" → prev1=5, prev2=9, sum=14. Push 9, 5, 14. Stack: [5, -2, -4, 9, 5, 14]Sum: 5 + (-2) + (-4) + 9 + 5 + 14 = 27 ✅Approach 2: ArrayList (Most Readable)The IdeaArrayList gives you index-based access which makes the + operation much cleaner — no need to pop and push back. Just access the last two elements directly using size()-1 and size()-2.public int calPoints(String[] operations) { ArrayList<Integer> record = new ArrayList<>(); for (String op : operations) { int n = record.size(); if (op.equals("C")) { record.remove(n - 1); // remove last element } else if (op.equals("D")) { record.add(record.get(n - 1) * 2); // double last } else if (op.equals("+")) { // sum of last two — no need to remove and re-add! record.add(record.get(n - 1) + record.get(n - 2)); } else { record.add(Integer.parseInt(op)); } } int total = 0; for (int score : record) { total += score; } return total;}See how the + operation becomes a single line with ArrayList? record.get(n-1) + record.get(n-2) directly accesses the last two elements without any pop-push gymnastics.Dry Run — ops = ["5","2","C","D","+"]"5" → add 5. List: [5]"2" → add 2. List: [5, 2]"C" → remove last. List: [5]"D" → 5×2=10, add 10. List: [5, 10]"+" → get(0)+get(1) = 5+10=15, add 15. List: [5, 10, 15]Sum: 30 ✅Time Complexity: O(n) — single pass through operations Space Complexity: O(n) — ArrayList stores at most n scoresThe one tradeoff — remove(n-1) on an ArrayList is O(1) for the last element (no shifting needed). And get() is O(1). So this is fully O(n) overall and arguably the cleanest solution to read and understand.Approach 3: Deque (ArrayDeque — Fastest in Java)The IdeaArrayDeque is faster than Stack in Java because Stack is synchronized (thread-safe overhead) and ArrayDeque is not. For single-threaded LeetCode problems, ArrayDeque is always the better choice over Stack.public int calPoints(String[] operations) { Deque<Integer> deque = new ArrayDeque<>(); for (String op : operations) { if (op.equals("C")) { deque.pollLast(); // remove last } else if (op.equals("D")) { deque.offerLast(deque.peekLast() * 2); // double last } else if (op.equals("+")) { int prev1 = deque.pollLast(); int prev2 = deque.pollLast(); int sum = prev1 + prev2; deque.offerLast(prev2); // restore deque.offerLast(prev1); // restore deque.offerLast(sum); // new score } else { deque.offerLast(Integer.parseInt(op)); } } int total = 0; for (int score : deque) { total += score; } return total;}The logic is identical to the Stack approach. The only difference is the method names — offerLast instead of push, pollLast instead of pop, peekLast instead of peek.Time Complexity: O(n) Space Complexity: O(n)For iterating a Deque to sum, you can use a for-each loop directly — no need to pop everything out like with Stack.Approach ComparisonApproachTimeSpaceBest ForStackO(n)O(n)Classic interview answer, clear LIFO intentArrayListO(n)O(n)Cleanest code, easiest to readArrayDequeO(n)O(n)Best performance, preferred in productionAll three approaches have identical time and space complexity. The difference is purely in code style and readability. In an interview, any of these is perfectly acceptable. Mention that ArrayDeque is preferred over Stack in Java for performance if you want to impress.Why op.equals() Is Better Than op.charAt(0)Your original solution uses operations[i].charAt(0) == 'C' to check operations. This works but has a subtle risk — the + character check with charAt(0) is fine, but imagine if a future test had a number starting with C or D (it will not in this problem but defensive coding is a good habit). More importantly, "-2".charAt(0) is '-' which is fine, but using equals is semantically clearer — you are comparing the whole string, not just the first character. This shows cleaner coding habits in interviews.Edge Cases to KnowNegative numbers like "-2" Integer.parseInt("-2") handles negatives perfectly. The D operation on -2 gives -4. The + operation works correctly with negatives too. No special handling needed."C" after a "+" that added a score The problem guarantees C always has at least one score to remove. So after + adds a score, a C removes just that one new score — the previous two scores that + used remain intact. This is correct behavior and our solution handles it automatically.All scores removed If all operations are numbers followed by C operations removing every score, the stack ends up empty and the sum is 0. Our while loop handles this correctly — it simply never executes and returns 0.Only one operation A single number like ["5"] → push 5, sum is 5. Works fine.Common Mistakes to AvoidIn the + operation, forgetting to push both numbers back When you pop prev1 and prev2 to compute the sum, you must push them back onto the stack before pushing the sum. If you only push the sum without restoring prev1 and prev2, those scores disappear from the record permanently — which is wrong. The + operation only adds a new score, it does not remove the previous ones.Using charAt(0) comparison for detecting numbers Negative numbers start with -, not a digit. If you check charAt(0) >= '0' && charAt(0) <= '9' to detect numbers, you will miss negatives. The safest approach is to check for C, D, and + explicitly using equals, and fall through to the else for everything else (which covers both positive and negative numbers).Calling st.peek() or st.pop() without checking empty The problem guarantees valid operations — C always has something to remove, + always has two previous scores, D always has one. But in real code and defensive interview solutions, adding empty checks shows good habits even when the constraints guarantee safety.FAQs — People Also AskQ1. Why is Stack a good choice for LeetCode 682 Baseball Game? Because all four operations only access the most recently added scores — the last score for C and D, the last two for +. This "most recent first" access pattern is exactly what LIFO (Last In First Out) provides. Stack's push, pop, and peek all run in O(1) making it perfectly efficient.Q2. What is the time complexity of LeetCode 682? O(n) time where n is the number of operations. Each operation performs a constant number of stack operations (at most 3 pushes/pops for the + case). Space complexity is O(n) for storing scores.Q3. Why does the + operation need to pop and push back in the Stack approach? Stack only gives direct access to the top element. To get the second most recent score, you must pop the first one, peek/pop the second, then push the first one back. The ArrayList approach avoids this by using index-based access directly.Q4. What is the difference between Stack and ArrayDeque in Java for this problem? Both work correctly. ArrayDeque is faster because Stack is a legacy class that extends Vector and is synchronized (thread-safe), adding unnecessary overhead for single-threaded use. ArrayDeque has no synchronization overhead. For LeetCode and interviews, either is acceptable but ArrayDeque is technically better.Q5. Is LeetCode 682 asked in coding interviews? It appears occasionally as a warmup or screening problem. Its main value is testing whether you can carefully simulate rules without making logical errors — a skill that matters in systems programming, game development, and any domain with complex state management.Similar LeetCode Problems to Practice Next71. Simplify Path — Medium — stack simulation with path operations1047. Remove All Adjacent Duplicates In String — Easy — stack simulation735. Asteroid Collision — Medium — stack simulation with conditions150. Evaluate Reverse Polish Notation — Medium — stack with arithmetic operations, very similar pattern227. Basic Calculator II — Medium — stack with operator precedenceConclusionLeetCode 682 Baseball Game is a perfect problem to build confidence with stack simulation. The four operations are clearly defined, the rules are unambiguous, and the stack maps naturally to every operation. Once you understand why pop-push-back is needed for + in the stack approach and how ArrayList simplifies that with index access, you have genuinely understood the tradeoffs between these data structures.If you are newer to stacks, start with the ArrayList solution for clarity. Once that clicks, rewrite it with Stack to understand the LIFO mechanics. Then try ArrayDeque to understand why it is preferred in modern Java code.

LeetCodeJavaStackArrayListDequeEasy

LeetCode 1047: Remove All Adjacent Duplicates In String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 1047 Remove All Adjacent Duplicates In String?If you are grinding LeetCode for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 1047 Remove All Adjacent Duplicates In String is a problem you cannot skip. It is one of the most elegant examples of the stack simulation pattern and appears frequently as a warmup or follow-up question in technical rounds.In this article we will cover everything you need — plain English explanation, real life analogy, 3 Java approaches with dry runs, complexity analysis, common mistakes, FAQs, and similar problems to practice next.Here is the problem link-: Leetcode 1047 What Is the Problem Really Asking?You are given a string. Keep scanning it and whenever you find two same letters sitting next to each other, remove both of them. After removing, the letters around them might now become adjacent and form a new pair — so you keep doing this until no more adjacent duplicates exist.Example walkthrough for "abbaca":"abbaca" → bb are adjacent duplicates → remove → "aaca""aaca" → aa are adjacent duplicates → remove → "ca""ca" → no adjacent duplicates → done!✅ Output: "ca"Real Life Analogy — Think of Popping BubblesImagine a row of colored bubbles. Whenever two bubbles of the same color are next to each other, they pop and disappear. After they pop, the bubbles on either side might now touch each other — and if they are the same color, they pop too! You keep going until no two same-colored bubbles are touching.That chain reaction is exactly what this problem simulates. And the best tool to handle that chain reaction? A stack.Approach 1: Brute Force (Beginner Friendly)The IdeaScan the string repeatedly. Every time you find two adjacent equal characters, remove them. Keep doing this until a full pass finds nothing to remove.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(s); boolean found = true; while (found) { found = false; for (int i = 0; i < sb.length() - 1; i++) { if (sb.charAt(i) == sb.charAt(i + 1)) { sb.deleteCharAt(i); sb.deleteCharAt(i); found = true; break; } } } return sb.toString();}This is easy to understand but very slow. For each pair found, you restart the entire scan. With n up to 100,000, this will get Time Limit Exceeded on LeetCode. Use it only to build intuition.Time Complexity: O(n²) — repeated passes over the string Space Complexity: O(n) — StringBuilder storageApproach 2: Stack Based Solution (Classic Interview Approach)The IdeaA stack is perfect here because of one key observation — when you remove a pair, the character that was before the pair is now adjacent to the character after the pair. That is a Last In First Out situation, which is exactly what a stack handles naturally.Algorithm:If the current character matches the top of the stack → pop (they cancel each other)Otherwise → push the current character onto the stackAt the end, the stack contains your final answerpublic String removeDuplicates(String s) { Stack<Character> st = new Stack<>(); StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (!st.empty() && c == st.peek()) { st.pop(); // adjacent duplicate found, cancel both } else { st.push(c); } } while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString();}Dry Run — "abbaca"We go character by character and check against the top of the stack:a → stack empty, push → stack: [a]b → top is a, not equal, push → stack: [a, b]b → top is b, equal! pop → stack: [a]a → top is a, equal! pop → stack: []c → stack empty, push → stack: [c]a → top is c, not equal, push → stack: [c, a]Stack remaining: [c, a] → reverse → ✅ "ca"Notice how after removing bb, the two as automatically become adjacent and get caught — the stack handles this chain reaction naturally without any extra logic!Time Complexity: O(n) — single pass through the string Space Complexity: O(n) — stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅The IdeaThis is your own solution and the best one! Instead of using a separate Stack<Character>, we use StringBuilder itself as a stack:sb.append(c) acts as pushsb.deleteCharAt(sb.length() - 1) acts as popsb.charAt(sb.length() - 1) acts as peekNo extra data structure, no boxing of char into Character objects, and no reversal needed at the end. Clean, fast, and minimal.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (sb.length() != 0 && c == sb.charAt(sb.length() - 1)) { sb.deleteCharAt(sb.length() - 1); // adjacent duplicate, remove both } else { sb.append(c); } } return sb.toString();}Dry Run — "azxxzy"a → sb empty, append → "a"z → last char is a, not equal, append → "az"x → last char is z, not equal, append → "azx"x → last char is x, equal! delete → "az"z → last char is z, equal! delete → "a"y → last char is a, not equal, append → "ay"✅ Final Answer: "ay"Again, notice the chain reaction — after xx was removed, z and z became adjacent and got removed too. The StringBuilder handles this perfectly in a single pass!Time Complexity: O(n) — one pass, every character processed exactly once Space Complexity: O(n) — StringBuilder storageWhy StringBuilder Beats Stack in JavaWhen you use Stack<Character> in Java, every char primitive gets auto-boxed into a Character object. That means extra memory allocation for every single character. With StringBuilder, you work directly on the underlying char array — faster and leaner. Plus you skip the reversal step entirely.For an interview, the Stack approach is great for explaining your thought process clearly. But for the final submitted solution, StringBuilder is the way to go.Common Mistakes to AvoidNot checking sb.length() != 0 before peeking If the StringBuilder is empty and you call sb.charAt(sb.length() - 1), you will get a StringIndexOutOfBoundsException. Always guard this check — even if the problem guarantees valid input, it shows clean coding habits.Thinking you need multiple passes Many beginners think you need to scan the string multiple times because of chain reactions. The stack handles chain reactions automatically in a single pass. Trust the process!Forgetting to reverse when using Stack Since a stack gives you characters in reverse order when you pop them, you must call .reverse() at the end. With StringBuilder you do not need this.How This Fits Into the Stack Simulation PatternBy now you might be noticing a theme across multiple problems:LeetCode 3174 Clear Digits — digit acts as backspace, deletes closest left non-digit LeetCode 2390 Removing Stars — star acts as backspace, deletes closest left non-star LeetCode 1047 Remove Adjacent Duplicates — character cancels itself if it matches the top of stackAll three use the exact same StringBuilder-as-stack pattern. The only difference is the condition that triggers a deletion. This is why pattern recognition is the real skill — once you internalize this pattern, you can solve a whole family of problems in minutes.FAQs — People Also AskQ1. What is the best approach for LeetCode 1047 in Java? The StringBuilder approach is the best. It runs in O(n) time, uses O(n) space, requires no extra data structure, and avoids the reversal step needed with a Stack.Q2. Why does a stack work for removing adjacent duplicates? Because whenever you remove a pair, the characters around them become the new neighbors. A stack naturally keeps track of the most recently seen character, so it catches these chain reactions without any extra logic.Q3. What is the time complexity of LeetCode 1047? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 1047 asked in coding interviews? Yes, it is commonly asked as a warmup problem or follow-up at companies like Google, Amazon, and Adobe. It tests your understanding of stack-based string manipulation.Q5. What is the difference between LeetCode 1047 and LeetCode 1209? LeetCode 1047 removes pairs of adjacent duplicates. LeetCode 1209 is the harder version — it removes groups of k adjacent duplicates, requiring you to store counts alongside characters in the stack.Similar LeetCode Problems to Practice Next2390. Removing Stars From a String — Medium — star as backspace3174. Clear Digits — Easy — digit as backspace844. Backspace String Compare — Easy — compare two strings after backspaces1209. Remove All Adjacent Duplicates in String II — Medium — harder version with k duplicates735. Asteroid Collision — Medium — stack simulation with collision logicConclusionLeetCode 1047 Remove All Adjacent Duplicates In String is a beautiful problem that teaches you one of the most powerful and reusable patterns in DSA — stack simulation. The moment you spot that a removal can cause a chain reaction of more removals, you know a stack is your best friend.The StringBuilder solution is clean, optimal, and interview-ready. Master it, understand why it works, and you will be able to tackle the entire family of stack simulation problems with confidence.Found this helpful? Share it with friends preparing for coding interviews

LeetCodeJavaStackStringEasy

Merge Sort Algorithm Explained | Java Implementation, Intuition & Complexity

IntroductionSorting is one of the most fundamental operations in computer science, and Merge Sort is among the most efficient and widely used sorting algorithms.It follows the Divide and Conquer approach, making it highly scalable and predictable even for large datasets.In this article, we will cover:Intuition behind Merge SortStep-by-step breakdownMultiple approachesJava implementation with commentsTime & space complexity analysis🔗 Problem LinkGeeksforGeeks: Merge SortProblem StatementGiven an array arr[] with starting index l and ending index r, sort the array using the Merge Sort algorithm.ExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]Output:[1, 2, 3, 4, 5, 6, 7, 8, 9, 10]Key InsightMerge Sort works by:Divide → Conquer → CombineDivide the array into two halvesRecursively sort each halfMerge both sorted halvesIntuition (Visual Understanding)For:[4, 1, 3, 9, 7]Step 1: Divide[4, 1, 3] [9, 7][4, 1] [3] [9] [7][4] [1]Step 2: Merge[4] [1] → [1, 4][1, 4] [3] → [1, 3, 4][9] [7] → [7, 9]Step 3: Final Merge[1, 3, 4] + [7, 9] → [1, 3, 4, 7, 9]Approach 1: Recursive Merge Sort (Top-Down)IdeaKeep dividing until single elements remainMerge sorted subarraysJava Codeclass Solution { // Function to merge two sorted halves void merge(int[] arr, int l, int mid, int h) { // Temporary array to store merged result int[] temp = new int[h - l + 1]; int i = l; // pointer for left half int j = mid + 1; // pointer for right half int k = 0; // pointer for temp array // Compare elements from both halves while (i <= mid && j <= h) { if (arr[i] <= arr[j]) { temp[k] = arr[i]; i++; } else { temp[k] = arr[j]; j++; } k++; } // Copy remaining elements from left half while (i <= mid) { temp[k] = arr[i]; i++; k++; } // Copy remaining elements from right half while (j <= h) { temp[k] = arr[j]; j++; k++; } // Copy sorted elements back to original array for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } // Recursive merge sort function void mergeSort(int arr[], int l, int h) { // Base case: single element if (l >= h) return; int mid = l + (h - l) / 2; // Sort left half mergeSort(arr, l, mid); // Sort right half mergeSort(arr, mid + 1, h); // Merge both halves merge(arr, l, mid, h); }}Approach 2: Iterative Merge Sort (Bottom-Up)IdeaStart with subarrays of size 1Merge pairsIncrease size graduallyCodeclass Solution { void merge(int[] arr, int l, int mid, int h) { int[] temp = new int[h - l + 1]; int i = l, j = mid + 1, k = 0; while (i <= mid && j <= h) { if (arr[i] <= arr[j]) temp[k++] = arr[i++]; else temp[k++] = arr[j++]; } while (i <= mid) temp[k++] = arr[i++]; while (j <= h) temp[k++] = arr[j++]; for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } void mergeSort(int[] arr, int n) { for (int size = 1; size < n; size *= 2) { for (int l = 0; l < n - size; l += 2 * size) { int mid = l + size - 1; int h = Math.min(l + 2 * size - 1, n - 1); merge(arr, l, mid, h); } } }}Approach 3: Using Built-in Sorting (For Comparison)Arrays.sort(arr);👉 Internally uses optimized algorithms (TimSort in Java)Complexity AnalysisTime ComplexityCaseComplexityBestO(n log n)AverageO(n log n)WorstO(n log n)Space ComplexityO(n) (extra array for merging)Why Merge Sort is PowerfulStable sorting algorithmWorks efficiently on large datasetsPredictable performanceUsed in external sorting (large files)❌ Why Not Use Bubble/Selection Sort?AlgorithmTime ComplexityBubble SortO(n²)Selection SortO(n²)Merge SortO(n log n) ✅Key TakeawaysMerge Sort uses divide and conquerRecursion splits problem into smaller partsMerging is the key stepAlways O(n log n), regardless of inputWhen to Use Merge SortLarge datasetsLinked lists (very efficient)Stable sorting requiredExternal sortingConclusionMerge Sort is one of the most reliable and efficient sorting algorithms. Understanding its recursive structure and merging process is essential for mastering advanced algorithms.Once you grasp the divide-and-conquer pattern, it becomes easier to solve many complex problems.Frequently Asked Questions (FAQs)1. Is Merge Sort stable?Yes, it maintains the relative order of equal elements.2. Why is extra space required?Because we use a temporary array during merging.3. Can it be done in-place?Not efficiently; standard merge sort requires extra space.

GeekfOfGeeksMediumSortingMerge SortJava

LeetCode 3488 — Closest Equal Element Queries: A Complete Walkthrough from Brute Force to Optimal

If you have been grinding LeetCode lately, you have probably run into problems where your first clean-looking solution times out and forces you to rethink from scratch. LeetCode 3488 is exactly that kind of problem. This article walks through the complete thought process — from the naive approach that got me TLE, to the intuition shift, to the final optimized solution in Java.You can find the original problem here: LeetCode 3488 — Closest Equal Element Queries at Problem LinkUnderstanding the ProblemYou are given a circular array nums and an array of queries. For each query queries[i], you must find the minimum distance between the element at index queries[i] and any other index j such that nums[j] == nums[queries[i]]. If no such other index exists, the answer is -1.The critical detail here is the word circular. The array wraps around, which means the distance between two indices i and j in an array of length n is not simply |i - j|. It is:min( |i - j| , n - |i - j| )You can travel either clockwise or counterclockwise, and you take whichever path is shorter.Breaking Down the ExamplesExample 1nums = [1, 3, 1, 4, 1, 3, 2], queries = [0, 3, 5]For query index 0, the value is 1. Other indices holding 1 are 2 and 4. Circular distances are min(2, 5) = 2 and min(4, 3) = 3. The minimum is 2.For query index 3, the value is 4. It appears nowhere else in the array. Answer is -1.For query index 5, the value is 3. The other 3 sits at index 1. Circular distance is min(4, 3) = 3. Answer is 3.Output: [2, -1, 3]Example 2nums = [1, 2, 3, 4], queries = [0, 1, 2, 3]Every element is unique. Every query returns -1.Output: [-1, -1, -1, -1]First Attempt — Brute ForceMy first instinct was straightforward. For each query, scan the entire array, collect every index that matches the queried value, compute the circular distance to each, and return the minimum. Clean logic, easy to reason about, and dead simple to implement.while (i != queries.length) { int max = Integer.MAX_VALUE; for (int j = 0; j < nums.length; j++) { int target = nums[queries[i]]; if (nums[j] == target && j != queries[i]) { // Linear distance between the two indices int right = Math.abs(j - queries[i]); // Distance going the other direction around the ring int left = nums.length - right; // True circular distance is the shorter of the two int dist = Math.min(right, left); max = Math.min(max, dist); } } lis.add(max == Integer.MAX_VALUE ? -1 : max); i++;}This got TLE immediately, and once you look at the constraints it is obvious why. Both nums.length and queries.length can be up to 10^5. For every query you are scanning every element, giving you O(n × q) time — which in the worst case is 10 billion operations. No judge is going to wait for that.Rethinking the Approach — Where Is the Waste?After the TLE, the question I asked myself was: what work is being repeated unnecessarily?The answer was obvious in hindsight. Every time a query asks about a value like 3, the brute force scans the entire array again looking for every index that holds 3. If ten different queries all ask about value 3, you are doing that scan ten times. You are finding the same indices over and over.The fix is to do that work exactly once, before any query is processed. You precompute a map from each value to all the indices where it appears. Then for every query you simply look up the relevant list and work within it.That observation reduces the precomputation to O(n) — one pass through the array. The question then becomes: once you have that sorted list of indices for a given value, how do you find the closest one to your query index efficiently?The Key Insight — You Only Need Two NeighboursHere is the insight that makes this problem elegant. The index list for any value is sorted in ascending order because you build it by iterating left to right through the array. If your query index sits at position mid inside that sorted list, then by definition every index to the left of mid - 1 is farther away than arr[mid - 1], and every index to the right of mid + 1 is farther away than arr[mid + 1].This means you never need to compare against all duplicates. You only ever need to check the immediate left and right neighbours of your query index within the sorted list.The one subtlety is the circular wrap. Because the array itself is circular, the left neighbour of the very first element in the list is actually the last element in the list, since you can wrap around the ring. This is handled cleanly with modular arithmetic: (mid - 1 + n) % n for the left neighbour and (mid + 1) % n for the right.The Optimized Solution — HashMap + Binary SearchStep 1 — Precompute the index mapIterate through nums once and build a HashMap mapping each value to a list of all indices where it appears. The lists are sorted by construction since you insert indices in order.Step 2 — Binary search to locate the query indexFor a given query at index q, look up the index list for nums[q]. Binary search the list to find the position of q within it. This runs in O(log n) rather than O(n).Step 3 — Check immediate neighbours and compute circular distancesOnce you have the position mid, fetch arr[(mid + 1) % n] and arr[(mid - 1 + n) % n]. For each, compute the circular distance using min(|diff|, totalLength - |diff|). Return the smaller of the two.Full Annotated Java Solutionclass Solution { public List<Integer> solveQueries(int[] nums, int[] queries) { int c = 0; // Precompute: map each value to the sorted list of indices where it appears. // Since we iterate left to right, the list is sorted by construction. HashMap<Integer, List<Integer>> mp = new HashMap<>(); for (int i = 0; i < nums.length; i++) { mp.computeIfAbsent(nums[i], k -> new ArrayList<>()).add(i); } List<Integer> lis = new ArrayList<>(); while (c != queries.length) { // Retrieve the sorted index list for the value at the queried position List<Integer> arr = mp.get(nums[queries[c]]); int n = arr.size(); int i = 0; int j = n - 1; int min = -1; while (i <= j) { int mid = i + (j - i) / 2; if (arr.get(mid) == queries[c]) { // Only one occurrence in the entire array — no duplicate exists if (n == 1) { min = -1; } else { // Circular neighbour to the right within the index list int right = arr.get((mid + 1) % n); // Circular neighbour to the left within the index list int left = arr.get((mid - 1 + n) % n); // Compute circular distance to the right neighbour int d1 = Math.abs(right - queries[c]); int distRight = Math.min(d1, nums.length - d1); // Compute circular distance to the left neighbour int d2 = Math.abs(left - queries[c]); int distLeft = Math.min(d2, nums.length - d2); // The answer is the closer of the two neighbours min = Math.min(distLeft, distRight); } break; } else if (arr.get(mid) > queries[c]) { // Query index is smaller — search the left half j = mid - 1; } else { // Query index is larger — search the right half i = mid + 1; } } lis.add(min); c++; } return lis; }}Complexity AnalysisTime Complexity: O(n log n)Building the HashMap takes O(n). For each of the q queries, binary search over the index list takes O(log n) in the worst case. Total: O(n + q log n), which simplifies to O(n log n) given the constraint that q ≤ n.Space Complexity: O(n)The HashMap stores every index exactly once across all its lists, so total space used is O(n).Compared to the brute force O(n × q), this is the difference between ~1.7 million operations and ~10 billion operations at the constraint limits.Common PitfallsMixing up the two values of n. Inside the solution, n refers to arr.size() — the number of occurrences of a particular value. But when computing circular distance, you need nums.length — the full array length. These are different numbers and swapping them silently produces wrong answers.Forgetting the + n in the left neighbour formula. Writing (mid - 1) % n when mid is 0 produces -1 in Java, since Java's modulo preserves the sign of the dividend. Always write (mid - 1 + n) % n.Not handling the single-occurrence case. If a value appears only once, n == 1, and the neighbour formula wraps around to the element itself, giving a distance of zero — which is completely wrong. Guard against this explicitly before running the neighbour logic.What This Problem Teaches YouThe journey from brute force to optimal here follows a pattern worth internalizing.The brute force was correct but repeated work. Recognizing that repeated work and lifting it into a precomputation step is the single move that makes this problem tractable. The HashMap does that.Once you have a sorted structure, binary search is almost always the right tool to find a position within it. And once you have a position in a sorted structure, you only ever need to look at adjacent elements to find the nearest one — checking anything further is redundant by definition.These are not tricks specific to this problem. They are transferable patterns that appear across dozens of medium and hard problems on the platform. Internalizing them — rather than memorizing solutions — is what actually builds problem-solving ability over time.

ArraysHashMapBinary SearchCircular ArraysMediumLeetCodeJava

LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

IntroductionIf you are preparing for coding interviews or improving your Data Structures and Algorithms skills, LeetCode 39 Combination Sum is one of the most important backtracking problems to learn. This problem helps you understand how recursion explores multiple possibilities and how combinations are generated efficiently. It is a foundational problem that builds strong problem-solving skills and prepares you for many advanced recursion and backtracking questions.Why Should You Solve This Problem?Combination Sum is not just another coding question — it teaches you how to think recursively and break a complex problem into smaller decisions. By solving it, you learn how to manage recursive paths, avoid duplicate combinations, and build interview-level backtracking intuition. Once you understand this pattern, problems like subsets, permutations, N-Queens, and Sudoku Solver become much easier to approach.LeetCode Problem LinkProblem Name: Combination SumProblem Link: Combination SumProblem StatementGiven an array of distinct integers called candidates and a target integer target, you need to return all unique combinations where the chosen numbers sum to the target.Important rules:You can use the same number unlimited times.Only unique combinations should be returned.Order of combinations does not matter.ExampleExample 1Input:candidates = [2,3,6,7]target = 7Output:[[2,2,3],[7]]Explanation2 + 2 + 3 = 77 itself equals targetUnderstanding the Problem in Simple WordsWe are given some numbers.We need to:Pick numbers from the arrayAdd them togetherReach the target sumUse numbers multiple times if neededAvoid duplicate combinationsThis problem belongs to the Backtracking + Recursion category.Real-Life AnalogyImagine you have coins of different values.You want to make an exact payment.You can reuse coins multiple times.You need to find every possible valid coin combination.This is exactly what Combination Sum does.Intuition Behind the SolutionAt every index, we have two choices:Pick the current numberSkip the current numberSince numbers can be reused unlimited times, when we pick a number, we stay at the same index.This creates a recursion tree.We continue until:Target becomes 0 → valid answerTarget becomes negative → invalid pathArray ends → stop recursionWhy Backtracking Works HereBacktracking helps us:Explore all possible combinationsUndo previous decisionsTry another pathIt is useful whenever we need:All combinationsAll subsetsPath explorationRecursive searchingApproach 1: Backtracking Using Pick and SkipCore IdeaAt every element:Either take itOr move to next elementJava Code (Pick and Skip Method)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] candidates, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == candidates.length) {return;}if (candidates[index] <= target) {current.add(candidates[index]);solve(candidates, index, target - candidates[index], current);current.remove(current.size() - 1);}solve(candidates, index + 1, target, current);}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Approach 2: Backtracking Using Loop (Optimized)This is the cleaner and more optimized version.Your code belongs to this category.Java Code (Loop-Based Backtracking)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == arr.length) {return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Dry Run of the AlgorithmInputcandidates = [2,3,6,7]target = 7Step-by-Step ExecutionStart:solve([2,3,6,7], index=0, target=7, [])Pick 2[2]target = 5Pick 2 again:[2,2]target = 3Pick 2 again:[2,2,2]target = 1No valid choice possible.Backtrack.Try 3[2,2,3]target = 0Valid answer found.Add:[2,2,3]Try 7[7]target = 0Valid answer found.Add:[7]Final Output[[2,2,3],[7]]Recursion Tree Visualization[]/ | | \2 3 6 7/2/2/3Every branch explores a different combination.Time Complexity AnalysisTime ComplexityO(2^Target)More accurately:O(N^(Target/minValue))Where:N = Number of candidatesTarget = Required sumReason:Every number can be picked multiple times.This creates many recursive branches.Space ComplexityO(Target)Reason:Recursion stack stores elements.Maximum recursion depth depends on target.Why We Pass Same Index AgainNotice this line:solve(arr, i, target - arr[i], current);We pass i, not i+1.Why?Because we can reuse the same number unlimited times.If we used i+1, we would move forward and lose repetition.Why Duplicate Combinations Are Not CreatedWe start loop from current index.This guarantees:[2,3]and[3,2]are not both generated.Order remains controlled.Common Mistakes Beginners Make1. Using i+1 Instead of iWrong:solve(arr, i+1, target-arr[i], current)This prevents reuse.2. Forgetting Backtracking StepWrong:current.remove(current.size()-1)Without removing, recursion keeps incorrect values.3. Missing Target == 0 Base CaseThis is where valid answer is stored.Important Interview InsightCombination Sum is a foundational problem.It helps build understanding for:Combination Sum IISubsetsPermutationsN-QueensWord SearchSudoku SolverThis question is frequently asked in coding interviews.Pattern RecognitionUse Backtracking when problem says:Find all combinationsGenerate all subsetsFind all pathsUse recursionExplore possibilitiesOptimized Thinking StrategyWhenever you see:Target sumRepeated selectionMultiple combinationsThink:Backtracking + DFSEdge CasesCase 1candidates = [2]target = 1Output:[]No possible answer.Case 2candidates = [1]target = 3Output:[[1,1,1]]Interview Answer in One Line“We use backtracking to recursively try all candidate numbers while reducing the target and backtrack whenever a path becomes invalid.”Final Java Codeclass Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Key TakeawaysCombination Sum uses Backtracking.Reuse same element by passing same index.Target becomes smaller in recursion.Backtracking removes last element.Very important for interview preparation.Frequently Asked QuestionsIs Combination Sum DP or Backtracking?It is primarily solved using Backtracking.Dynamic Programming can also solve it but recursion is more common.Why is this Medium difficulty?Because:Requires recursion understandingRequires backtracking logicRequires duplicate preventionCan we sort the array?Yes.Sorting can help with pruning.ConclusionLeetCode 39 Combination Sum is one of the best problems to learn recursion and backtracking.Once you understand this pattern, many interview problems become easier.The loop-based recursive solution is clean, optimized, and interview-friendly.If you master this question, you gain strong understanding of recursive decision trees and combination generation.

LeetcodeMediumRecursionBacktrackingJava

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium

LeetCode 3761 Minimum Absolute Distance Between Mirror Pairs | Java HashMap Solution

IntroductionSome problems look simple at first—but hide a clever trick inside.LeetCode 3761 – Minimum Absolute Distance Between Mirror Pairs is one such problem. It combines:Number manipulation (digit reversal)HashingEfficient searchingIf approached naively, this problem can easily lead to O(n²) time complexity—which is not feasible for large inputs.In this article, we will walk through:Problem intuitionNaive approach (and why it fails)Optimized HashMap solutionStep-by-step explanationClean Java code with comments🔗 Problem LinkLeetCode: Minimum Absolute Distance Between Mirror PairsTo gain a deeper understanding of the problem, it is highly recommended that you review this similar problem Closest Equal Element Queries here is the link of the article. Both cases follow a nearly identical pattern, and studying the initial example will provide valuable context for the current task.Problem StatementYou are given an integer array nums.A mirror pair (i, j) satisfies:0 ≤ i < j < nums.lengthreverse(nums[i]) == nums[j]👉 Your task is to find:The minimum absolute distance between such pairsIf no mirror pair exists, return -1.ExamplesExample 1Input:nums = [12, 21, 45, 33, 54]Output:1Explanation:(0,1) → reverse(12) = 21 → distance = 1(2,4) → reverse(45) = 54 → distance = 2✔ Minimum = 1Example 2Input:nums = [120, 21]Output:1Example 3Input:nums = [21, 120]Output:-1Key InsightThe core idea is:Instead of checking every pair,store reversed values and match on the fly.❌ Naive Approach (Brute Force)IdeaCheck all pairs (i, j)Reverse nums[i]Compare with nums[j]ComplexityTime: O(n²) ❌Space: O(1)ProblemWith n ≤ 100000, this approach will definitely cause TLE.✅ Optimized Approach (HashMap)IntuitionWhile iterating through the array:Reverse the current numberCheck if this number was already seen as a reversed valueIf yes → we found a mirror pairKey TrickInstead of storing original numbers:👉 Store reversed values as keysThis allows instant lookup.Java Code (With Detailed Comments)import java.util.*;class Solution {// Function to reverse digits of a numberpublic int reverse(int m) {int rev = 0;while (m != 0) {int dig = m % 10; // extract last digitm = m / 10; // remove last digitrev = rev * 10 + dig; // build reversed number}return rev;}public int minMirrorPairDistance(int[] nums) {// Map to store reversed values and their indicesHashMap<Integer, Integer> mp = new HashMap<>();int min = Integer.MAX_VALUE;for (int i = 0; i < nums.length; i++) {// Check if current number exists in map// Meaning: some previous number had reverse equal to thisif (mp.containsKey(nums[i])) {// Calculate distanceint prevIndex = mp.get(nums[i]);min = Math.min(min, Math.abs(i - prevIndex));}// Reverse current numberint revVal = reverse(nums[i]);// Store reversed value with indexmp.put(revVal, i);}// If no pair found, return -1return min == Integer.MAX_VALUE ? -1 : min;}}Step-by-Step Dry RunInput:nums = [12, 21, 45, 33, 54]Execution:IndexValueReverseMap CheckAction01221not foundstore (21 → 0)12112founddistance = 124554not foundstore (54 → 2)33333not foundstore (33 → 3)45445founddistance = 2👉 Minimum = 1Complexity AnalysisTime ComplexityReversing number → O(digits) ≈ O(log n)Loop → O(n)👉 Overall: O(n)Space ComplexityHashMap stores at most n elements👉 O(n)Why This Approach WorksAvoids unnecessary pair comparisonsUses hashing for constant-time lookupProcesses array in a single passKey TakeawaysAlways think of hashing when matching conditions existReversing numbers can convert the problem into a lookup problemAvoid brute force when constraints are largeThis is a classic “store & check” patternCommon Interview PatternThis problem is similar to:Two Sum (hashing)Reverse pairsMatching transformationsConclusionThe Minimum Absolute Distance Between Mirror Pairs problem is a great example of how a simple optimization (using a HashMap) can reduce complexity from O(n²) → O(n).Understanding this pattern will help you solve many similar problems involving:TransformationsMatching conditionsEfficient lookupsFrequently Asked Questions (FAQs)1. Why store reversed value instead of original?Because we want to quickly check if a number matches the reverse of a previous number.2. What if multiple same reversed values exist?The map stores the latest index, ensuring minimum distance is considered.3. Can this be solved without HashMap?Yes, but it will result in inefficient O(n²) time.

LeetCodeArrayJavaMediumHashMap

Quick Sort Algorithm Explained | Java Implementation, Partition Logic & Complexity

IntroductionQuick Sort is one of the most powerful and widely used sorting algorithms in computer science. It follows the Divide and Conquer approach and is known for its excellent average-case performance.What makes Quick Sort special is:It sorts in-place (no extra array required)It is faster in practice than many O(n log n) algorithms like Merge SortIt is heavily used in real-world systems and librariesIn this article, we’ll go deep into:Intuition behind Quick SortPartition logic (most important part)Step-by-step dry runJava implementation with commentsTime complexity analysisCommon mistakes and optimizations🔗 Problem LinkGeeksforGeeks: Quick SortProblem StatementGiven an array arr[], sort it in ascending order using Quick Sort.Requirements:Use Divide and ConquerChoose pivot elementPlace pivot in correct positionElements smaller → left sideElements greater → right sideExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [2, 1, 6, 10, 4, 1, 3, 9, 7]Output:[1, 1, 2, 3, 4, 6, 7, 9, 10]Core Idea of Quick SortPick a pivot → Place it correctly → Recursively sort left & right🔥 Key Insight (Partition is Everything)Quick Sort depends entirely on partitioning:👉 After partition:Pivot is at its correct sorted positionLeft side → smaller elementsRight side → larger elementsIntuition (Visual Understanding)Consider:[4, 1, 3, 9, 7]Step 1: Choose PivotLet’s say pivot = 4Step 2: Rearrange Elements[1, 3] 4 [9, 7]Now:Left → smallerRight → largerStep 3: Apply RecursivelyLeft: [1, 3]Right: [9, 7]Final result:[1, 3, 4, 7, 9]Partition Logic (Most Important)Your implementation uses:Pivot = first elementTwo pointers:i → moves forwardj → moves backwardJava Codeclass Solution { public void quickSort(int[] arr, int low, int high) { // Base case: if array has 1 or 0 elements if (low < high) { // Partition array and get pivot index int pivotInd = partition(arr, low, high); // Sort left part quickSort(arr, low, pivotInd - 1); // Sort right part quickSort(arr, pivotInd + 1, high); } } // Function to swap two elements void swap(int[] arr, int i, int j) { int temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; } private int partition(int[] arr, int low, int high) { int pivot = arr[low]; // choosing first element as pivot int i = low + 1; // start from next element int j = high; // start from end while (i <= j) { // Move i forward until element > pivot while (i <= high && arr[i] <= pivot) { i++; } // Move j backward until element <= pivot while (j >= low && arr[j] > pivot) { j--; } // Swap if pointers haven't crossed if (i < j) { swap(arr, i, j); } } // Place pivot at correct position swap(arr, low, j); return j; // return pivot index }}Step-by-Step Dry RunInput:[4, 1, 3, 9, 7]Execution:Pivot = 4i → moves until element > 4j → moves until element ≤ 4Swaps happen → pivot placed correctlyFinal partition:[1, 3, 4, 9, 7]Complexity AnalysisTime ComplexityCaseComplexityBest CaseO(n log n)Average CaseO(n log n)Worst CaseO(n²)Why Worst Case Happens?When array is:Already sortedReverse sortedPivot always becomes smallest/largest.Space ComplexityO(log n) (recursion stack)❌ Common MistakesWrong partition logicInfinite loops in while conditionsIncorrect pivot placementNot handling duplicates properly⚡ Optimizations1. Random PivotAvoid worst-case:int pivotIndex = low + new Random().nextInt(high - low + 1);swap(arr, low, pivotIndex);2. Median of ThreeChoose better pivot:median(arr[low], arr[mid], arr[high])Quick Sort vs Merge SortFeatureQuick SortMerge Sort link to get moreSpaceO(log n)O(n)SpeedFaster (practical)StableWorst CaseO(n²)O(n log n)Why Quick Sort is PreferredCache-friendlyIn-place sortingFaster in real-world scenariosKey TakeawaysPartition is the heart of Quick SortPivot must be placed correctlyRecursion splits problem efficientlyAvoid worst case using random pivotWhen to Use Quick SortLarge arraysMemory constraints (in-place)Performance-critical applicationsConclusionQuick Sort is one of the most efficient and practical sorting algorithms. Mastering its partition logic is crucial for solving advanced problems and performing well in coding interviews.Understanding how pointers move and how pivot is placed will make this algorithm intuitive and powerful.Frequently Asked Questions (FAQs)1. Is Quick Sort stable?No, it is not stable.2. Why is Quick Sort faster than Merge Sort?Because it avoids extra space and is cache-efficient.3. What is the most important part?👉 Partition logic

MediumJavaSortingQuick SortGeeksofGeeks

LeetCode 1283 — Find the Smallest Divisor Given a Threshold | Binary Search on Answer Explained

🚀 Try This Problem First!Before reading the solution, attempt it yourself on LeetCode — you'll retain the concept far better.🔗 Problem Link: https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold/Understanding the ProblemYou are given an array of integers nums and an integer threshold. You must choose a positive integer divisor, divide every element of the array by it (rounding up to the nearest integer), sum all the results, and make sure that sum is ≤ threshold.Goal: Find the smallest possible divisor that keeps the sum within the threshold.Important detail — Ceiling Division: Every division rounds up, not down. So 7 ÷ 3 = 3 (not 2), and 10 ÷ 2 = 5.Constraints:1 ≤ nums.length ≤ 5 × 10⁴1 ≤ nums[i] ≤ 10⁶nums.length ≤ threshold ≤ 10⁶Two Key Observations (Before Writing a Single Line of Code)Minimum possible divisor: The divisor must be at least 1. Dividing by anything less than 1 isn't a positive integer. So:low = 1Maximum possible divisor: If divisor = max(nums), then every element divided by it gives at most 1 (due to ceiling), so the sum equals nums.length, which is always ≤ threshold (guaranteed by constraints). So:high = max(nums)Our answer lies in the range [1, max(nums)]. This is the search space for Binary Search.Intuition — Why Binary Search?Ask yourself: what happens as the divisor increases?As divisor gets larger, each divided value gets smaller (or stays the same), so the total sum decreases or stays the same. This is a monotonic relationship — the green flag for Binary Search on the Answer.Instead of trying every divisor from 1 to max(nums), we binary search over divisor values. For each candidate mid, we ask:"Does dividing all elements by mid (ceiling) give a sum ≤ threshold?"This feasibility check runs in O(N), making the whole approach O(N log(max(nums))).The Feasibility Check — Ceiling Sum SimulationGiven a divisor mid, compute the sum of ⌈arr[i] / mid⌉ for all elements. If the total sum ≤ threshold, then mid is a valid divisor.In Java, ceiling division of integers is done as:Math.ceil((double) arr[i] / mid)Binary Search StrategyIf canDivide(mid) is true → mid might be the answer, but try smaller. Set ans = mid, high = mid - 1.If canDivide(mid) is false → divisor is too small, increase it. Set low = mid + 1.Dry Run — Example 1 (Step by Step)Input: nums = [1, 2, 5, 9], threshold = 6We start with low = 1 and high = 9 (max element in array).Iteration 1: mid = 1 + (9 - 1) / 2 = 5Compute ceiling sum with divisor 5: ⌈1/5⌉ + ⌈2/5⌉ + ⌈5/5⌉ + ⌈9/5⌉ = 1 + 1 + 1 + 2 = 55 ≤ 6 → ✅ Valid. Record ans = 5, search smaller → high = 4.Iteration 2: mid = 1 + (4 - 1) / 2 = 2Compute ceiling sum with divisor 2: ⌈1/2⌉ + ⌈2/2⌉ + ⌈5/2⌉ + ⌈9/2⌉ = 1 + 1 + 3 + 5 = 1010 > 6 → ❌ Too large. Increase divisor → low = 3.Iteration 3: mid = 3 + (4 - 3) / 2 = 3Compute ceiling sum with divisor 3: ⌈1/3⌉ + ⌈2/3⌉ + ⌈5/3⌉ + ⌈9/3⌉ = 1 + 1 + 2 + 3 = 77 > 6 → ❌ Too large. Increase divisor → low = 4.Iteration 4: mid = 4 + (4 - 4) / 2 = 4Compute ceiling sum with divisor 4: ⌈1/4⌉ + ⌈2/4⌉ + ⌈5/4⌉ + ⌈9/4⌉ = 1 + 1 + 2 + 3 = 77 > 6 → ❌ Too large. Increase divisor → low = 5.Loop ends: low (5) > high (4). Binary search terminates.Output: ans = 5 ✅The Code Implementationclass Solution {/*** Feasibility Check (Helper Function)** Given a divisor 'mid', this function computes the ceiling sum of* all elements divided by 'mid' and checks if it is within threshold.** @param mid - candidate divisor to test* @param arr - input array* @param thresh - the allowed threshold for the sum* @return true if the ceiling division sum <= threshold, false otherwise*/public boolean canDivide(int mid, int[] arr, int thresh) {int sumOfDiv = 0;for (int i = 0; i < arr.length; i++) {// Ceiling division: Math.ceil(arr[i] / mid)// Cast to double to avoid integer division truncationsumOfDiv += Math.ceil((double) arr[i] / mid);}// If total sum is within threshold, this divisor is validreturn sumOfDiv <= thresh;}/*** Main Function — Binary Search on the Answer** Search range: [1, max(nums)]* - low = 1 → smallest valid positive divisor* - high = max(nums) → guarantees every ceil(num/divisor) = 1,* so sum = nums.length <= threshold (always valid)** @param nums - input array* @param threshold - maximum allowed sum after ceiling division* @return smallest divisor such that the ceiling division sum <= threshold*/public int smallestDivisor(int[] nums, int threshold) {int min = 1; // Lower bound: divisor starts at 1int max = Integer.MIN_VALUE; // Will become max(nums)int ans = 1;// Find the upper bound of binary search (max element)for (int a : nums) {max = Math.max(max, a);}// Binary Search over the divisor spacewhile (min <= max) {int mid = min + (max - min) / 2; // Safe midpoint, avoids overflowif (canDivide(mid, nums, threshold)) {// mid is valid — record it and try a smaller divisorans = mid;max = mid - 1;} else {// mid is too small — the sum exceeded threshold, go highermin = mid + 1;}}return ans; // Smallest valid divisor}}Code Walkthrough — Step by StepSetting bounds: We iterate through nums once to find max — this becomes our upper bound high. The lower bound low = 1 because divisors must be positive integers.Binary Search loop: We pick mid = min + (max - min) / 2 as the candidate divisor. We check if using mid as the divisor keeps the ceiling sum ≤ threshold.Feasibility helper (canDivide): For each element, we compute Math.ceil((double) arr[i] / mid) and accumulate the total. The cast to double is critical — without it, Java performs integer division (which truncates, not rounds up).Narrowing the search: If the sum is within threshold → record ans = mid, try smaller (max = mid - 1). If the sum exceeds threshold → divisor is too small, increase it (min = mid + 1).A Critical Bug to Watch Out For — The return min vs return ans TrapIn your original code, the final line was return min instead of return ans. This is a subtle bug. After the loop ends, min has overshot past the answer (it's now ans + 1). Always store the answer in a dedicated variable ans and return that. Using return min would return the wrong result in most cases.Common Mistakes to AvoidWrong lower bound: Setting low = min(nums) instead of low = 1 seems intuitive but is wrong. A divisor smaller than the minimum element is still valid — for example, dividing [5, 9] by 3 gives ⌈5/3⌉ + ⌈9/3⌉ = 2 + 3 = 5, which could be within threshold.Forgetting ceiling division: Using arr[i] / mid (integer division, which truncates) instead of Math.ceil((double) arr[i] / mid) is wrong. The problem explicitly states results are rounded up.Returning min instead of ans: After the binary search loop ends, min > max, meaning min has already gone past the valid answer. Always return the stored ans.Integer overflow in midpoint: Always use mid = min + (max - min) / 2 instead of (min + max) / 2. When both values are large (up to 10⁶), their sum can overflow an int.Complexity AnalysisTime Complexity: O(N × log(max(nums)))Binary search runs over [1, max(nums)] → at most log₂(10⁶) ≈ 20 iterations.Each iteration calls canDivide which is O(N).Total: O(N log M) where M = max(nums).Space Complexity: O(1) No extra data structures — only a few integer variables are used throughout.How This Relates to LeetCode 1011This problem and LeetCode 1011 (Ship Packages Within D Days) are almost identical in structure:🔗 LeetCode 1011 #Search space: [max(weights), sum(weights)]Feasibility check: Can we ship in ≤ D days?Monotonic property: More capacity → fewer daysGoal: Minimize capacityLeetCode 1283Search space: [1, max(nums)]Feasibility check: Is ceiling sum ≤ threshold?Monotonic property: Larger divisor → smaller sumGoal: Minimize divisorOnce you deeply understand one, the other takes minutes to solve.Similar Problems (Same Pattern — Binary Search on Answer)LeetCode 875 — Koko Eating Bananas [ Blog is also avaliable on this - Read Now ]LeetCode 1011 — Capacity To Ship Packages Within D Days [ Blog is also avaliable on this - Read Now ]LeetCode 410 — Split Array Largest SumLeetCode 2064 — Minimized Maximum of Products Distributed to Any StoreAll follow the same template: identify a monotonic answer space, write an O(N) feasibility check, and binary search over it.Key Takeaways✅ When the problem asks "find the minimum value such that a condition holds" — think Binary Search on the Answer.✅ The lower bound is the most constrained valid value (1 here, since divisors must be positive).✅ The upper bound is the least constrained valid value (max element, guarantees sum = length ≤ threshold).✅ Ceiling division in Java requires casting to double: Math.ceil((double) a / b).✅ Always store the answer in a separate ans variable — never return min or max directly after a binary search loop.Happy Coding! Smash that upvote if this helped you crack the pattern. 🚀

LeetCodeBinary SearchMediumJavaBinary Search on AnswerArraysCeiling Division

LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

IntroductionThe Letter Case Permutation problem is a classic example of recursion and backtracking, often asked in coding interviews and frequently searched by learners preparing for platforms like LeetCode.This problem helps in understanding:Decision-making at each stepRecursive branchingString manipulationIn this article, we’ll break down the intuition, visualize the decision process using your decision tree, and implement an efficient Java solution.🔗 Problem LinkLeetCode: Letter Case PermutationProblem StatementGiven a string s, you can transform each alphabet character into:LowercaseUppercaseDigits remain unchanged.👉 Return all possible strings formed by these transformations.ExamplesExample 1Input:s = "a1b2"Output:["a1b2","a1B2","A1b2","A1B2"]Example 2Input:s = "3z4"Output:["3z4","3Z4"]Key InsightAt each character:If it's a digit → only one choiceIf it's a letter → two choices:lowercase OR uppercaseSo total combinations:2^(number of letters)Intuition (Using Your Decision Tree)For input: "a1b2"Start from index 0: "" / \ "a" "A" | | "a1" "A1" / \ / \ "a1b" "a1B" "A1b" "A1B" | | | | "a1b2" "a1B2" "A1b2" "A1B2"Understanding the TreeAt 'a' → branch into 'a' and 'A''1' → no branching (digit)'b' → again branching'2' → no branching📌 Leaf nodes = final answersApproach: Recursion + BacktrackingIdeaTraverse the string character by characterIf digit → move forwardIf letter → branch into:lowercaseuppercaseJava Codeimport java.util.*;class Solution { // List to store all results List<String> lis = new ArrayList<>(); public void solve(String s, int ind, String ans) { // Base case: reached end of string if (ind == s.length()) { lis.add(ans); // store generated string return; } char ch = s.charAt(ind); // If character is a digit → only one option if (ch >= '0' && ch <= '9') { solve(s, ind + 1, ans + ch); } else { // Choice 1: convert to lowercase solve(s, ind + 1, ans + Character.toLowerCase(ch)); // Choice 2: convert to uppercase solve(s, ind + 1, ans + Character.toUpperCase(ch)); } } public List<String> letterCasePermutation(String s) { solve(s, 0, ""); // start recursion return lis; }}Step-by-Step ExecutionFor "a1b2":Start → ""'a' → "a", "A"'1' → "a1", "A1"'b' → "a1b", "a1B", "A1b", "A1B"'2' → final stringsComplexity AnalysisTime Complexity: O(2^n)(n = number of letters)Space Complexity: O(2^n)(for storing results)Why This Approach WorksRecursion explores all possibilitiesEach letter creates a branching pointDigits pass through unchangedBacktracking ensures all combinations are generatedKey TakeawaysThis is a binary decision recursion problemLetters → 2 choicesDigits → 1 choiceDecision tree directly maps to recursionPattern similar to:SubsetsPermutations with conditionsWhen This Problem Is AskedCommon in:Coding interviewsRecursion/backtracking roundsString manipulation problemsConclusionThe Letter Case Permutation problem is a perfect example of how recursion can be used to explore all possible combinations efficiently.Once the decision tree is clear, the implementation becomes straightforward. This pattern is widely used in many advanced problems, making it essential to master.Frequently Asked Questions (FAQs)1. Why don’t digits create branches?Because they have only one valid form.2. What is the main concept used?Recursion with decision-making (backtracking).3. Can this be solved iteratively?Yes, using BFS or iterative expansion, but recursion is more intuitive.

LeetCodeMediumJavaRecursion

LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

IntroductionSome problems test complex algorithms, while others focus on fundamental concepts done right.LeetCode 3783 – Mirror Distance of an Integer falls into the second category.This problem is simple yet important because it builds understanding of:Digit manipulationReversing numbersMathematical operationsIn this article, we’ll break down the problem in a clean and intuitive way, along with an optimized Java solution.🔗 Problem LinkLeetCode: Mirror Distance of an IntegerProblem StatementYou are given an integer n.The mirror distance is defined as:| n - reverse(n) |Where:reverse(n) = number formed by reversing digits of n|x| = absolute value👉 Return the mirror distance.ExamplesExample 1Input:n = 25Output:27Explanation:reverse(25) = 52|25 - 52| = 27Example 2Input:n = 10Output:9Explanation:reverse(10) = 1|10 - 1| = 9Example 3Input:n = 7Output:0Key InsightThe problem consists of two simple steps:1. Reverse the number2. Take absolute differenceIntuitionLet’s take an example:n = 120Step 1: Reverse digits120 → 021 → 21👉 Leading zeros are ignored automatically.Step 2: Compute difference|120 - 21| = 99ApproachStep-by-StepExtract digits using % 10Build reversed numberUse Math.abs() for final resultJava Codeclass Solution { // Function to reverse a number public int reverse(int k) { int rev = 0; while (k != 0) { int dig = k % 10; // get last digit k = k / 10; // remove last digit rev = rev * 10 + dig; // build reversed number } return rev; } public int mirrorDistance(int n) { // Calculate mirror distance return Math.abs(n - reverse(n)); }}Dry RunInput:n = 25Execution:Reverse → 52Difference → |25 - 52| = 27Complexity AnalysisTime ComplexityReversing number → O(d)(d = number of digits)👉 Overall: O(log n)Space Complexity👉 O(1) (no extra space used)Why This WorksDigit extraction ensures correct reversalLeading zeros automatically removedAbsolute difference ensures positive resultEdge Cases to ConsiderSingle digit → result = 0Numbers ending with zero (e.g., 10 → 1)Large numbers (up to 10⁹)Key TakeawaysSimple math problems can test core logicDigit manipulation is a must-know skillAlways handle leading zeros carefullyUse built-in functions like Math.abs() effectivelyReal-World RelevanceConcepts used here are helpful in:Number transformationsPalindrome problemsReverse integer problemsMathematical algorithmsConclusionThe Mirror Distance of an Integer problem is a great example of combining basic operations to form a meaningful solution.While simple, it reinforces important programming fundamentals that are widely used in more complex problems.Frequently Asked Questions (FAQs)1. What happens to leading zeros in reverse?They are automatically removed when stored as an integer.2. Can this be solved using strings?Yes, but integer-based approach is more efficient.3. What is the best approach?Using arithmetic operations (% and /) is optimal.

EasyArrayReverse NumberLeetCodeJava

LeetCode 496: Next Greater Element I — Java Solution With All Approaches Explained

IntroductionLeetCode 496 Next Greater Element I is your gateway into one of the most important and frequently tested patterns in coding interviews — the Monotonic Stack. Once you understand this problem deeply, problems like Next Greater Element II, Daily Temperatures, and Largest Rectangle in Histogram all start to make sense.Here is the Link of Question -: LeetCode 496This article covers plain English explanation, real life analogy, brute force and optimal approaches in Java, detailed dry runs, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You have two arrays. nums2 is the main array. nums1 is a smaller subset of nums2. For every element in nums1, find its position in nums2 and look to the right — what is the first element that is strictly greater? If none exists, return -1.Example:nums1 = [4,1,2], nums2 = [1,3,4,2]For 4 in nums2: elements to its right are [2], none greater → -1For 1 in nums2: elements to its right are [3,4,2], first greater is 3For 2 in nums2: no elements to its right → -1Output: [-1, 3, -1]Real Life Analogy — The Taller Person in a QueueImagine you are standing in a queue and you want to know — who is the first person taller than you standing somewhere behind you in the line?You look to your right one by one until you find someone taller. That person is your "next greater element." If everyone behind you is shorter, your answer is -1.Now imagine doing this for every person in the queue efficiently — instead of each person looking one by one, you use a smart system that processes everyone in a single pass. That smart system is the Monotonic Stack.Approach 1: Brute Force (Beginner Friendly)The IdeaFor each element in nums1, find its position in nums2, then scan everything to its right to find the first greater element.javapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { int found = -1; boolean seen = false; for (int j = 0; j < nums2.length; j++) { if (seen && nums2[j] > nums1[i]) { found = nums2[j]; break; } if (nums2[j] == nums1[i]) { seen = true; } } ans[i] = found; } return ans;}Simple to understand but inefficient. For each element in nums1 you scan the entire nums2.Time Complexity: O(m × n) — where m = nums1.length, n = nums2.length Space Complexity: O(1) — ignoring output arrayThis works for the given constraints (n ≤ 1000) but will not scale for larger inputs. The follow-up specifically asks for better.Approach 2: Monotonic Stack + HashMap (Optimal Solution) ✅The IdeaThis is your solution and the best one. The key insight is — instead of answering queries for nums1 elements one by one, precompute the next greater element for every element in nums2 and store results in a HashMap. Then answering nums1 queries becomes just a HashMap lookup.To precompute efficiently, we use a Monotonic Stack — a stack that always stays in decreasing order from bottom to top.Why traverse from right to left? Because we are looking for the next greater element to the right. Starting from the right end, by the time we process any element, we have already seen everything to its right.Algorithm:Traverse nums2 from right to leftMaintain a stack of "candidate" next greater elementsFor current element, pop all stack elements that are smaller or equal — they can never be the next greater for anything to the leftIf stack is empty → next greater is -1, else → top of stack is the answerPush current element onto stackStore result in HashMapLook up each nums1 element in the HashMapjavapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { Stack<Integer> st = new Stack<>(); HashMap<Integer, Integer> mp = new HashMap<>(); // Precompute next greater for every element in nums2 for (int i = nums2.length - 1; i >= 0; i--) { // Pop elements smaller than current — they are useless while (!st.empty() && nums2[i] >= st.peek()) { st.pop(); } // Top of stack is the next greater, or -1 if empty mp.put(nums2[i], st.empty() ? -1 : st.peek()); // Push current element as a candidate for elements to its left st.push(nums2[i]); } // Answer queries for nums1 int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { ans[i] = mp.get(nums1[i]); } return ans;}Why Is the Stack Monotonic?After popping smaller elements, the stack always maintains a decreasing order from bottom to top. This means the top of the stack at any point is always the smallest element seen so far to the right — making it the best candidate for "next greater."This is called a Monotonic Decreasing Stack and it is the heart of this entire pattern.Detailed Dry Run — nums2 = [1,3,4,2]We traverse from right to left:i = 3, nums2[3] = 2Stack is emptyNo elements to popStack empty → mp.put(2, -1)Push 2 → stack: [2]i = 2, nums2[2] = 4Stack top is 2, and 4 >= 2 → pop 2 → stack: []Stack empty → mp.put(4, -1)Push 4 → stack: [4]i = 1, nums2[1] = 3Stack top is 4, and 3 < 4 → stop poppingStack not empty → mp.put(3, 4)Push 3 → stack: [4, 3]i = 0, nums2[0] = 1Stack top is 3, and 1 < 3 → stop poppingStack not empty → mp.put(1, 3)Push 1 → stack: [4, 3, 1]HashMap after processing nums2:1 → 3, 2 → -1, 3 → 4, 4 → -1Now answer nums1 = [4, 1, 2]:nums1[0] = 4 → mp.get(4) = -1nums1[1] = 1 → mp.get(1) = 3nums1[2] = 2 → mp.get(2) = -1✅ Output: [-1, 3, -1]Time Complexity: O(n + m) — n for processing nums2, m for answering nums1 queries Space Complexity: O(n) — HashMap and Stack both store at most n elementsWhy Pop Elements Smaller Than Current?This is the most important thing to understand in this problem. When we are at element x and we see a stack element y where y < x, we pop y. Why?Because x is to the right of everything we will process next (we go right to left), and x is already greater than y. So for any element to the left of x, if they are greater than y, they are definitely also greater than y — meaning y would never be the "next greater" for anything. It becomes useless and gets discarded.This is why the stack stays decreasing — every element we keep is a legitimate candidate for being someone's next greater element.How This Differs From Previous Stack ProblemsYou have been solving stack problems with strings — backspace, stars, adjacent duplicates. This problem introduces the stack for arrays and searching, which is a step up in complexity.The pattern shift is: instead of using the stack to build or reduce a string, we use it to maintain a window of candidates while scanning. This monotonic stack idea is what powers many hard problems like Largest Rectangle in Histogram, Trapping Rain Water, and Daily Temperatures.Common Mistakes to AvoidUsing >= instead of > in the pop condition We pop when nums2[i] >= st.peek(). If you use only >, equal elements stay on the stack and give wrong answers since we need strictly greater.Traversing left to right instead of right to left Going left to right makes it hard to know what is to the right of the current element. Always go right to left for "next greater to the right" problems.Forgetting HashMap lookup handles the nums1 query efficiently Some people recompute inside the nums1 loop. Always precompute in a HashMap — that is the whole point of the optimization.FAQs — People Also AskQ1. What is a Monotonic Stack and why is it used in LeetCode 496? A Monotonic Stack is a stack that maintains its elements in either increasing or decreasing order. In LeetCode 496, a Monotonic Decreasing Stack is used to efficiently find the next greater element for every number in nums2 in a single pass, reducing time complexity from O(n²) to O(n).Q2. What is the time complexity of LeetCode 496 optimal solution? The optimal solution runs in O(n + m) time where n is the length of nums2 and m is the length of nums1. Processing nums2 takes O(n) and answering all nums1 queries via HashMap takes O(m).Q3. Why do we traverse nums2 from right to left? Because we are looking for the next greater element to the right. Starting from the right end means by the time we process any element, we have already seen all elements to its right and stored them in the stack as candidates.Q4. Is LeetCode 496 asked in coding interviews? Yes, it is commonly used as an introduction to the Monotonic Stack pattern at companies like Amazon, Google, and Microsoft. It often appears as a warmup before harder follow-ups like Next Greater Element II (circular array) or Daily Temperatures.Q5. What is the difference between LeetCode 496 and LeetCode 739 Daily Temperatures? Both use the same Monotonic Stack pattern. In 496 you return the actual next greater value. In 739 you return the number of days (index difference) until a warmer temperature. The core stack logic is identical.Similar LeetCode Problems to Practice Next739. Daily Temperatures — Medium — days until warmer temperature, same pattern503. Next Greater Element II — Medium — circular array version901. Online Stock Span — Medium — monotonic stack with span counting84. Largest Rectangle in Histogram — Hard — classic monotonic stack42. Trapping Rain Water — Hard — monotonic stack or two pointerConclusionLeetCode 496 Next Greater Element I is the perfect entry point into the Monotonic Stack pattern. The brute force is easy to understand, but the real learning happens when you see why the stack stays decreasing and how that single insight collapses an O(n²) problem into O(n).Once you truly understand why we pop smaller elements and how the HashMap bridges the gap between precomputation and query answering, the entire family of Next Greater Element problems becomes approachable — including the harder circular and histogram variants.

ArrayStackMonotonic StackHashMapEasyLeetCode

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium

Check if Binary String Has at Most One Segment of Ones – Java Solution (LeetCode 1784)

Try the QuestionBefore reading the solution, try solving the problem yourself:👉 https://leetcode.com/problems/check-if-binary-string-has-at-most-one-segment-of-ones/Attempting the problem first helps build your problem-solving intuition, which is essential for coding interviews.Problem DescriptionYou are given a binary string s, which means the string contains only two characters:'0' and '1'The string does not contain leading zeros, meaning the first character is always 1.Your task is to determine whether the string contains at most one contiguous segment of 1s.If the string has only one continuous group of 1s, return:trueIf the string contains multiple separated groups of 1s, return:falseUnderstanding the Problem ClearlyThe key phrase in the problem is:"at most one contiguous segment of ones"A segment means a continuous block of characters without interruption.For example:111This is one segment of ones.But if 1s are separated by 0s and appear again later, then there are multiple segments.Example WalkthroughExample 1Inputs = "1001"Structure1 0 0 1Here we have:Segment 1 → "1"Segment 2 → "1"There are two separate segments of ones, which violates the condition.OutputfalseExample 2Inputs = "110"Structure1 1 0There is only one continuous block of ones.OutputtrueVisual IntuitionThe string is valid only if it follows this pattern:111111000000Meaning:[One block of 1s] + [any number of 0s]But the string becomes invalid if we see something like:111001011Because here:1s → stop → 0 → start again → 1Which means two segments of ones exist.Key ObservationSince the string starts with 1, the valid structure must look like:111...111000...000Once we encounter the first 0, we should never see 1 again.If we ever see:0 → followed by → 1then a new segment of ones has started, which means the answer is false.Intuition Behind the SolutionThe logic becomes very simple:Traverse the string from left to right.Keep track of the previous character.If we ever see the pattern:0 followed by 1then it means a new segment of ones has started, so return false.If we finish scanning the string without seeing this pattern, the string is valid.Java Implementationclass Solution { public boolean checkOnesSegment(String s) { if(s.length() == 1) return true; if(s.length() == 2 && s.charAt(1) == '1'){ return true; } if(s.length() == 2 && s.charAt(1) == '0'){ return true; } char prev = '0'; for(int i = 0; i < s.length() - 1; i++){ prev = s.charAt(i); if(s.charAt(i+1) == '1' && prev == '0'){ return false; } } return true; }}Step-by-Step Code Explanation1. Handle Small Edge CasesIf the string length is 1:"1"There is obviously only one segment, so we return:trueIf the string length is 2, both cases are valid:"11""10"Because neither creates multiple segments of ones.2. Traverse the StringWe loop through the string:for(int i = 0; i < s.length() - 1; i++)At every step, we compare:current characternext character3. Detect the Invalid PatternWe check this condition:if(s.charAt(i+1) == '1' && prev == '0')This means we found:0 → 1Which indicates a new segment of ones has started, so we return:false4. If No Violation is FoundIf we finish the loop without encountering the pattern:0 → 1then the string contains only one contiguous segment of ones, so we return:trueTime ComplexityO(n)Where:n = length of the stringWe traverse the string only once.Space ComplexityO(1)No extra space is used except a few variables.A Simpler Observation (Bonus Insight)A simpler trick for this problem is checking if the string contains:"01"Why?Because:111000 → validBut:1110011contains:01 → followed by another 1Which means a second segment of ones exists.Key Takeaways✔ Binary strings contain only 0 and 1✔ A segment means a continuous block✔ Valid strings contain only one block of ones✔ The invalid pattern is 0 followed by 1✔ The solution works with one linear scanFinal ThoughtsAlthough this problem is categorized as easy, it tests an important concept:Pattern detection while traversing strings.Problems like this are common in interviews because they evaluate:Logical reasoningEdge case handlingString traversal techniquesMastering such problems helps build a strong foundation for more complex string and pattern-matching algorithms.

LeetCodeJavaString ProblemsBinary StringsEasy

Reverse a Stack — GFG Problem Solved (3 Approaches Explained)

What Is This Problem About?This is a classic stack problem from GeeksForGeeks — "Reverse a Stack" (Medium | 4 Points). You can find it on GFG by Reverse a Stack.You are given a stack. Your job is simple — reverse it. The element that was at the bottom should now be at the top, and vice versa.Example:Input: [1, 2, 3, 4] → bottom to top, so 4 is on topOutput: [1, 2, 3, 4] → after reversal, 1 is on topWait — the input and output look the same? That is because GFG displays the result top to bottom after reversal. So after reversing, 1 comes to the top, and printing top to bottom gives [1, 2, 3, 4]. The stack is indeed reversed internally.Approach 1 — Using Two Extra StacksIntuition: Pop everything from the original stack into Stack 1 — this reverses the order once. Then pop everything from Stack 1 into Stack 2 — this reverses it again, back to original order. Now push everything from Stack 2 back into the original stack. The result? The original stack is reversed.Why does this work? Two reversals cancel each other out to give you... wait, that sounds wrong. Let us trace it:Original: [1, 2, 3, 4] → top is 4After → S1: [4, 3, 2, 1] → top is 1After → S2: [1, 2, 3, 4] → top is 4Push S2 back → st: [1, 2, 3, 4] → top is 4Hmm, that brings it back to the same thing. This approach with two stacks actually does NOT work correctly — it ends up restoring the original order. This is why the approach was commented out in the original code. Good observation to catch in an interview.Lesson: Two full reversals = no change. One reversal = what we want. Keep this in mind.Approach 2 — Using an ArrayList (Clean & Simple) ✅Intuition: Pop all elements from the stack into an ArrayList. At this point, the ArrayList holds elements in reverse order (because popping reverses). Then push them back from index 0 to end. This is the clean, working solution.Stack: [1, 2, 3, 4] → top is 4Pop into ArrayList: [4, 3, 2, 1]Push back index 0→end: push 4 → st: [4] push 3 → st: [4, 3] push 2 → st: [4, 3, 2] push 1 → st: [4, 3, 2, 1] → top is now 1 ✓The stack is now reversed. 1 is on top.public static void reverseStack(Stack<Integer> st) { if (st.empty()) return; ArrayList<Integer> list = new ArrayList<>(); // Pop all elements — goes in reverse order into list while (!st.empty()) { list.add(st.pop()); } // Push back from index 0 — restores in reversed order for (int i = 0; i < list.size(); i++) { st.push(list.get(i)); }}Time Complexity: O(n) — one pass to pop, one pass to push.Space Complexity: O(n) — for the ArrayList.Why this works: When you pop all elements into a list, the top element (last inserted) goes to index 0. When you push back from index 0, that element goes in first and ends up at the bottom. The bottom element (first inserted) was popped last, sits at the end of the list, and gets pushed last — ending up on top. That is a perfect reversal.Approach 3 — Using Recursion (No Extra Space) ✅This is the most elegant approach and the one interviewers love to ask about.Intuition: Use two recursive functions:reverseStack — pops the top element, recursively reverses the rest, then inserts the popped element at the bottom.insertAtBottom — holds all elements out while inserting one element at the very bottom, then restores everything.// Insert an item at the bottom of the stackstatic void insertAtBottom(Stack<Integer> st, int item) { if (st.empty()) { st.push(item); return; } int top = st.pop(); insertAtBottom(st, item); st.push(top);}// Reverse the stackpublic static void reverseStack(Stack<Integer> st) { if (st.empty()) return; int top = st.pop(); reverseStack(st); // reverse remaining stack insertAtBottom(st, top); // put popped element at the bottom}```**Dry Run with [1, 2, 3]:**```reverseStack([1,2,3]) → pop 3, reverseStack([1,2]) reverseStack([1,2]) → pop 2, reverseStack([1]) reverseStack([1]) → pop 1, reverseStack([]) base case → return insertAtBottom([], 1) → push 1 → [1] insertAtBottom([1], 2) → 2 < 1? no → pop 1, insert 2, push 1 → [2,1]insertAtBottom([2,1], 3) → pop 1, pop 2, push 3, push 2, push 1 → [3,2,1]Final stack top → 3... wait, let us recheck display.Top is 3, which was originally at bottom. ✓ Reversed!Time Complexity: O(n²) — for each of n elements, insertAtBottom takes O(n).Space Complexity: O(n) — recursive call stack.Which Approach Should You Use?ApproachTimeSpaceSimplicityInterview ValueTwo Extra Stacks❌ Does not workO(n)SimpleLowArrayListO(n)O(n)Very EasyMediumRecursionO(n²)O(n)ModerateHighFor a coding interview, always mention the recursive approach — it shows you understand stack mechanics deeply. For production code, the ArrayList approach is cleaner and faster.Key TakeawayReversing a stack is fundamentally about understanding LIFO. Because a stack only allows access from the top, you need a systematic way to invert the order — whether that is using auxiliary storage like an ArrayList, or using the call stack itself via recursion. Both are valid. Both teach you something different about how stacks behave.The next time you see a problem that involves reversing, reordering, or inserting at the bottom of a stack — your first instinct should be recursion with insertAtBottom. It is a pattern that appears again and again in DSA.And if you want to understand Stack from Scratch?If you are just getting started with stacks or want a complete reference — I have written a detailed in-depth guide on the Stack Data Structure in Java covering everything from what a stack is, how LIFO works, all three implementations (Array, ArrayList, LinkedList), every operation explained with code, time complexity, advantages, disadvantages, real-world use cases, and six practice problems with full solutions.Check it out here → Stack Data Structure in Java: The Complete GuideIt is the perfect companion to this problem walkthrough — start there if you want the full picture, then come back here for the problem-solving side.

StackProblemsJavaMediumGeeksForGeeksReverseStack

Sort a Stack Using Recursion - Java Solution Explained

IntroductionSort a Stack is one of those problems that feels impossible at first — you only have access to the top of a stack, you cannot index into it, and the only tools you have are push, pop, and peek. How do you sort something with such limited access?The answer is recursion. And this problem is a perfect example of how recursion can do something elegant that feels like it should require much more complex logic.You can find this problem here — Sort a Stack — GeeksForGeeksThis article explains the complete intuition, both recursive functions in detail, a thorough dry run, all approaches, and complexity analysis.What Is the Problem Really Asking?You have a stack of integers. Sort it so that the smallest element is at the bottom and the largest element is at the top.Input: [41, 3, 32, 2, 11] (11 is at top)Output: [41, 32, 11, 3, 2] (2 is at top, 41 at bottom)Wait — if smallest is at bottom and largest at top, then popping gives you the smallest first. So the stack is sorted in ascending order from top to bottom when you pop.The constraints make this interesting — you can only use stack operations (push, pop, peek, isEmpty). No arrays, no sorting algorithms directly on the data, no random access.Real Life Analogy — Sorting a Stack of BooksImagine a stack of books of different thicknesses on your desk. You want the thinnest book on top and thickest at the bottom. But you can only take from the top.Here is what you do — pick up books one by one from the top and set them aside. Once you have removed enough, place each book back in its correct position. If the book you are placing is thicker than what is currently on top, slide the top books aside temporarily, place the thick book down, then put the others back.That is exactly what the recursive sort does — take elements out one by one, and insert each back into the correct position.The Core Idea — Two Recursive Functions Working TogetherThe solution uses two recursive functions that work hand in hand:sortStack(st) — removes elements one by one until the stack is empty, then inserts each back using insertinsert(st, temp) — inserts a single element into its correct sorted position in an already-sorted stackThink of it like this — sortStack is the manager that empties the stack recursively, and insert is the worker that places each element in the right position on the way back.Function 1: sortStack — The Main Recursive Driverpublic void sortStack(Stack<Integer> st) { // base case — empty or single element is already sorted if (st.empty() || st.size() == 1) return; // Step 1: remove the top element int temp = st.pop(); // Step 2: recursively sort the remaining stack sortStack(st); // Step 3: insert the removed element in correct position insert(st, temp);}How to Think About ThisThe leap of faith here — trust that sortStack correctly sorts whatever is below. After the recursive call, the remaining stack is perfectly sorted. Now your only job is to insert temp (the element you removed) into its correct position in that sorted stack.This is the classic "solve smaller, fix current" recursion pattern. Reduce the problem by one element, trust recursion for the rest, then fix the current element's position.Function 2: insert — Placing an Element in Sorted Positionvoid insert(Stack<Integer> st, int temp) { // base case 1: stack is empty — just push // base case 2: top element is smaller or equal — push on top if (st.empty() || st.peek() <= temp) { st.push(temp); return; } // top element is greater than temp // temp needs to go below the top element int val = st.pop(); // temporarily remove the top insert(st, temp); // try inserting temp deeper st.push(val); // restore the removed element on top}How to Think About ThisYou want to insert temp in sorted order. The stack is already sorted (largest on top). So:If the top is smaller than or equal to temp → temp belongs on top. Push it.If the top is greater than temp → temp needs to go below the top. So pop the top temporarily, try inserting temp deeper, then push the top back.This is the same "pop, recurse deeper, push back" pattern you saw in the Baseball Game problem — when you need to access elements below the top without permanent removal.Complete Solutionclass Solution { // insert temp into its correct position in sorted stack void insert(Stack<Integer> st, int temp) { if (st.empty() || st.peek() <= temp) { st.push(temp); return; } int val = st.pop(); insert(st, temp); st.push(val); } // sort the stack using recursion public void sortStack(Stack<Integer> st) { if (st.empty() || st.size() == 1) return; int temp = st.pop(); // remove top sortStack(st); // sort remaining insert(st, temp); // insert top in correct position }}Detailed Dry Run — st = [3, 2, 1] (1 at top)Let us trace every single call carefully.sortStack calls (going in):sortStack([3, 2, 1]) temp = 1, remaining = [3, 2] call sortStack([3, 2]) temp = 2, remaining = [3] call sortStack([3]) size == 1, return ← base case now insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 ← base case push val=3 back stack is now [2, 3] (3 on top) sortStack([3,2]) done → stack = [2, 3] now insert(st=[2,3], temp=1) peek=3 > 1, pop val=3 insert(st=[2], temp=1) peek=2 > 1, pop val=2 insert(st=[], temp=1) st empty, push 1 ← base case push val=2 back stack = [1, 2] push val=3 back stack = [1, 2, 3] (3 on top)sortStack done → stack = [1, 2, 3]✅ Final stack (3 on top, 1 at bottom): largest at top, smallest at bottom — correctly sorted!Detailed Dry Run — st = [41, 3, 32, 2, 11] (11 at top)Let us trace at a higher level to see the pattern:sortStack calls unwinding (popping phase):sortStack([41, 3, 32, 2, 11]) pop 11, sortStack([41, 3, 32, 2]) pop 2, sortStack([41, 3, 32]) pop 32, sortStack([41, 3]) pop 3, sortStack([41]) base case — return insert([41], 3) → [3, 41] (41 on top) insert([3, 41], 32) → [3, 32, 41] (41 on top) insert([3, 32, 41], 2) → [2, 3, 32, 41] (41 on top) insert([2, 3, 32, 41], 11) → [2, 3, 11, 32, 41] (41 on top)✅ Final: [2, 3, 11, 32, 41] with 41 at top, 2 at bottom — correct!Let us verify the insert([3, 32, 41], 2) step in detail since it involves multiple pops:insert(st=[3, 32, 41], temp=2) peek=41 > 2, pop val=41 insert(st=[3, 32], temp=2) peek=32 > 2, pop val=32 insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 push val=3 back → [2, 3] push val=32 back → [2, 3, 32] push val=41 back → [2, 3, 32, 41]Beautiful chain of pops followed by a chain of pushes — recursion handling what would be very messy iterative logic.Approach 2: Using an Additional Stack (Iterative)If recursion is not allowed or you want an iterative solution, you can use a second stack.public void sortStack(Stack<Integer> st) { Stack<Integer> tempStack = new Stack<>(); while (!st.empty()) { int curr = st.pop(); // move elements from tempStack back to st // until we find the right position for curr while (!tempStack.empty() && tempStack.peek() > curr) { st.push(tempStack.pop()); } tempStack.push(curr); } // move everything back to original stack while (!tempStack.empty()) { st.push(tempStack.pop()); }}How This WorkstempStack is maintained in sorted order (smallest on top). For each element popped from st, we move elements from tempStack back to st until we find the right position, then push. At the end, transfer everything back.Time Complexity: O(n²) — same as recursive approach Space Complexity: O(n) — explicit extra stackApproach 3: Using Collections.sort (Cheat — Not Recommended)public void sortStack(Stack<Integer> st) { List<Integer> list = new ArrayList<>(st); Collections.sort(list); // ascending st.clear(); for (int num : list) { st.push(num); // smallest pushed first = smallest at bottom }}This gives the right answer but completely defeats the purpose of the problem. Never use this in an interview — it shows you do not understand the problem's intent.Time Complexity: O(n log n) Space Complexity: O(n)Approach ComparisonApproachTimeSpaceAllowed in InterviewCode ComplexityRecursive (Two Functions)O(n²)O(n)✅ Best answerMediumIterative (Two Stacks)O(n²)O(n)✅ Good alternativeMediumCollections.sortO(n log n)O(n)❌ Defeats purposeEasyTime and Space Complexity AnalysisRecursive ApproachTime Complexity: O(n²)For each of the n elements popped by sortStack, the insert function may traverse the entire stack to find the correct position — O(n) per insert. Total: O(n) × O(n) = O(n²).This is similar to insertion sort — and in fact, this recursive approach IS essentially insertion sort implemented on a stack using recursion.Space Complexity: O(n)No extra data structure is used. But the call stack holds up to n frames for sortStack and up to n additional frames for insert. In the worst case, total recursion depth is O(n) + O(n) = O(n) space.The Connection to Insertion SortIf you have studied sorting algorithms, this solution will look very familiar. It is Insertion Sort implemented recursively on a stack:sortStack is like the outer loop — take one element at a timeinsert is like the inner loop — find the correct position by comparing and shiftingThe key difference from array-based insertion sort is that "shifting" in an array is done by moving elements right. Here, "shifting" is done by temporarily popping elements off the stack, inserting at the right depth, then pushing back. Recursion handles the "shift" naturally.Common Mistakes to AvoidWrong base case in insert The base case is st.empty() || st.peek() <= temp. Both conditions are needed. Without st.empty(), you call peek() on an empty stack and get an exception. Without st.peek() <= temp, you never stop even when you find the right position.Using < instead of <= in insert Using strictly less than means equal elements get treated as "wrong position" and cause unnecessary recursion. Using <= correctly handles duplicates — equal elements stay in their current relative order.Calling sortStack instead of insert inside insert insert should only call itself recursively. Calling sortStack inside insert re-sorts an already-sorted stack — completely wrong and causes incorrect results.Not pushing val back after the recursive insert call This is the most common bug. After insert(st, temp) places temp in the correct position, you must push val back on top. Forgetting this loses elements from the stack permanently.FAQs — People Also AskQ1. How do you sort a stack without using extra space in Java? Using recursion — the call stack itself serves as temporary storage. sortStack removes elements one by one and insert places each back in its correct sorted position. No explicit extra data structure is needed, but O(n) implicit call stack space is used.Q2. What is the time complexity of sorting a stack using recursion? O(n²) in all cases — for each of the n elements, the insert function traverses up to n elements to find the correct position. This is equivalent to insertion sort applied to a stack.Q3. Can you sort a stack without recursion? Yes — using a second auxiliary stack. Pop elements from the original stack one by one and insert each into the correct position in the second stack by temporarily moving elements back. Transfer everything back to the original stack at the end.Q4. Why does the insert function need to push val back after the recursive call? Because the goal of insert is to place temp in the correct position WITHOUT losing any existing elements. When we pop val temporarily to go deeper, we must restore it after temp has been placed. Not restoring it means permanently losing that element from the stack.Q5. Is sorting a stack asked in coding interviews? Yes, it appears frequently at companies like Amazon, Adobe, and in platforms like GeeksForGeeks and InterviewBit. It tests whether you understand recursion deeply enough to use it as a mechanism for reordering — not just for computation.Similar Problems to Practice NextDelete Middle Element of a Stack — use same recursive pop-recurse-push patternReverse a Stack — very similar recursive approach, great warmup84. Largest Rectangle in Histogram — advanced stack problem946. Validate Stack Sequences — stack simulation150. Evaluate Reverse Polish Notation — stack with operationsConclusionSort a Stack Using Recursion is a beautiful problem that demonstrates the true power of recursion — using the call stack itself as temporary storage to perform operations that would otherwise require extra data structures.The key insight is splitting the problem into two clean responsibilities. sortStack handles one job — peel elements off one by one until the base case, then trigger insert on the way back up. insert handles one job — place a single element into its correct position in an already-sorted stack by temporarily moving larger elements aside.Once you see those two responsibilities clearly, the code almost writes itself. And once this pattern clicks, it directly prepares you for more advanced recursive problems like reversing a stack, deleting the middle element, and even understanding how recursive backtracking works at a deeper level.

StackRecursionJavaGeeksForGeeksMedium

LeetCode 1614: Maximum Nesting Depth of Parentheses — Java Solution Explained

IntroductionLeetCode 1614 Maximum Nesting Depth of Parentheses is a natural follow-up to LeetCode 20 Valid Parentheses. While LeetCode 20 asks "are the brackets valid?", this problem asks "how deeply are they nested?" It is a clean, focused problem that teaches you how to think about bracket depth — a concept that appears in compilers, parsers, JSON validators, and XML processors in real world software.Here is the Link of Question -: LeetCode 1614In this article we cover plain English explanation, real life analogy, two Java approaches with dry runs, complexity analysis, and all the important details you need for interviews.What Is the Problem Really Asking?You are given a valid parentheses string. You need to find the maximum number of nested (not just sequential) open parentheses at any point in the string.The key distinction here is nested vs sequential:"()()()" → depth is 1, brackets are sequential not nested"((()))" → depth is 3, brackets are fully nested inside each other"()(())" → depth is 2, the second pair is nested one level deepReal Life Analogy — Folders Inside FoldersThink of your computer's file system. You have a folder, inside that a subfolder, inside that another subfolder. The depth is how many folders deep you are at the deepest point."(1+(2*3)+((8)/4))+1" is like:Outer folder ( → depth 1Inner folder ( inside it → depth 2Innermost folder (( → depth 3The answer is how deep the deepest file is buried. You do not care about other folders — just the maximum depth reached at any single moment.Approach 1: Stack Based Solution (Classic)The IdeaUse a stack exactly like LeetCode 20. Every time you push an opening bracket, increment a counter. Every time you pop a closing bracket, record the max before decrementing. The stack size at any moment represents current depth.public int maxDepth(String s) { Stack<Character> st = new Stack<>(); int current = 0; int max = 0; for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (c == '(') { st.push(c); current++; max = Math.max(max, current); // record depth when going deeper } else if (c == ')') { if (!st.empty() && st.peek() == '(') { max = Math.max(max, current); current--; st.pop(); } } } return max;}Dry Run — s = "()(())((()()))"( → push, current = 1, max = 1) → pop, current = 0( → push, current = 1, max = 1( → push, current = 2, max = 2) → pop, current = 1) → pop, current = 0( → push, current = 1, max = 2( → push, current = 2, max = 2( → push, current = 3, max = 3 ✅) → pop, current = 2( → push, current = 3, max = 3) → pop, current = 2) → pop, current = 1) → pop, current = 0✅ Output: 3Time Complexity: O(n) — single pass Space Complexity: O(n) — stack holds up to n/2 opening bracketsApproach 2: Counter Only — No Stack (Optimal) ✅The IdeaThis is the smartest approach and the real insight of this problem. You do not actually need a stack at all! Think about it — the depth at any moment is simply how many unmatched opening brackets we have seen so far. That is just a counter!( → increment counter, update max) → decrement counterEverything else → ignorepublic int maxDepth(String s) { int current = 0; int max = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { current++; max = Math.max(max, current); } else if (s.charAt(i) == ')') { current--; } } return max;}This is beautifully simple. No stack, no extra memory, just two integer variables.Dry Run — s = "(1+(2*3)+((8)/4))+1"Only tracking ( and ), ignoring digits and operators:( → current = 1, max = 1( → current = 2, max = 2) → current = 1( → current = 2, max = 2( → current = 3, max = 3 ✅) → current = 2) → current = 1) → current = 0✅ Output: 3Time Complexity: O(n) — single pass Space Complexity: O(1) — only two integer variables, no extra storage!Why Update Max on ( Not on )?This is the most important implementation detail. You update max when you open a bracket, not when you close it. Why?Because when you encounter (, your depth just increased to a new level — that is when you might have hit a new maximum. When you encounter ), you are going back up — depth is decreasing, so it can never be a new maximum.Always capture the peak on the way down into nesting, not on the way back out.Stack vs Counter — Which to Use?The counter approach is strictly better here — same time complexity but O(1) space instead of O(n). In an interview, start by mentioning the stack approach to show you recognize the stack pattern, then immediately offer the counter optimization to show deeper understanding.This mirrors the same progression as LeetCode 844 Backspace String Compare — where the O(1) two pointer follow-up impressed interviewers more than the standard stack solution.How This Fits the Stack Pattern SeriesLooking at the full series you have been solving:20 Valid Parentheses — are brackets correctly matched? 1614 Maximum Nesting Depth — how deeply are they nested?These two problems are complementary. One validates structure, the other measures depth. Together they cover the two most fundamental questions you can ask about a bracket string. Real world parsers need to answer both — "is this valid?" and "how complex is the nesting?"Common Mistakes to AvoidUpdating max after decrementing on ) If you write current-- before Math.max, you will always be one level too low and miss the true maximum. Always capture max before or at the moment of increment, never after decrement.Counting all characters not just brackets Digits, operators like +, -, *, / must be completely ignored. Only ( and ) affect depth.Using a Stack when a counter suffices Since the problem guarantees a valid parentheses string, you never need to validate matching — just track depth. A Stack adds unnecessary complexity and memory overhead here.FAQs — People Also AskQ1. What is nesting depth in LeetCode 1614? Nesting depth is the maximum number of open parentheses that are simultaneously unclosed at any point in the string. For example "((()))" has depth 3 because at the innermost point, three ( are open at the same time.Q2. What is the best approach for LeetCode 1614 in Java? The counter approach is optimal — O(n) time and O(1) space. Increment a counter on (, update max, decrement on ). No stack needed since the string is guaranteed to be a valid parentheses string.Q3. What is the time complexity of LeetCode 1614? Both approaches are O(n) time. The Stack approach uses O(n) space while the counter approach uses O(1) space, making the counter approach strictly better.Q4. What is the difference between LeetCode 20 and LeetCode 1614? LeetCode 20 validates whether a bracket string is correctly formed. LeetCode 1614 assumes the string is already valid and asks how deeply the brackets are nested. LeetCode 20 needs a stack for matching; LeetCode 1614 only needs a counter.Q5. Is LeetCode 1614 asked in coding interviews? It appears occasionally as a warmup or follow-up after LeetCode 20. The more important skill it tests is recognizing when a stack can be replaced by a simpler counter — that kind of space optimization thinking is valued in interviews.Similar LeetCode Problems to Practice Next20. Valid Parentheses — Easy — validate bracket structure1021. Remove Outermost Parentheses — Easy — depth-based filtering1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets32. Longest Valid Parentheses — Hard — longest valid substring394. Decode String — Medium — nested brackets with encodingConclusionLeetCode 1614 Maximum Nesting Depth of Parentheses teaches a deceptively simple but important lesson — not every bracket problem needs a stack. When the string is guaranteed valid and you only need to measure depth, a counter is all you need.The progression from LeetCode 20 to 1614 perfectly illustrates how understanding the core problem deeply leads to elegant simplifications. Master both, understand why one needs a stack and the other does not, and you will have a strong foundation for every bracket problem in your interview journey.

StringStackLeetCodeEasy

Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

IntroductionThe Permutation with Spaces problem is a classic recursion question that helps build a strong understanding of decision-making and backtracking patterns.Instead of generating permutations by rearranging characters, this problem focuses on inserting spaces between characters in all possible ways.What makes this problem powerful is its decision tree structure, which you’ve already visualized perfectly. In this article, we will directly connect that intuition with code.Link of Problem: GeeksforGeeks – Permutation with SpacesProblem StatementGiven a string s, generate all possible strings by placing:Either a spaceOr no spacebetween every pair of characters.Return all results in sorted order.ExampleInput:s = "ABC"Output:A B CA BCAB CABCUnderstanding Your Decision Tree (Very Important)Two Choices at Each Step:❌ Do NOT add space before the character✔️ Add space before the characterMapping TreeFrom diagram:At B:"AB" → no space"A B" → spaceAt C:From "AB":"ABC""AB C"From "A B":"A BC""A B C"Final Output (Leaf Nodes)As shown in your diagram:ABC, AB C, A BC, A B C📌 This is exactly what recursion generates.Key InsightAt every index (except first), we have:2 choices → space OR no spaceSo total combinations:2^(n-1)Approach: Recursion + Decision MakingIdeaFix the first characterFor every next character:Add space + characterAdd character directlyContinue recursivelyJava Code with Detailed Commentsimport java.util.*;class Solution { // List to store all results ArrayList<String> lis = new ArrayList<>(); void solve(String s, int ind, String curr) { // Base case: // If index reaches end of string, // we have formed one valid permutation if (ind == s.length()) { lis.add(curr); // store the result return; } // Choice 1: Add SPACE before current character // Example: "A" → "A B" solve(s, ind + 1, curr + " " + s.charAt(ind)); // Choice 2: Do NOT add space // Example: "A" → "AB" solve(s, ind + 1, curr + s.charAt(ind)); } ArrayList<String> permutation(String s) { // Start with first character (no space before it) String curr = "" + s.charAt(0); // Start recursion from index 1 solve(s, 1, curr); // Sort results as required in problem Collections.sort(lis); return lis; }}Step-by-Step Execution (Using Your Tree)For "ABC":Start → "A"At "B":"AB""A B"At "C":"ABC", "AB C""A BC", "A B C"Exactly matches your decision tree leaf nodes ✅Complexity AnalysisTime Complexity: O(2ⁿ)Space Complexity: O(2ⁿ)Why This Approach WorksRecursion explores every possible choiceEach level = one characterEach branch = decision (space / no space)Leaf nodes = final answersKey TakeawaysThis is a binary decision recursion problemAlways identify:ChoicesBase conditionYour decision tree = direct blueprint of recursionSame pattern applies to:SubsetsBinary choices problemsConclusionThe Permutation with Spaces problem becomes extremely simple once the decision tree is understood—and your diagram already captures that perfectly.The recursion directly follows the same structure:Every branch = one decisionEvery leaf = one answerMaster this pattern, and you’ll find many recursion problems much easier to solve.

MediumGeeksforGeeksRecursionJava

Roman to Integer – Easy Explanation with Java Solution (LeetCode 13)

Try the QuestionYou can try solving the problem here before reading the solution:👉 https://leetcode.com/problems/roman-to-integer/Practicing it yourself first helps you understand the logic better.Roman to Integer – Complete GuideRoman numerals are an ancient numbering system used by the Romans. Instead of digits like 1, 2, 3, they used specific characters to represent values.This problem asks us to convert a Roman numeral string into its corresponding integer value.It is a very common interview question and frequently appears in coding platforms like LeetCode, HackerRank, and coding interviews at product-based companies.Roman Numeral SymbolsRoman numerals consist of seven characters, each representing a fixed value.SymbolValueI1V5X10L50C100D500M1000Example conversions:III = 3 → 1 + 1 + 1XII = 12 → 10 + 1 + 1XXVII = 27 → 10 + 10 + 5 + 1 + 1Normally, Roman numerals are written from largest to smallest from left to right.But there is an important exception.The Subtraction RuleIn some cases, Roman numerals use subtraction instead of addition.If a smaller value appears before a larger value, it means we subtract it.Examples:RomanCalculationResultIV5 − 14IX10 − 19XL50 − 1040XC100 − 1090CD500 − 100400CM1000 − 100900These are the only valid subtraction cases.Example WalkthroughExample 1Inputs = "III"ExplanationI + I + I = 1 + 1 + 1 = 3Output3Example 2Inputs = "LVIII"ExplanationL = 50V = 5III = 350 + 5 + 3 = 58Output58Example 3Inputs = "MCMXCIV"ExplanationM = 1000CM = 900XC = 90IV = 4Total = 1994Output1994Intuition Behind the SolutionThe key idea is to compare each Roman numeral with the numeral to its right.Two situations occur:Case 1 — Normal AdditionIf the current value ≥ next valueWe simply add it to the total.ExampleVI5 + 1 = 6Case 2 — Subtraction CaseIf the current value < next valueWe subtract it.ExampleIV5 - 1 = 4Strategy to SolveCreate a HashMap to store Roman numeral values.Start from the rightmost character.Initialize total with the last character's value.Move from right to left.Compare the current numeral with the next numeral.If smaller → subtract.Otherwise → add.Continue until the beginning of the string.This approach works because Roman numerals follow a local comparison rule.Java Implementationclass Solution { public int romanToInt(String s) { HashMap<Character,Integer> mp = new HashMap<>(); mp.put('I',1); mp.put('V',5); mp.put('X',10); mp.put('L',50); mp.put('C',100); mp.put('D',500); mp.put('M',1000); int tot = mp.get(s.charAt(s.length()-1)); char arr[] = s.toCharArray(); int j = s.length()-2; for(int i = arr.length-1; i >= 0; i--){ if(j >= 0){ if(mp.get(arr[j]) < mp.get(arr[i])){ tot -= mp.get(arr[j]); }else if(mp.get(arr[j]) > mp.get(arr[i])){ tot += mp.get(arr[j]); }else{ tot += mp.get(arr[j]); } } j--; } return tot; }}Code ExplanationStep 1 — Store Roman ValuesWe create a HashMap so we can quickly get the numeric value of each Roman character.I → 1V → 5X → 10...This allows O(1) lookup time.Step 2 — Initialize TotalWe start with the last character.int tot = mp.get(s.charAt(s.length()-1));Why?Because the last numeral is always added, never subtracted.Step 3 — Traverse from Right to LeftWe move backward through the string.for(int i = arr.length-1; i >= 0; i--)And compare with the previous character.Step 4 — Apply Roman RulesIf the previous numeral is smaller than the current numeral:tot -= valueExampleIV5 - 1If it is greater or equal:tot += valueExampleVI5 + 1Time ComplexityO(n)Where n = length of the string.We only traverse the string once.Space ComplexityO(1)The HashMap size is constant (only 7 entries).Key Takeaways✔ Roman numerals mostly use addition✔ Subtraction occurs only in six specific cases✔ Comparing current and next value is the simplest approach✔ A single pass solution (O(n)) is enoughThis is why this problem is commonly used to test string processing and logical reasoning in coding interviews.Final ThoughtsThe Roman to Integer problem is a great beginner-friendly problem that teaches:HashMap usageString traversalConditional logicPattern recognitionMastering these simple problems builds a strong foundation for more complex algorithmic questions.If you're preparing for coding interviews, this is definitely a problem you should practice.

LeetCodeJavaString ProblemsEasyRoman Numerals

LeetCode 844: Backspace String Compare — Java Solution With All Approaches Explained

IntroductionLeetCode 844 Backspace String Compare is a fantastic problem that shows up frequently in coding interviews. It combines string manipulation, stack simulation, and even has a follow-up that challenges you to solve it in O(1) space — which is what separates a good candidate from a great one.Here is the Link of Question -: LeetCode 844In this article we cover a plain English explanation, real life analogy, 3 Java approaches including the O(1) space two pointer solution, dry runs, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You are given two strings s and t. Both contain lowercase letters and # characters. Think of # as the backspace key on your keyboard — it deletes the character just before it. If there is nothing to delete, it does nothing.Process both strings through these backspace operations and check if the resulting strings are equal. Return true if equal, false otherwise.Quick Example:s = "ab#c" → # deletes b → becomes "ac"t = "ad#c" → # deletes d → becomes "ac"Both equal "ac" → return true ✅Real Life Analogy — The Keyboard TypoYou are typing a message. You type "ab", realize you made a typo, hit backspace, and type "c". Your friend types "ad", hits backspace, and types "c". Even though you both typed differently, the final message on screen is the same — "ac".That is exactly what this problem is about. Two people typing differently but ending up with the same result.Approach 1: StringBuilder as Stack (Optimal & Clean) ✅The IdeaThis is your own solution and the best O(n) approach. Process each string independently using a StringBuilder as a stack:Letter → append to StringBuilder (push)# → delete last character if StringBuilder is not empty (pop)Then simply compare the two resulting StringBuilders.public boolean backspaceCompare(String s, String t) { return process(s).equals(process(t));}private String process(String str) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < str.length(); i++) { char c = str.charAt(i); if (c == '#') { if (sb.length() > 0) { sb.deleteCharAt(sb.length() - 1); } } else { sb.append(c); } } return sb.toString();}Notice how extracting a process() helper method makes the code cleaner and avoids repeating the same loop twice — a great habit to show in interviews!Dry Run — s = "ab##", t = "c#d#"Processing s = "ab##":a → append → "a"b → append → "ab"# → delete last → "a"# → delete last → ""Processing t = "c#d#":c → append → "c"# → delete last → ""d → append → "d"# → delete last → ""Both result in "" → return true ✅Time Complexity: O(n + m) — where n and m are lengths of s and t Space Complexity: O(n + m) — two StringBuilders storing processed stringsApproach 2: Stack Based Solution (Interview Classic)The IdeaSame logic as above but using explicit Stack<Character> objects. Great for explaining your thought process clearly in an interview even though StringBuilder is cleaner.public boolean backspaceCompare(String s, String t) { return processStack(s).equals(processStack(t));}private String processStack(String str) { Stack<Character> st = new Stack<>(); for (int i = 0; i < str.length(); i++) { char c = str.charAt(i); if (c == '#') { if (!st.empty()) { st.pop(); } } else { st.push(c); } } StringBuilder sb = new StringBuilder(); while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString();}Dry Run — s = "a#c", t = "b"Processing s = "a#c":a → push → stack: [a]# → pop → stack: []c → push → stack: [c]Result: "c"Processing t = "b":b → push → stack: [b]Result: "b""c" does not equal "b" → return false ✅Time Complexity: O(n + m) Space Complexity: O(n + m)Approach 3: Two Pointer — O(1) Space (Follow-Up Solution) 🔥This is the follow-up the problem asks about — can you solve it in O(n) time and O(1) space? This means no extra StringBuilder or Stack allowed.The IdeaInstead of building processed strings, traverse both strings from right to left simultaneously. Keep a count of pending backspaces. Skip characters that would be deleted and compare characters that survive.Why right to left? Because # affects characters to its left, so processing from the end lets us know upfront how many characters to skip.public boolean backspaceCompare(String s, String t) { int i = s.length() - 1; int j = t.length() - 1; int skipS = 0, skipT = 0; while (i >= 0 || j >= 0) { // Find next valid character in s while (i >= 0) { if (s.charAt(i) == '#') { skipS++; i--; } else if (skipS > 0) { skipS--; i--; } else { break; } } // Find next valid character in t while (j >= 0) { if (t.charAt(j) == '#') { skipT++; j--; } else if (skipT > 0) { skipT--; j--; } else { break; } } // Compare the valid characters if (i >= 0 && j >= 0) { if (s.charAt(i) != t.charAt(j)) { return false; } } else if (i >= 0 || j >= 0) { return false; // one string still has chars, other doesn't } i--; j--; } return true;}Dry Run — s = "ab#c", t = "ad#c"Starting from the right end of both strings:Round 1:s[3] = 'c' → valid, no skips → stopt[3] = 'c' → valid, no skips → stopCompare 'c' == 'c' ✅ → move both pointers leftRound 2:s[2] = '#' → skipS = 1, move lefts[1] = 'b' → skipS > 0, skipS = 0, move lefts[0] = 'a' → valid, stopt[2] = '#' → skipT = 1, move leftt[1] = 'd' → skipT > 0, skipT = 0, move leftt[0] = 'a' → valid, stopCompare 'a' == 'a' ✅ → move both pointers leftBoth pointers exhausted → return true ✅Time Complexity: O(n + m) — each character visited at most once Space Complexity: O(1) — only pointer and counter variables, no extra storage!Approach ComparisonThe StringBuilder approach is the easiest to write and explain. The Stack approach is slightly more verbose but shows clear intent. The Two Pointer approach is the hardest to code but the most impressive — it solves the follow-up and uses zero extra space.In an interview, start with the StringBuilder solution, explain it clearly, then mention the Two Pointer approach as the O(1) space optimization if asked.How This Fits the Stack Simulation PatternYou have now seen this same pattern across four problems:3174 Clear Digits — digit deletes closest left non-digit 2390 Removing Stars — star deletes closest left non-star 1047 Remove Adjacent Duplicates — character cancels matching top of stack 844 Backspace String Compare — # deletes closest left character, then compare two stringsAll four use the same StringBuilder-as-stack core. The only differences are the trigger character and what you do with the result. This is the power of pattern recognition in DSA.Common Mistakes to AvoidNot handling backspace on empty string When # appears but the StringBuilder is already empty, do nothing. Always guard with sb.length() > 0 before calling deleteCharAt. The problem explicitly states backspace on empty text keeps it empty.Using Stack and forgetting to handle # when stack is empty In the Stack approach, only pop if the stack is not empty. Pushing # onto the stack when it is empty is a common bug that gives wrong answers.In Two Pointer, comparing before both pointers find valid characters Make sure both inner while loops fully complete before comparing. Comparing too early is the most common mistake in the O(1) space solution.FAQs — People Also AskQ1. What is the best approach for LeetCode 844 in Java? For most interviews, the StringBuilder approach is the best — clean, readable, and O(n) time. If the interviewer asks for O(1) space, switch to the Two Pointer approach traversing from right to left.Q2. How does the O(1) space solution work for LeetCode 844? It uses two pointers starting from the end of both strings, keeping a skip counter to track pending backspaces. Characters that would be deleted are skipped, and only surviving characters are compared.Q3. What is the time complexity of LeetCode 844? All three approaches run in O(n + m) time where n and m are the lengths of the two strings. The Two Pointer approach achieves this with O(1) space instead of O(n + m).Q4. Why traverse from right to left in the Two Pointer approach? Because # affects characters to its left. Scanning from the right lets you know upfront how many characters to skip before you reach them, avoiding the need to store anything.Q5. Is LeetCode 844 asked in Google interviews? Yes, it is commonly used as a warmup or screening problem. The follow-up O(1) space solution is what makes it interesting for senior-level interviews.Similar LeetCode Problems to Practice Next1047. Remove All Adjacent Duplicates In String — Easy — same stack pattern2390. Removing Stars From a String — Medium — star as backspace3174. Clear Digits — Easy — digit as backspace1209. Remove All Adjacent Duplicates in String II — Medium — k adjacent duplicates678. Valid Parenthesis String — Medium — stack with wildcardsConclusionLeetCode 844 Backspace String Compare is a well-rounded problem that tests string manipulation, stack simulation, and space optimization all in one. The StringBuilder solution is your go-to for interviews. But always be ready to explain the Two Pointer O(1) space follow-up — that is what shows real depth of understanding.Check out these problems alongside 1047, 2390, and 3174 and you will have the entire stack simulation pattern locked down for any coding interview.

StringStackTwo PointerString Builder

Delete Middle Element of Stack Without Extra Space | Java Recursive Solution

IntroductionStack-based problems are a core part of data structures and algorithms (DSA) interviews. One such interesting and frequently asked question is deleting the middle element of a stack without using any additional data structure.At first glance, this problem may seem tricky because stacks only allow access to the top element. However, with the help of recursion, it becomes an elegant and intuitive solution.In this article, we will break down the problem, build the intuition, and implement an efficient recursive approach step by step.Link of Problem: GeeksforGeeks – Delete Middle of a StackProblem StatementGiven a stack s, delete the middle element of the stack without using any additional data structure.Definition of Middle ElementThe middle element is defined as:floor((size_of_stack + 1) / 2)Indexing starts from the bottom of the stack (1-based indexing)ExamplesExample 1Input:s = [10, 20, 30, 40, 50]Output:[50, 40, 20, 10]Explanation:Middle index = (5+1)/2 = 3Middle element = 30 → removedExample 2Input:s = [10, 20, 30, 40]Output:[40, 30, 10]Explanation:Middle index = (4+1)/2 = 2Middle element = 20 → removedKey InsightStacks follow LIFO (Last In, First Out), meaning:You can only access/remove the top elementYou cannot directly access the middleSo how do we solve it?We use recursion to:Pop elements until we reach the middleRemove the middle elementPush back all other elementsThis way, no extra data structure is used—just the recursion call stack.Approach: Recursive SolutionIdeaCalculate the middle positionRecursively remove elements from the topWhen the middle is reached → delete itWhile returning, push elements backCode (Java)import java.util.Stack;class Solution {void findMid(Stack<Integer> s, int mid) {// When current stack size equals middle positionif (s.size() == mid) {s.pop(); // delete middle elementreturn;}int temp = s.pop(); // remove top element// Recursive callfindMid(s, mid);// Push element back after recursions.push(temp);}// Function to delete middle element of a stackpublic void deleteMid(Stack<Integer> s) {int mid = (s.size() + 1) / 2;findMid(s, mid);}}Step-by-Step Dry RunLet’s take:Stack (bottom → top): [10, 20, 30, 40, 50]Middle index = 3Recursion pops: 50 → 40Now stack size = 3 → remove 30Push back: 40 → 50Final Stack:[10, 20, 40, 50]Complexity AnalysisTime Complexity: O(n)Each element is removed and added onceAuxiliary Space: O(n)Due to recursion call stackWhy This Approach WorksRecursion simulates stack behaviorNo extra data structures like arrays or lists are usedMaintains original order after deletionEfficient and interview-friendly solutionKey TakeawaysDirect access to middle is not possible in a stackRecursion is the key to solving such constraintsAlways think of breaking + rebuilding for stack problemsThis pattern is useful in many stack-based interview questionsWhen This Problem Is AskedThis problem is commonly seen in:Technical interviewsCoding platforms like GeeksforGeeksStack and recursion-based problem setsIt evaluates:Understanding of stack operationsRecursive thinkingProblem-solving under constraintsConclusionDeleting the middle element of a stack without extra space is a classic example of using recursion effectively. While the problem may seem restrictive, the recursive approach provides a clean and optimal solution.Mastering this concept will help you tackle more advanced stack and recursion problems with confidence.Frequently Asked Questions (FAQs)1. Can this be solved without recursion?Not efficiently without using another data structure. Recursion is the best approach under given constraints.2. Why not use an array or list?The problem explicitly restricts the use of additional data structures.3. What is the best approach?The recursive approach is optimal with O(n) time and space complexity.

GeeksofGeeksEasyStackRecursionJava

LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

IntroductionThe Generate Parentheses problem is one of the most important and frequently asked backtracking questions in coding interviews.At first glance, it may look like a simple string generation problem—but the real challenge is to generate only valid (well-formed) parentheses combinations.This problem is a perfect example of:Constraint-based recursionBacktracking with conditionsDecision tree pruningIn this article, we’ll break down the intuition, understand the constraints, and implement a clean and efficient solution.🔗 Problem LinkLeetCode: Generate ParenthesesProblem StatementGiven n pairs of parentheses:👉 Generate all combinations of well-formed parenthesesExamplesExample 1Input:n = 3Output:["((()))","(()())","(())()","()(())","()()()"]Example 2Input:n = 1Output:["()"]Key InsightWe are not generating all possible strings—we are generating only valid parentheses.Rules of Valid ParenthesesNumber of ( must equal number of )At any point:closing brackets should never exceed opening bracketsIntuition (Decision Making)At every step, we have two choices:Add "(" OR Add ")"But we cannot always take both choices.Valid ConditionsWhen can we add "("?If open > 0When can we add ")"?If close > open👉 This ensures the string always remains valid.Decision Tree (n = 3)👉 You can add your tree diagram here for better visualization.Conceptual FlowStart: ""→ "(" → "(("→ "(((" → "((()"→ ...Invalid paths like ")(" are never explored because of constraints.Approach: Backtracking with ConstraintsIdeaKeep track of:Remaining open bracketsRemaining close bracketsBuild string step by stepOnly take valid decisionsJava Codeimport java.util.*;class Solution {// List to store all valid combinationsList<String> lis = new ArrayList<>();public void solve(int open, int close, String curr) {// Base case: no brackets leftif (open == 0 && close == 0) {lis.add(curr); // valid combinationreturn;}// Choice 1: Add opening bracket "("// Allowed only if we still have opening brackets leftif (open > 0) {solve(open - 1, close, curr + "(");}// Choice 2: Add closing bracket ")"// Allowed only if closing brackets > opening bracketsif (open < close) {solve(open, close - 1, curr + ")");}}public List<String> generateParenthesis(int n) {solve(n, n, ""); // start recursionreturn lis;}}Step-by-Step Execution (n = 2)Start: ""→ "("→ "(("→ "(())"→ "()"→ "()()"Complexity AnalysisTime Complexity: O(4ⁿ / √n) (Catalan Number)Space Complexity: O(n) recursion stackWhy Catalan Number?The number of valid parentheses combinations is:Cn = (1 / (n+1)) * (2n choose n)Why This Approach WorksIt avoids invalid combinations earlyUses constraints to prune recursion treeGenerates only valid resultsEfficient compared to brute force❌ Naive Approach (Why It Fails)Generate all combinations of ( and ):Total combinations = 2^(2n)Then filter valid ones👉 Very inefficient → TLEKey TakeawaysThis is a constraint-based recursion problemAlways:Add "(" if availableAdd ")" only if validBacktracking avoids invalid pathsImportant pattern for interviewsCommon Interview VariationsValid parentheses checkingLongest valid parenthesesRemove invalid parenthesesBalanced expressionsConclusionThe Generate Parentheses problem is a must-know backtracking problem. It teaches how to apply constraints during recursion to efficiently generate valid combinations.Once mastered, this pattern becomes extremely useful in solving many advanced recursion problems.Frequently Asked Questions (FAQs)1. Why can’t we add ")" anytime?Because it may create invalid sequences like ")(".2. What is the key trick?Ensure:close > open3. Is recursion the best approach?Yes, it is the most intuitive and efficient method.

MediumLeetCodeJavaRecursion

Reverse a Stack Without Extra Space | Java Recursive Solution

IntroductionReversing a stack is a classic data structures problem that frequently appears in coding interviews and competitive programming. While it may seem straightforward, the challenge lies in reversing the stack without using any additional data structure.This problem is a great way to understand the power of recursion and stack manipulation.In this article, we will explore an intuitive recursive approach, understand how it works step by step, and also briefly discuss alternative methods.Link of Problem: GeeksforGeeks – Reverse a StackProblem StatementYou are given a stack st[]. The task is to reverse the stack.Important NotesThe input array represents the stack from bottom to topThe last element is considered the topOutput should display elements from top to bottom after reversalExamplesExample 1Input:st = [1, 2, 3, 4]Output:[1, 2, 3, 4]Explanation:After reversing, the internal order becomes [4, 3, 2, 1],so when printed from top → bottom, it appears as [1, 2, 3, 4].Example 2Input:st = [3, 2, 1]Output:[3, 2, 1]Explanation:Reversed stack becomes [1, 2, 3] internally.Key InsightA stack only allows:push() → insert at toppop() → remove from topChallengeWe cannot directly insert an element at the bottom of the stack.Solution StrategyUse recursion to:Remove all elements from the stackInsert each element back at the bottomThis effectively reverses the stack.Approach: Recursive SolutionIdeaPop the top elementReverse the remaining stack recursivelyInsert the popped element at the bottomCode (Java)import java.util.Stack;class Solution {static void rever(Stack<Integer> s) {if (s.size() == 1) return;int temp = s.pop();// Reverse remaining stackrever(s);// Insert element at bottominsre(s, temp);}static void insre(Stack<Integer> s, int val) {// Base condition: empty stackif (s.empty()) {s.push(val);return;}int temp = s.pop();// Recursive callinsre(s, val);// Push back previous elementss.push(temp);}public static void reverseStack(Stack<Integer> st) {rever(st);}}Step-by-Step Dry RunLet’s take:Stack (bottom → top): [1, 2, 3, 4]Execution Flow:Pop 4 → reverse [1, 2, 3]Pop 3 → reverse [1, 2]Pop 2 → reverse [1]Insert elements at bottom in orderFinal Stack:[4, 3, 2, 1]Complexity AnalysisTime Complexity: O(n²)Each insertion at bottom takes O(n)Auxiliary Space: O(n)Due to recursion call stackWhy This Approach WorksRecursion helps access deeper elements of the stackThe helper function inserts elements at the bottomMaintains order while reversing without extra structuresAlternative Approaches1. Using Two StacksTransfer elements between stacks multiple timesEasy but uses extra space2. Using Array/ListStore elements in a listPush them back into stack⚠️ These methods violate the constraint of not using extra data structures.Key TakeawaysStack problems often require creative recursionReversing a stack without extra space is a common interview patternUnderstanding insert at bottom is crucialTime complexity is higher due to repeated insert operationsWhen This Problem Is AskedThis question is commonly seen in:Technical interviewsStack and recursion problem setsPlatforms like GeeksforGeeksIt evaluates:Understanding of stack operationsRecursive thinkingProblem-solving under constraintsConclusionReversing a stack without using extra space is a great example of how recursion can simplify complex constraints. While the solution may not be the most optimal in terms of time complexity, it is elegant and widely accepted in interviews.Mastering this pattern will help you solve many similar problems involving stack manipulation.Frequently Asked Questions (FAQs)1. Why is the time complexity O(n²)?Because inserting an element at the bottom takes O(n), and this is done for each element.2. Can this be optimized further?Not without using extra data structures. The recursive approach is optimal under constraints.3. What is the key concept to learn here?Understanding how to insert an element at the bottom of a stack using recursion.

JavaGeeksofGeeksStackRecursionReverse

All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

IntroductionThe Power Set problem for strings is a classic question in recursion and backtracking, frequently asked in coding interviews and platforms like GeeksforGeeks.In this problem, instead of numbers, we deal with strings and generate all possible subsequences (not substrings). This makes it slightly more interesting and practical for real-world applications like pattern matching, text processing, and combinatorics.In this article, we will cover:Intuition behind subsequencesRecursive (backtracking) approachSorting for lexicographical orderAlternative approachesComplexity analysisProblem StatementGiven a string s of length n, generate all non-empty subsequences of the string.RequirementsReturn only non-empty subsequencesOutput must be in lexicographically sorted orderExamplesExample 1Input:s = "abc"Output:a ab abc ac b bc cExample 2Input:s = "aa"Output:a a aaSubsequence vs Substring (Important)Substring: Continuous charactersSubsequence: Characters can be skippedExample for "abc":Subsequences → a, b, c, ab, ac, bc, abcKey InsightFor every character, we have two choices:Include it OR Exclude itSo total subsequences:2^nWe generate all and then remove the empty string.Approach 1: Recursion (Backtracking)IntuitionAt each index:Skip the characterInclude the characterBuild all combinations recursivelyJava Code (With Explanation)import java.util.*;class Solution { // List to store all subsequences List<String> a = new ArrayList<>(); void sub(String s, int ind, String curr) { // Base case: reached end of string if (ind == s.length()) { a.add(curr); // add current subsequence return; } // Choice 1: Exclude current character sub(s, ind + 1, curr); // Choice 2: Include current character sub(s, ind + 1, curr + s.charAt(ind)); } public List<String> AllPossibleStrings(String s) { // Start recursion sub(s, 0, ""); // Remove empty string (not allowed) a.remove(""); // Sort lexicographically Collections.sort(a); return a; }}Step-by-Step Dry Run (s = "abc")Start: ""→ Exclude 'a' → "" → Exclude 'b' → "" → Exclude 'c' → "" → Include 'c' → "c" → Include 'b' → "b" → Exclude 'c' → "b" → Include 'c' → "bc"→ Include 'a' → "a" → Exclude 'b' → "a" → Exclude 'c' → "a" → Include 'c' → "ac" → Include 'b' → "ab" → Exclude 'c' → "ab" → Include 'c' → "abc"Final Output (After Sorting)a ab abc ac b bc cApproach 2: Bit ManipulationIntuitionEach subsequence can be represented using binary numbers:0 → exclude1 → includeCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); int n = s.length(); int total = 1 << n; // 2^n for (int i = 1; i < total; i++) { // start from 1 to avoid empty StringBuilder sb = new StringBuilder(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { sb.append(s.charAt(j)); } } result.add(sb.toString()); } Collections.sort(result); return result; }}Approach 3: Iterative (Expanding List)IdeaStart with empty listFor each character:Add it to all existing subsequencesCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); result.add(""); for (char ch : s.toCharArray()) { int size = result.size(); for (int i = 0; i < size; i++) { result.add(result.get(i) + ch); } } result.remove(""); Collections.sort(result); return result; }}Complexity AnalysisTime Complexity: O(n × 2ⁿ)Space Complexity: O(n × 2ⁿ)Why?Total subsequences = 2ⁿEach subsequence takes O(n) to buildWhy Sorting is RequiredThe recursion generates subsequences in random order, so we sort them:Collections.sort(result);This ensures lexicographical order as required.Key TakeawaysThis is a power set problem for stringsEach character → 2 choicesRecursion = most intuitive approachBit manipulation = most optimized thinkingAlways remove empty string if requiredCommon Interview VariationsSubsets of arrayPermutations of stringCombination sumSubsequence with conditionsConclusionThe Power Set problem is a fundamental building block in recursion and combinatorics. Once you understand the include/exclude pattern, you can solve a wide range of problems efficiently.Mastering this will significantly improve your ability to tackle backtracking and decision tree problems.Frequently Asked Questions (FAQs)1. Why is the empty string removed?Because the problem requires only non-empty subsequences.2. Why is time complexity O(n × 2ⁿ)?Because there are 2ⁿ subsequences and each takes O(n) time to construct.3. Which approach is best?Recursion → best for understandingBit manipulation → best for optimization

GeeksforGeeksRecursionJavaBacktrackingMedium

LeetCode 1855 Maximum Distance Between Pair of Values | Two Pointer Java Solution

IntroductionLeetCode 1855 – Maximum Distance Between a Pair of Values is a classic problem that beautifully demonstrates the power of the Two Pointer technique on sorted (non-increasing) arrays.At first glance, it may feel like a brute-force problem—but using the right observation, it can be solved efficiently in O(n) time.In this article, we will cover:Problem intuitionWhy brute force failsOptimized two-pointer approach (your solution)Alternative approachesTime complexity analysis🔗 Problem LinkLeetCode: Maximum Distance Between a Pair of ValuesProblem StatementYou are given two non-increasing arrays:nums1nums2A pair (i, j) is valid if:i <= jnums1[i] <= nums2[j]👉 Distance = j - iReturn the maximum distance among all valid pairs.ExamplesExample 1Input:nums1 = [55,30,5,4,2]nums2 = [100,20,10,10,5]Output:2Key InsightThe most important observation:Both arrays are NON-INCREASING👉 This allows us to use two pointers efficiently instead of brute force.❌ Naive Approach (Brute Force)IdeaTry all (i, j) pairsCheck conditionsTrack maximumComplexityTime: O(n × m) ❌👉 This will cause TLE for large inputs (up to 10⁵)✅ Optimized Approach: Two PointersIntuitionUse two pointers:i → nums1j → nums2We try to:Expand j as far as possibleMove i only when necessaryKey LogicIf nums1[i] <= nums2[j] → valid → increase jElse → move i forwardJava Codeclass Solution { public int maxDistance(int[] nums1, int[] nums2) { int i = 0; // pointer for nums1 int j = 0; // pointer for nums2 int max = Integer.MIN_VALUE; // Traverse both arrays while (i < nums1.length && j < nums2.length) { // Valid pair condition if (nums1[i] <= nums2[j] && i <= j) { // Update maximum distance max = Math.max(max, j - i); // Try to expand distance by moving j j++; } else if (nums1[i] >= nums2[j]) { // nums1[i] is too large → move i forward i++; } else { // Just move j forward j++; } } // If no valid pair found, return 0 return max == Integer.MIN_VALUE ? 0 : max; }}Step-by-Step Dry RunInput:nums1 = [55,30,5,4,2]nums2 = [100,20,10,10,5]Execution:(0,0) → valid → distance = 0Move j → (0,1) → invalid → move iContinue...Final best pair:(i = 2, j = 4) → distance = 2Why This WorksArrays are sorted (non-increasing)Moving j increases distanceMoving i helps find valid pairs👉 No need to re-check previous elementsComplexity AnalysisTime ComplexityO(n + m)Each pointer moves at most once through the array.Space ComplexityO(1) (no extra space used)Alternative Approach: Binary SearchIdeaFor each i in nums1:Use binary search in nums2Find farthest j such that:nums2[j] >= nums1[i]ComplexityO(n log m)Code (Binary Search Approach)class Solution { public int maxDistance(int[] nums1, int[] nums2) { int max = 0; for (int i = 0; i < nums1.length; i++) { int left = i, right = nums2.length - 1; while (left <= right) { int mid = left + (right - left) / 2; if (nums2[mid] >= nums1[i]) { max = Math.max(max, mid - i); left = mid + 1; } else { right = mid - 1; } } } return max; }}Two Pointer vs Binary SearchApproachTimeSpaceTwo PointerO(n + m) ✅O(1)Binary SearchO(n log m)O(1)👉 Two pointer is optimal hereKey TakeawaysUse two pointers when arrays are sortedAlways look for monotonic propertiesAvoid brute force when constraints are largeGreedy pointer movement can optimize drasticallyCommon Interview PatternsThis problem is related to:Two pointer problemsSliding windowBinary search on arraysGreedy expansionConclusionThe Maximum Distance Between a Pair of Values problem is a great example of how recognizing array properties can drastically simplify the solution.By using the two-pointer technique, we reduce complexity from O(n²) to O(n)—a massive improvement.Frequently Asked Questions (FAQs)1. Why do we use two pointers?Because arrays are sorted, allowing linear traversal.2. Why not brute force?It is too slow for large inputs (10⁵).3. What is the best approach?👉 Two-pointer approach

MediumLeetCodeJavaArrayBinary SearchTwo Pointer