Search Blogs

Showing results for "Strings"

Found 50 results

LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

Try the ProblemYou can solve the problem here:https://leetcode.com/problems/find-unique-binary-string/Problem DescriptionYou are given an array nums containing n unique binary strings, where each string has length n.Your task is to return any binary string of length n that does not appear in the array.Important ConditionsEach string consists only of '0' and '1'.Every string in the array is unique.The output must be a binary string of length n.If multiple valid answers exist, any one of them is acceptable.ExamplesExample 1Inputnums = ["01","10"]Output"11"ExplanationPossible binary strings of length 2:00011011Since "01" and "10" are already present, valid answers could be:00 or 11Example 2Inputnums = ["00","01"]Output"11"Another valid output could be:10Example 3Inputnums = ["111","011","001"]Output101Other valid answers include:000010100110Constraintsn == nums.length1 <= n <= 16nums[i].length == nnums[i] consists only of '0' and '1'All strings in nums are uniqueImportant ObservationThe total number of binary strings of length n is:2^nBut the array contains only:n stringsSince 2^n grows very quickly and n ≤ 16, there are many possible binary strings missing from the array. Our goal is simply to construct one of those missing strings.Thinking About the ProblemBefore jumping into coding, it's useful to think about different strategies that could help us generate a binary string that does not appear in the array.Possible Ways to Think About the ProblemWhen approaching this problem, several ideas may come to mind:Generate all possible binary strings of length n and check which one is missing.Store all strings in a HashSet or HashMap and construct a candidate string to verify whether it exists.Manipulate existing strings by flipping bits to create new combinations.Use a mathematical trick that guarantees the new string is different from every string in the list.Each of these approaches leads to a different solution strategy.In this article, we will walk through these approaches and understand how they work.Approach 1: Brute Force – Generate All Binary StringsIdeaThe simplest idea is to generate every possible binary string of length n and check whether it exists in the given array.Since there are:2^n possible binary stringsWe can generate them one by one and return the first string that does not appear in nums.StepsConvert numbers from 0 to (2^n - 1) into binary strings.Pad the binary string with leading zeros so its length becomes n.Check if that string exists in the array.If not, return it.Time ComplexityO(2^n * n)This works because n is at most 16, but it is still not the most elegant approach.Approach 2: HashMap + Bit Flipping (My Approach)IdeaWhile solving this problem, another idea is to store all given binary strings inside a HashMap for quick lookup.Then we can try to construct a new binary string by flipping bits from the existing strings.The intuition is simple:If the current character is '0', change it to '1'.If the current character is '1', change it to '0'.By flipping bits at different positions, we attempt to build a new binary combination.Once the string is constructed, we check whether it already exists in the map.If the generated string does not exist, we return it as our answer.Java Implementation (My Solution)class Solution { public String findDifferentBinaryString(String[] nums) { int len = nums[0].length(); // HashMap to store all given binary strings HashMap<String, Integer> mp = new HashMap<>(); for(int i = 0; i < nums.length; i++){ mp.put(nums[i], i); } int cou = 0; String ans = ""; for(int i = 0; i < nums.length; i++){ if(cou < len){ // Flip the current bit if(nums[i].charAt(cou) == '0'){ ans += '1'; cou++; } else{ ans += '0'; cou++; } }else{ // If generated string does not exist in map if(!mp.containsKey(ans)){ return ans; } // Reset and try building again ans = ""; cou = 0; } } return ans; }}Time ComplexityO(n²)Because we iterate through the array and perform string operations.Space ComplexityO(n)For storing the strings in the HashMap.Approach 3: Cantor’s Diagonalization (Optimal Solution)IdeaA clever mathematical observation allows us to construct a string that must differ from every string in the array.We build a new string such that:The first character differs from the first string.The second character differs from the second string.The third character differs from the third string.And so on.By ensuring that the generated string differs from each string at least at one position, it is guaranteed not to exist in the array.This technique is known as Cantor’s Diagonalization.Java Implementationclass Solution { public String findDifferentBinaryString(String[] nums) { int n = nums.length; StringBuilder result = new StringBuilder(); for(int i = 0; i < n; i++){ // Flip the diagonal bit if(nums[i].charAt(i) == '0'){ result.append('1'); } else{ result.append('0'); } } return result.toString(); }}Time ComplexityO(n)We only traverse the array once.Space ComplexityO(n)For storing the resulting string.Comparison of ApproachesApproachTime ComplexitySpace ComplexityNotesBrute ForceO(2^n * n)O(n)Simple but inefficientHashMap + Bit FlippingO(n²)O(n)Constructive approachCantor DiagonalizationO(n)O(n)Optimal and elegantKey TakeawaysThis problem highlights an interesting concept in algorithm design:Sometimes the best solution is not searching for the answer but constructing one directly.By understanding the structure of the input, we can generate a result that is guaranteed to be unique.ConclusionThe Find Unique Binary String problem can be solved using multiple strategies, ranging from brute force enumeration to clever mathematical construction.While brute force works due to the small constraint (n ≤ 16), more elegant solutions exist. Using hashing or constructive approaches improves efficiency and demonstrates deeper algorithmic thinking.Among all approaches, the Cantor Diagonalization technique provides the most efficient and mathematically guaranteed solution.Understanding problems like this helps strengthen skills in string manipulation, hashing, and constructive algorithms, which are commonly tested in coding interviews.

Binary StringsHashingCantor DiagonalizationLeetCodeMedium
LeetCode 844: Backspace String Compare — Java Solution With All Approaches Explained

LeetCode 844: Backspace String Compare — Java Solution With All Approaches Explained

IntroductionLeetCode 844 Backspace String Compare is a fantastic problem that shows up frequently in coding interviews. It combines string manipulation, stack simulation, and even has a follow-up that challenges you to solve it in O(1) space — which is what separates a good candidate from a great one.Here is the Link of Question -: LeetCode 844In this article we cover a plain English explanation, real life analogy, 3 Java approaches including the O(1) space two pointer solution, dry runs, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You are given two strings s and t. Both contain lowercase letters and # characters. Think of # as the backspace key on your keyboard — it deletes the character just before it. If there is nothing to delete, it does nothing.Process both strings through these backspace operations and check if the resulting strings are equal. Return true if equal, false otherwise.Quick Example:s = "ab#c" → # deletes b → becomes "ac"t = "ad#c" → # deletes d → becomes "ac"Both equal "ac" → return true ✅Real Life Analogy — The Keyboard TypoYou are typing a message. You type "ab", realize you made a typo, hit backspace, and type "c". Your friend types "ad", hits backspace, and types "c". Even though you both typed differently, the final message on screen is the same — "ac".That is exactly what this problem is about. Two people typing differently but ending up with the same result.Approach 1: StringBuilder as Stack (Optimal & Clean) ✅The IdeaThis is your own solution and the best O(n) approach. Process each string independently using a StringBuilder as a stack:Letter → append to StringBuilder (push)# → delete last character if StringBuilder is not empty (pop)Then simply compare the two resulting StringBuilders.public boolean backspaceCompare(String s, String t) { return process(s).equals(process(t));}private String process(String str) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < str.length(); i++) { char c = str.charAt(i); if (c == '#') { if (sb.length() > 0) { sb.deleteCharAt(sb.length() - 1); } } else { sb.append(c); } } return sb.toString();}Notice how extracting a process() helper method makes the code cleaner and avoids repeating the same loop twice — a great habit to show in interviews!Dry Run — s = "ab##", t = "c#d#"Processing s = "ab##":a → append → "a"b → append → "ab"# → delete last → "a"# → delete last → ""Processing t = "c#d#":c → append → "c"# → delete last → ""d → append → "d"# → delete last → ""Both result in "" → return true ✅Time Complexity: O(n + m) — where n and m are lengths of s and t Space Complexity: O(n + m) — two StringBuilders storing processed stringsApproach 2: Stack Based Solution (Interview Classic)The IdeaSame logic as above but using explicit Stack<Character> objects. Great for explaining your thought process clearly in an interview even though StringBuilder is cleaner.public boolean backspaceCompare(String s, String t) { return processStack(s).equals(processStack(t));}private String processStack(String str) { Stack<Character> st = new Stack<>(); for (int i = 0; i < str.length(); i++) { char c = str.charAt(i); if (c == '#') { if (!st.empty()) { st.pop(); } } else { st.push(c); } } StringBuilder sb = new StringBuilder(); while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString();}Dry Run — s = "a#c", t = "b"Processing s = "a#c":a → push → stack: [a]# → pop → stack: []c → push → stack: [c]Result: "c"Processing t = "b":b → push → stack: [b]Result: "b""c" does not equal "b" → return false ✅Time Complexity: O(n + m) Space Complexity: O(n + m)Approach 3: Two Pointer — O(1) Space (Follow-Up Solution) 🔥This is the follow-up the problem asks about — can you solve it in O(n) time and O(1) space? This means no extra StringBuilder or Stack allowed.The IdeaInstead of building processed strings, traverse both strings from right to left simultaneously. Keep a count of pending backspaces. Skip characters that would be deleted and compare characters that survive.Why right to left? Because # affects characters to its left, so processing from the end lets us know upfront how many characters to skip.public boolean backspaceCompare(String s, String t) { int i = s.length() - 1; int j = t.length() - 1; int skipS = 0, skipT = 0; while (i >= 0 || j >= 0) { // Find next valid character in s while (i >= 0) { if (s.charAt(i) == '#') { skipS++; i--; } else if (skipS > 0) { skipS--; i--; } else { break; } } // Find next valid character in t while (j >= 0) { if (t.charAt(j) == '#') { skipT++; j--; } else if (skipT > 0) { skipT--; j--; } else { break; } } // Compare the valid characters if (i >= 0 && j >= 0) { if (s.charAt(i) != t.charAt(j)) { return false; } } else if (i >= 0 || j >= 0) { return false; // one string still has chars, other doesn't } i--; j--; } return true;}Dry Run — s = "ab#c", t = "ad#c"Starting from the right end of both strings:Round 1:s[3] = 'c' → valid, no skips → stopt[3] = 'c' → valid, no skips → stopCompare 'c' == 'c' ✅ → move both pointers leftRound 2:s[2] = '#' → skipS = 1, move lefts[1] = 'b' → skipS > 0, skipS = 0, move lefts[0] = 'a' → valid, stopt[2] = '#' → skipT = 1, move leftt[1] = 'd' → skipT > 0, skipT = 0, move leftt[0] = 'a' → valid, stopCompare 'a' == 'a' ✅ → move both pointers leftBoth pointers exhausted → return true ✅Time Complexity: O(n + m) — each character visited at most once Space Complexity: O(1) — only pointer and counter variables, no extra storage!Approach ComparisonThe StringBuilder approach is the easiest to write and explain. The Stack approach is slightly more verbose but shows clear intent. The Two Pointer approach is the hardest to code but the most impressive — it solves the follow-up and uses zero extra space.In an interview, start with the StringBuilder solution, explain it clearly, then mention the Two Pointer approach as the O(1) space optimization if asked.How This Fits the Stack Simulation PatternYou have now seen this same pattern across four problems:3174 Clear Digits — digit deletes closest left non-digit 2390 Removing Stars — star deletes closest left non-star 1047 Remove Adjacent Duplicates — character cancels matching top of stack 844 Backspace String Compare — # deletes closest left character, then compare two stringsAll four use the same StringBuilder-as-stack core. The only differences are the trigger character and what you do with the result. This is the power of pattern recognition in DSA.Common Mistakes to AvoidNot handling backspace on empty string When # appears but the StringBuilder is already empty, do nothing. Always guard with sb.length() > 0 before calling deleteCharAt. The problem explicitly states backspace on empty text keeps it empty.Using Stack and forgetting to handle # when stack is empty In the Stack approach, only pop if the stack is not empty. Pushing # onto the stack when it is empty is a common bug that gives wrong answers.In Two Pointer, comparing before both pointers find valid characters Make sure both inner while loops fully complete before comparing. Comparing too early is the most common mistake in the O(1) space solution.FAQs — People Also AskQ1. What is the best approach for LeetCode 844 in Java? For most interviews, the StringBuilder approach is the best — clean, readable, and O(n) time. If the interviewer asks for O(1) space, switch to the Two Pointer approach traversing from right to left.Q2. How does the O(1) space solution work for LeetCode 844? It uses two pointers starting from the end of both strings, keeping a skip counter to track pending backspaces. Characters that would be deleted are skipped, and only surviving characters are compared.Q3. What is the time complexity of LeetCode 844? All three approaches run in O(n + m) time where n and m are the lengths of the two strings. The Two Pointer approach achieves this with O(1) space instead of O(n + m).Q4. Why traverse from right to left in the Two Pointer approach? Because # affects characters to its left. Scanning from the right lets you know upfront how many characters to skip before you reach them, avoiding the need to store anything.Q5. Is LeetCode 844 asked in Google interviews? Yes, it is commonly used as a warmup or screening problem. The follow-up O(1) space solution is what makes it interesting for senior-level interviews.Similar LeetCode Problems to Practice Next1047. Remove All Adjacent Duplicates In String — Easy — same stack pattern2390. Removing Stars From a String — Medium — star as backspace3174. Clear Digits — Easy — digit as backspace1209. Remove All Adjacent Duplicates in String II — Medium — k adjacent duplicates678. Valid Parenthesis String — Medium — stack with wildcardsConclusionLeetCode 844 Backspace String Compare is a well-rounded problem that tests string manipulation, stack simulation, and space optimization all in one. The StringBuilder solution is your go-to for interviews. But always be ready to explain the Two Pointer O(1) space follow-up — that is what shows real depth of understanding.Check out these problems alongside 1047, 2390, and 3174 and you will have the entire stack simulation pattern locked down for any coding interview.

StringStackTwo PointerString Builder
LeetCode 3612: Process String with Special Operations I – Java StringBuilder Solution Explained

LeetCode 3612: Process String with Special Operations I – Java StringBuilder Solution Explained

IntroductionLeetCode 3612, Process String with Special Operations I, is an excellent string simulation problem that tests your ability to process characters sequentially while maintaining a dynamic result string.The challenge introduces three special operations:* → Delete the last character# → Duplicate the current string% → Reverse the current stringAlthough the problem appears simple, it teaches an important interview concept:Simulate operations exactly as described while efficiently modifying a string.In this article, we'll break down the intuition, explore the optimal approach, perform a dry run, and analyze the time and space complexity.Problem link :- Process String with Special Operations IProblem StatementYou are given a string s containing:Lowercase English letters*#%Process the string from left to right according to the following rules:Lowercase LetterAppend it to the result.a → result += 'a'Asterisk (*)Remove the last character if one exists.abc*becomesabHash (#)Duplicate the current string.abc#becomesabcabcPercent (%)Reverse the current string.abc%becomescbaReturn the final string after processing all characters.Example 1Inputs = "a#b%*"Step-by-Step ExecutionCharacterOperationResultaAppenda#DuplicateaabAppendaab%Reversebaa*Remove lastbaOutput"ba"Key ObservationThe operations always modify the current result.We need a data structure that supports:Appendappend()Delete Last CharacterdeleteCharAt()Reversereverse()Duplicateappend(currentString)A StringBuilder supports all of these efficiently.This makes it the perfect choice for the problem.Approach 1: StringBuilder SimulationIntuitionProcess each character one by one.If it is a letterAppend it.If it is *Delete the last character.If it isDuplicate the entire current string.If it is %Reverse the current string.Continue until all characters are processed.Java Solutionclass Solution { public String processStr(String q) { StringBuilder s = new StringBuilder(); for(int i =0;i < q.length();i++){ if(q.charAt(i) != '#'&&q.charAt(i) != '*'&& q.charAt(i) != '%'){ s.append(q.charAt(i)); }else if(q.charAt(i) == '#'&& s.length()>=1){ s.append(s); }else if(q.charAt(i) == '*' && s.length()>=1){ s.deleteCharAt(s.length()-1); }else{ s.reverse(); } } return s.toString(); }}Dry RunInputs = "abc#%"Step 1aResult:aStep 2bResult:abStep 3cResult:abcStep 4#Duplicate:abcabcStep 5%Reverse:cbacbaFinal Answer:cbacbaWhy StringBuilder Is Better Than StringSuppose we use:result += ch;Every append creates a brand-new string.For large inputs this becomes inefficient.StringBuilder modifies the same object in memory.Benefits:Faster appendFaster deletionBuilt-in reverse operationLower memory overheadThis is why StringBuilder is the preferred interview solution.Complexity AnalysisLet:n = length of input stringTime ComplexityAppendO(1)Delete LastO(1)ReverseO(m)where m is current result length.DuplicateO(m)because the entire string is copied.Overall:O(n × m)In this problem:n ≤ 20so this is perfectly acceptable.Alternative Approach: Using a StackAnother way is storing characters inside a stack.Advantages:Easy handling of *Natural last-in-first-out behaviorDisadvantages:Reversing becomes expensiveDuplicating requires rebuilding dataTherefore, StringBuilder remains the cleaner solution.Interview DiscussionA common interview follow-up is:Why not use String?Because Strings are immutable.Every operation like:result += ch;creates a new object.StringBuilder avoids repeated object creation and is significantly more efficient.Edge CasesCase 1s = "z*#"Process:z → "z"* → ""# → ""Output:""Case 2s = "%"Output:""Reversing an empty string changes nothing.Case 3s = "*"Output:""Nothing exists to delete.Key TakeawaysStringBuilder is ideal for string simulation problems.Process operations strictly from left to right.append(), deleteCharAt(), and reverse() make implementation simple.Always look for mutable string structures when frequent modifications are required.Simulation problems often test implementation accuracy more than algorithmic complexity.ConclusionLeetCode 3612: Process String with Special Operations I is a clean simulation problem that demonstrates how powerful StringBuilder can be for handling dynamic string transformations.By processing each character sequentially and applying the required operation immediately, we can solve the problem efficiently with a straightforward and readable solution.This problem is an excellent exercise for improving string manipulation skills and understanding when to choose mutable data structures over immutable strings.

LeetcodeJavaStringString BuilderMedium
Check if Binary String Has at Most One Segment of Ones – Java Solution (LeetCode 1784)

Check if Binary String Has at Most One Segment of Ones – Java Solution (LeetCode 1784)

Try the QuestionBefore reading the solution, try solving the problem yourself:👉 https://leetcode.com/problems/check-if-binary-string-has-at-most-one-segment-of-ones/Attempting the problem first helps build your problem-solving intuition, which is essential for coding interviews.Problem DescriptionYou are given a binary string s, which means the string contains only two characters:'0' and '1'The string does not contain leading zeros, meaning the first character is always 1.Your task is to determine whether the string contains at most one contiguous segment of 1s.If the string has only one continuous group of 1s, return:trueIf the string contains multiple separated groups of 1s, return:falseUnderstanding the Problem ClearlyThe key phrase in the problem is:"at most one contiguous segment of ones"A segment means a continuous block of characters without interruption.For example:111This is one segment of ones.But if 1s are separated by 0s and appear again later, then there are multiple segments.Example WalkthroughExample 1Inputs = "1001"Structure1 0 0 1Here we have:Segment 1 → "1"Segment 2 → "1"There are two separate segments of ones, which violates the condition.OutputfalseExample 2Inputs = "110"Structure1 1 0There is only one continuous block of ones.OutputtrueVisual IntuitionThe string is valid only if it follows this pattern:111111000000Meaning:[One block of 1s] + [any number of 0s]But the string becomes invalid if we see something like:111001011Because here:1s → stop → 0 → start again → 1Which means two segments of ones exist.Key ObservationSince the string starts with 1, the valid structure must look like:111...111000...000Once we encounter the first 0, we should never see 1 again.If we ever see:0 → followed by → 1then a new segment of ones has started, which means the answer is false.Intuition Behind the SolutionThe logic becomes very simple:Traverse the string from left to right.Keep track of the previous character.If we ever see the pattern:0 followed by 1then it means a new segment of ones has started, so return false.If we finish scanning the string without seeing this pattern, the string is valid.Java Implementationclass Solution { public boolean checkOnesSegment(String s) { if(s.length() == 1) return true; if(s.length() == 2 && s.charAt(1) == '1'){ return true; } if(s.length() == 2 && s.charAt(1) == '0'){ return true; } char prev = '0'; for(int i = 0; i < s.length() - 1; i++){ prev = s.charAt(i); if(s.charAt(i+1) == '1' && prev == '0'){ return false; } } return true; }}Step-by-Step Code Explanation1. Handle Small Edge CasesIf the string length is 1:"1"There is obviously only one segment, so we return:trueIf the string length is 2, both cases are valid:"11""10"Because neither creates multiple segments of ones.2. Traverse the StringWe loop through the string:for(int i = 0; i < s.length() - 1; i++)At every step, we compare:current characternext character3. Detect the Invalid PatternWe check this condition:if(s.charAt(i+1) == '1' && prev == '0')This means we found:0 → 1Which indicates a new segment of ones has started, so we return:false4. If No Violation is FoundIf we finish the loop without encountering the pattern:0 → 1then the string contains only one contiguous segment of ones, so we return:trueTime ComplexityO(n)Where:n = length of the stringWe traverse the string only once.Space ComplexityO(1)No extra space is used except a few variables.A Simpler Observation (Bonus Insight)A simpler trick for this problem is checking if the string contains:"01"Why?Because:111000 → validBut:1110011contains:01 → followed by another 1Which means a second segment of ones exists.Key Takeaways✔ Binary strings contain only 0 and 1✔ A segment means a continuous block✔ Valid strings contain only one block of ones✔ The invalid pattern is 0 followed by 1✔ The solution works with one linear scanFinal ThoughtsAlthough this problem is categorized as easy, it tests an important concept:Pattern detection while traversing strings.Problems like this are common in interviews because they evaluate:Logical reasoningEdge case handlingString traversal techniquesMastering such problems helps build a strong foundation for more complex string and pattern-matching algorithms.

LeetCodeJavaString ProblemsBinary StringsEasy
Minimum Changes to Make Alternating Binary String – LeetCode 1758 Explained

Minimum Changes to Make Alternating Binary String – LeetCode 1758 Explained

Try This QuestionBefore reading the solution, try solving the problem yourself on LeetCode:👉 https://leetcode.com/problems/minimum-changes-to-make-alternating-binary-string/Problem StatementYou are given a binary string s consisting only of characters '0' and '1'.In one operation, you can change any '0' to '1' or '1' to '0'.A string is called alternating if no two adjacent characters are the same.Example of Alternating Strings01010101011010Example of Non-Alternating Strings0001001111101Your task is to return the minimum number of operations required to make the string alternating.Example WalkthroughExample 1Inputs = "0100"Possible fix:0101Only the last character needs to change, so the answer is:Output1Example 2Inputs = "10"The string is already alternating.Output0Example 3Inputs = "1111"Possible alternating strings:01011010Minimum operations needed = 2Output2Key ObservationAn alternating binary string can only have two possible patterns:Pattern 10101010101...Pattern 21010101010...So instead of trying many combinations, we only need to check:1️⃣ How many changes are required to convert s → "010101..."2️⃣ How many changes are required to convert s → "101010..."Then we return the minimum of the two.ApproachStep 1Generate two possible alternating strings:s1 = "010101..."s2 = "101010..."Both will be of the same length as the input string.Step 2Compare the original string with both patterns.Count mismatches.For example:s = 0100s1 = 0101Mismatch count = 1Step 3Repeat for the second pattern.Finally return:min(mismatch1, mismatch2)Intuition Behind the SolutionInstead of flipping characters randomly, we compare the string with the two valid alternating possibilities.Why only two?Because:Alternating strings must start with either 0 or 1After that, the pattern is fixed.So we simply compute which pattern requires fewer changes.This makes the solution efficient and simple.Java Implementationclass Solution { public int minOperations(String s) { int co1 = 0; int co2 = 0; String s1 = ""; String s2 = ""; for(int i = 0; i < s.length(); i++){ if(i % 2 == 0){ s1 += "0"; } else { s1 += "1"; } } for(int i = 0; i < s.length(); i++){ if(i % 2 == 0){ s2 += "1"; } else { s2 += "0"; } } for(int i = 0; i < s.length(); i++){ if(s.charAt(i) != s1.charAt(i)){ co1++; } } for(int i = 0; i < s.length(); i++){ if(s.charAt(i) != s2.charAt(i)){ co2++; } } return Math.min(co1, co2); }}Complexity AnalysisTime ComplexityO(n)We iterate through the string a few times.Space ComplexityO(n)Because we create two extra strings of size n.Optimized Approach (Better Interview Answer)We can avoid creating extra strings and calculate mismatches directly.Optimized Java Codeclass Solution { public int minOperations(String s) { int pattern1 = 0; int pattern2 = 0; for(int i = 0; i < s.length(); i++){ char expected1 = (i % 2 == 0) ? '0' : '1'; char expected2 = (i % 2 == 0) ? '1' : '0'; if(s.charAt(i) != expected1) pattern1++; if(s.charAt(i) != expected2) pattern2++; } return Math.min(pattern1, pattern2); }}Space Complexity NowO(1)No extra strings required.Why This Problem Is ImportantThis problem teaches important interview concepts:✔ Pattern observation✔ Greedy thinking✔ String manipulation✔ Optimization techniquesMany companies ask similar pattern-based string problems.Final ThoughtsThe trick in this problem is realizing that only two alternating patterns exist. Once you identify that, the problem becomes straightforward.Instead of trying multiple modifications, you simply compare and count mismatches.This leads to a clean and efficient O(n) solution.If you are preparing for coding interviews, practicing problems like this will improve your pattern recognition skills, which is a key skill for solving medium and hard problems later.Happy Coding 🚀

LeetCodeBinary StringGreedy AlgorithmJavaEasy
Reverse Vowels of a String – From Extra Space Approach to Two Pointer Optimization (LeetCode 345)

Reverse Vowels of a String – From Extra Space Approach to Two Pointer Optimization (LeetCode 345)

🔗 Problem LinkLeetCode 345 – Reverse Vowels of a String 👉 https://leetcode.com/problems/reverse-vowels-of-a-string/IntroductionThis problem is very similar to Reverse Only Letters, but with a small twist:Instead of reversing all letters, we only reverse the vowels.At first, we might think of extracting vowels, reversing them, and putting them back. That works — but it is not the most optimal approach.In this article, we’ll:Understand the brute-force style approach (your solution)Analyze its time complexityOptimize it using the Two Pointer patternCompare both approaches📌 Problem UnderstandingYou are given a string s.You must:Reverse only the vowelsKeep all other characters in the same positionVowels include:a, e, i, o, uA, E, I, O, UExample 1Input: "IceCreAm"Output: "AceCreIm"Vowels: ['I','e','e','A'] Reversed: ['A','e','e','I']Example 2Input: "leetcode"Output: "leotcede"🧠 Your First Approach – Extract, Reverse, ReplaceYour idea:Extract all vowels into a string.Store their indices.Reverse the vowel string.Replace vowels at stored indices.Let’s look at your code.💻 Your Code (Extract & Replace Method)class Solution { public String reverseVowels(String s) { String vow = ""; List<Integer> lis = new ArrayList<>(); HashMap<Integer,Character> mp = new HashMap<>(); for(int i =0;i<s.length();i++){ if(((s.charAt(i) == 'a') || (s.charAt(i) == 'e') || (s.charAt(i) == 'i') || (s.charAt(i) == 'o') || (s.charAt(i) == 'u') || (s.charAt(i) == 'A') || (s.charAt(i) == 'E') || (s.charAt(i) == 'I') || (s.charAt(i) == 'O') || (s.charAt(i) == 'U')) ){ vow += s.charAt(i); lis.add(i); } } String so = ""; for(int i = vow.length()-1; i >= 0; i--){ so += vow.charAt(i); } for(int i =0; i< lis.size();i++){ mp.put(lis.get(i), so.charAt(i)); } String ans = ""; for(int i =0 ; i< s.length();i++){ if(mp.containsKey(i)){ ans += mp.get(i); }else{ ans += s.charAt(i); } } return ans; }}🔍 How This WorksStep 1 – Extract VowelsStore:Vowel characters in vowTheir indices in lisStep 2 – Reverse the Vowel StringCreate new reversed string so.Step 3 – Map Indices to Reversed VowelsUse a HashMap to store:index → reversed vowelStep 4 – Build Final StringTraverse original string:If index in map → use reversed vowelElse → use original character⚠️ Problem with This ApproachAlthough correct, it has inefficiencies:String concatenation (+=) → O(n²) in worst caseExtra space used:Vowel stringList of indicesHashMapFinal answer stringTime Complexity: O(n²) (due to string concatenation) Space Complexity: O(n)We can do better.🚀 Optimized Approach – Two Pointers (Best Solution)Instead of extracting vowels separately, we can:Convert string into char arrayUse two pointersSwap vowels directlyThis avoids extra structures.💻 Optimized Two Pointer Solutionclass Solution { public String reverseVowels(String s) { int i = 0, j = s.length() - 1; char[] arr = s.toCharArray(); while(i < j){ if(!isVowel(arr[i])){ i++; } else if(!isVowel(arr[j])){ j--; } else{ char temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; i++; j--; } } return new String(arr); } private boolean isVowel(char c){ return c=='a'||c=='e'||c=='i'||c=='o'||c=='u'|| c=='A'||c=='E'||c=='I'||c=='O'||c=='U'; }}🎯 Why This WorksWe:Move left pointer until vowel foundMove right pointer until vowel foundSwapContinueNo extra storage needed.⏱ Complexity ComparisonYour ApproachTime: O(n²) (string concatenation)Space: O(n)Two Pointer ApproachTime: O(n)Space: O(n) (char array)Much cleaner and faster.🔥 Key LearningThis problem reinforces:Two pointer patternIn-place modificationAvoiding unnecessary extra spaceRecognizing optimization opportunitiesWhenever you see:"Reverse something but keep other elements fixed"Think:👉 Two Pointers🏁 Final ThoughtsYour approach shows strong logical thinking:Extract → Reverse → ReplaceThat’s a valid way to solve it.But the optimized two-pointer approach is more interview-friendly.If you master this pattern, you can easily solve:Reverse Only LettersReverse StringValid PalindromeRemove Duplicates from Sorted Array

Two PointersString ManipulationHashMapLeetCodeEasy
All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

IntroductionThe Power Set problem for strings is a classic question in recursion and backtracking, frequently asked in coding interviews and platforms like GeeksforGeeks.In this problem, instead of numbers, we deal with strings and generate all possible subsequences (not substrings). This makes it slightly more interesting and practical for real-world applications like pattern matching, text processing, and combinatorics.In this article, we will cover:Intuition behind subsequencesRecursive (backtracking) approachSorting for lexicographical orderAlternative approachesComplexity analysisProblem StatementGiven a string s of length n, generate all non-empty subsequences of the string.RequirementsReturn only non-empty subsequencesOutput must be in lexicographically sorted orderExamplesExample 1Input:s = "abc"Output:a ab abc ac b bc cExample 2Input:s = "aa"Output:a a aaSubsequence vs Substring (Important)Substring: Continuous charactersSubsequence: Characters can be skippedExample for "abc":Subsequences → a, b, c, ab, ac, bc, abcKey InsightFor every character, we have two choices:Include it OR Exclude itSo total subsequences:2^nWe generate all and then remove the empty string.Approach 1: Recursion (Backtracking)IntuitionAt each index:Skip the characterInclude the characterBuild all combinations recursivelyJava Code (With Explanation)import java.util.*;class Solution { // List to store all subsequences List<String> a = new ArrayList<>(); void sub(String s, int ind, String curr) { // Base case: reached end of string if (ind == s.length()) { a.add(curr); // add current subsequence return; } // Choice 1: Exclude current character sub(s, ind + 1, curr); // Choice 2: Include current character sub(s, ind + 1, curr + s.charAt(ind)); } public List<String> AllPossibleStrings(String s) { // Start recursion sub(s, 0, ""); // Remove empty string (not allowed) a.remove(""); // Sort lexicographically Collections.sort(a); return a; }}Step-by-Step Dry Run (s = "abc")Start: ""→ Exclude 'a' → "" → Exclude 'b' → "" → Exclude 'c' → "" → Include 'c' → "c" → Include 'b' → "b" → Exclude 'c' → "b" → Include 'c' → "bc"→ Include 'a' → "a" → Exclude 'b' → "a" → Exclude 'c' → "a" → Include 'c' → "ac" → Include 'b' → "ab" → Exclude 'c' → "ab" → Include 'c' → "abc"Final Output (After Sorting)a ab abc ac b bc cApproach 2: Bit ManipulationIntuitionEach subsequence can be represented using binary numbers:0 → exclude1 → includeCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); int n = s.length(); int total = 1 << n; // 2^n for (int i = 1; i < total; i++) { // start from 1 to avoid empty StringBuilder sb = new StringBuilder(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { sb.append(s.charAt(j)); } } result.add(sb.toString()); } Collections.sort(result); return result; }}Approach 3: Iterative (Expanding List)IdeaStart with empty listFor each character:Add it to all existing subsequencesCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); result.add(""); for (char ch : s.toCharArray()) { int size = result.size(); for (int i = 0; i < size; i++) { result.add(result.get(i) + ch); } } result.remove(""); Collections.sort(result); return result; }}Complexity AnalysisTime Complexity: O(n × 2ⁿ)Space Complexity: O(n × 2ⁿ)Why?Total subsequences = 2ⁿEach subsequence takes O(n) to buildWhy Sorting is RequiredThe recursion generates subsequences in random order, so we sort them:Collections.sort(result);This ensures lexicographical order as required.Key TakeawaysThis is a power set problem for stringsEach character → 2 choicesRecursion = most intuitive approachBit manipulation = most optimized thinkingAlways remove empty string if requiredCommon Interview VariationsSubsets of arrayPermutations of stringCombination sumSubsequence with conditionsConclusionThe Power Set problem is a fundamental building block in recursion and combinatorics. Once you understand the include/exclude pattern, you can solve a wide range of problems efficiently.Mastering this will significantly improve your ability to tackle backtracking and decision tree problems.Frequently Asked Questions (FAQs)1. Why is the empty string removed?Because the problem requires only non-empty subsequences.2. Why is time complexity O(n × 2ⁿ)?Because there are 2ⁿ subsequences and each takes O(n) time to construct.3. Which approach is best?Recursion → best for understandingBit manipulation → best for optimization

GeeksforGeeksRecursionJavaBacktrackingMedium
OOPs in Java - Complete Guide With Simple Examples

OOPs in Java - Complete Guide With Simple Examples

IntroductionObject Oriented Programming — or OOPs — is the foundation of Java. Almost every Java program you will ever write or read is built around OOPs concepts. The good news is these concepts are not complicated at all. They are actually modeled after how we think about real life things.By the end of this article you will understand every core OOPs concept clearly — not just enough to answer interview questions, but enough to actually use them confidently in your code.What Is Object Oriented Programming?Before OOPs, programmers wrote procedural code — a long sequence of instructions executed top to bottom. As programs grew bigger, this became a nightmare to manage. You could not organize related data and behavior together, reuse code cleanly, or model real world things naturally.OOPs solved this by organizing code around objects — just like the real world is organized around things. A car, a person, a bank account — each is a thing with properties and behaviors. OOPs lets you model these things directly in code.Java is a purely object oriented language (almost everything in Java is an object). That is why understanding OOPs is not optional in Java — it is essential.Class — The BlueprintA class is a blueprint or template. It defines what properties and behaviors an object of that type will have. The class itself is not an actual thing — it is just the design.Think of a class like an architectural blueprint of a house. The blueprint is not a house. But from one blueprint you can build many houses.class Car { // properties (what a car HAS) String brand; String color; int speed; // behaviors (what a car DOES) void accelerate() { System.out.println(brand + " is speeding up!"); } void brake() { System.out.println(brand + " is slowing down!"); }}Car is the blueprint. It defines that every car has a brand, color, speed, and can accelerate and brake. No actual car exists yet — this is just the design.Object — The Real ThingAn object is an actual instance created from a class. When you create an object, you are building a real house from the blueprint.public class Main { public static void main(String[] args) { // creating objects from the Car class Car car1 = new Car(); car1.brand = "Toyota"; car1.color = "Red"; car1.speed = 120; Car car2 = new Car(); car2.brand = "BMW"; car2.color = "Black"; car2.speed = 200; car1.accelerate(); // Toyota is speeding up! car2.brake(); // BMW is slowing down! }}car1 and car2 are two different objects from the same Car blueprint. Each has its own data but shares the same structure and behaviors.Constructor — The Object InitializerA constructor is a special method that runs automatically when an object is created. It is used to set initial values.class Car { String brand; String color; int speed; // constructor — same name as class, no return type Car(String brand, String color, int speed) { this.brand = brand; this.color = color; this.speed = speed; } void accelerate() { System.out.println(brand + " is speeding up!"); }}// Now creating objects is cleanerCar car1 = new Car("Toyota", "Red", 120);Car car2 = new Car("BMW", "Black", 200);The this keyword refers to the current object — it distinguishes between the parameter brand and the object's field brand.The Four Pillars of OOPsEverything in OOPs builds on four core concepts. These are what interviewers ask about and what real code is organized around.Pillar 1: Encapsulation — Wrapping and Protecting DataEncapsulation means bundling data (fields) and the methods that work on that data together in one class — and controlling access from outside.Think of a capsule pill. The medicine inside is protected by the outer shell. You do not mess with the medicine directly — you just swallow the capsule.In Java, encapsulation is achieved using access modifiers (private, public) and getters/setters.class BankAccount { private double balance; // private — no direct access from outside private String owner; BankAccount(String owner, double initialBalance) { this.owner = owner; this.balance = initialBalance; } // getter — read the balance public double getBalance() { return balance; } // setter with validation — controlled access public void deposit(double amount) { if (amount > 0) { balance += amount; System.out.println("Deposited: " + amount); } else { System.out.println("Invalid amount!"); } } public void withdraw(double amount) { if (amount > 0 && amount <= balance) { balance -= amount; } else { System.out.println("Insufficient funds!"); } }}BankAccount account = new BankAccount("Alice", 1000);// account.balance = -5000; // ERROR — private, cannot access directlyaccount.deposit(500); // controlled access through methodSystem.out.println(account.getBalance()); // 1500.0Why encapsulation matters: Without it, anyone could set balance = -999999 directly. With it, you control exactly how data can be changed — protecting your object's integrity.Pillar 2: Inheritance — Reusing Code Through Parent-Child RelationshipInheritance allows one class to acquire the properties and behaviors of another class. The child class gets everything the parent has and can add its own things on top.Think of it like genetics. A child inherits traits from their parents but also develops their own unique characteristics.In Java, inheritance uses the extends keyword.// Parent classclass Animal { String name; Animal(String name) { this.name = name; } void eat() { System.out.println(name + " is eating."); } void sleep() { System.out.println(name + " is sleeping."); }}// Child class inherits from Animalclass Dog extends Animal { String breed; Dog(String name, String breed) { super(name); // calls Animal's constructor this.breed = breed; } // Dog's own behavior void bark() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } void meow() { System.out.println(name + " says: Meow!"); }}Dog dog = new Dog("Buddy", "Labrador");dog.eat(); // inherited from Animal — Buddy is eating.dog.sleep(); // inherited from Animal — Buddy is sleeping.dog.bark(); // Dog's own method — Buddy says: Woof!Cat cat = new Cat("Whiskers");cat.eat(); // inherited — Whiskers is eating.cat.meow(); // Cat's own — Whiskers says: Meow!super() calls the parent class constructor. super.methodName() calls a parent class method.Why inheritance matters: You write eat() and sleep() once in Animal and every animal class gets them for free. No repetition, clean organization.Pillar 3: Polymorphism — One Interface, Many FormsPolymorphism means the same method name behaves differently depending on the object calling it. It comes in two flavors.The word itself means "many forms" — same action, different results based on who is doing it.Think of a "speak" command given to different animals. You tell a dog to speak — it barks. You tell a cat to speak — it meows. Same command, different behavior.Method Overriding (Runtime Polymorphism)A child class provides its own version of a method already defined in the parent class.class Animal { String name; Animal(String name) { this.name = name; } void makeSound() { System.out.println(name + " makes a sound."); }}class Dog extends Animal { Dog(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Woof!"); }}class Cat extends Animal { Cat(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Meow!"); }}class Cow extends Animal { Cow(String name) { super(name); } @Override void makeSound() { System.out.println(name + " says: Moo!"); }}Animal[] animals = { new Dog("Buddy"), new Cat("Whiskers"), new Cow("Bella")};for (Animal a : animals) { a.makeSound(); // different behavior for each!}// Buddy says: Woof!// Whiskers says: Meow!// Bella says: Moo!Same makeSound() call on an Animal reference — but the actual behavior depends on what the object really is at runtime. That is runtime polymorphism.Method Overloading (Compile-Time Polymorphism)Same method name, different parameters in the same class.class Calculator { int add(int a, int b) { return a + b; } double add(double a, double b) { return a + b; } int add(int a, int b, int c) { return a + b + c; }}Calculator calc = new Calculator();calc.add(2, 3); // calls first method — 5calc.add(2.5, 3.5); // calls second method — 6.0calc.add(1, 2, 3); // calls third method — 6Java decides which version to call at compile time based on the argument types and count.Pillar 4: Abstraction — Hiding Complexity, Showing EssentialsAbstraction means showing only the necessary details to the user and hiding the internal complexity. You expose what something does, not how it does it.Think of driving a car. You know the steering wheel turns the car and the pedal accelerates it. You do not need to know how the engine combustion works internally. The complexity is hidden — only what you need to use is exposed.Java achieves abstraction through abstract classes and interfaces.Abstract ClassAn abstract class cannot be instantiated directly. It can have abstract methods (no body — child must implement) and regular methods (with body).abstract class Shape { String color; Shape(String color) { this.color = color; } // abstract method — no body, child MUST implement abstract double calculateArea(); // regular method — shared behavior void displayColor() { System.out.println("Color: " + color); }}class Circle extends Shape { double radius; Circle(String color, double radius) { super(color); this.radius = radius; } @Override double calculateArea() { return Math.PI * radius * radius; }}class Rectangle extends Shape { double width, height; Rectangle(String color, double width, double height) { super(color); this.width = width; this.height = height; } @Override double calculateArea() { return width * height; }}Shape circle = new Circle("Red", 5);Shape rect = new Rectangle("Blue", 4, 6);circle.displayColor(); // Color: RedSystem.out.println(circle.calculateArea()); // 78.53...System.out.println(rect.calculateArea()); // 24.0InterfaceAn interface is a 100% abstract contract — it only defines what methods a class must have, with no implementation (in older Java). A class can implement multiple interfaces.interface Flyable { void fly(); // every class implementing this MUST define fly()}interface Swimmable { void swim();}class Duck implements Flyable, Swimmable { @Override public void fly() { System.out.println("Duck is flying!"); } @Override public void swim() { System.out.println("Duck is swimming!"); }}Duck duck = new Duck();duck.fly(); // Duck is flying!duck.swim(); // Duck is swimming!Key difference between abstract class and interface:A class can extend only one abstract class but can implement multiple interfaces. Use abstract class when classes share common code. Use interface when you want to define a contract that unrelated classes can follow.Access Modifiers — Quick ReferenceAccess modifiers control who can access your class members:ModifierSame ClassSame PackageSubclassEverywhereprivate✅❌❌❌default✅✅❌❌protected✅✅✅❌public✅✅✅✅General rule — make fields private, make methods public unless there is a reason not to. This is encapsulation in practice.Quick Summary — All OOPs Concepts in One PlaceClass — Blueprint/template that defines structure and behaviorObject — Real instance created from a class using newConstructor — Special method that initializes an object when createdEncapsulation — Bundle data and methods together, control access with private/publicInheritance — Child class gets parent's properties and behaviors using extendsPolymorphism — Same method name behaves differently (overriding = runtime, overloading = compile time)Abstraction — Hide complexity, show only essentials using abstract class or interfaceFAQs — People Also AskQ1. What is the difference between a class and an object in Java? A class is the blueprint — it defines structure but does not exist in memory as a usable thing. An object is a real instance created from that blueprint using new. You can create many objects from one class, just like building many houses from one blueprint.Q2. What is the difference between abstract class and interface in Java? An abstract class can have both abstract (no body) and concrete (with body) methods, and a class can extend only one. An interface traditionally has only abstract methods and a class can implement multiple interfaces. Use abstract class for shared code, interface for defining contracts.Q3. What is the difference between method overriding and overloading? Overriding happens in a parent-child relationship — the child redefines a parent method with the same name and parameters. Overloading happens in the same class — same method name but different parameters. Overriding is resolved at runtime, overloading at compile time.Q4. Why is OOPs important in Java? Java is built entirely around OOPs. Every piece of Java code lives inside a class. OOPs enables code reuse through inheritance, data protection through encapsulation, flexibility through polymorphism, and simplicity through abstraction — all essential for building large, maintainable applications.ConclusionOOPs in Java is not a collection of confusing terms — it is a natural way of thinking about and organizing code. Classes are blueprints, objects are real things, encapsulation protects data, inheritance reuses code, polymorphism provides flexibility, and abstraction hides complexity.Once these four pillars feel natural, you will start seeing them everywhere — in every Java library, every framework, every codebase. That is when Java truly starts to click.

OOPsJavaClassesObjectsInheritancePolymorphismEncapsulationAbstraction
LeetCode 2390: Removing Stars From a String — Java Solution With All Approaches Explained

LeetCode 2390: Removing Stars From a String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 2390 Removing Stars From a String?If you are preparing for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 2390 Removing Stars From a String is a must-solve problem. It tests your understanding of the stack data structure and string manipulation — two of the most frequently tested topics in technical interviews.In this article, we will cover:What the problem is asking in plain English3 different Java approaches (Brute Force, Stack, StringBuilder)Step-by-step dry run with examplesTime and space complexity for each approachCommon mistakes to avoidFAQs that appear in Google's People Also AskLet's dive in!Problem Statement SummaryYou are given a string s containing lowercase letters and stars *. In one operation:Choose any * in the stringRemove the * itself AND the closest non-star character to its leftRepeat until all stars are removed and return the final string.Example:Input: s = "leet**cod*e"Output: "lecoe"Real Life Analogy — Think of It as a Backspace KeyImagine you are typing on a keyboard. Every * acts as your backspace key — it deletes itself and the character just before it.You type "leet" and press backspace twice:Backspace 1 → deletes t → "lee"Backspace 2 → deletes e → "le"That is exactly what this problem simulates! Once you see it this way, the solution becomes very obvious.Approach 1: Brute Force Simulation (Beginner Friendly)IdeaDirectly simulate the process the problem describes:Scan the string from left to rightFind the first *Remove it and the character just before itRepeat until no stars remainJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder(s);int i = 0;while (i < sb.length()) {if (sb.charAt(i) == '*') {sb.deleteCharAt(i); // remove the starif (i > 0) {sb.deleteCharAt(i - 1); // remove closest left characteri--;}} else {i++;}}return sb.toString();}Time and Space ComplexityComplexityValueReasonTimeO(n²)Each deletion shifts all remaining charactersSpaceO(n)StringBuilder storage⚠️ Important WarningThis problem has n up to 100,000. Brute force will get Time Limit Exceeded (TLE) on LeetCode. Use this only to understand the concept, never in production or interviews.Approach 2: Stack Based Solution (Interview Favorite)IdeaA stack is the perfect data structure here because:We always remove the most recently added letter when a * appearsThat is the definition of Last In First Out (LIFO) — exactly what a stack doesAlgorithm:Letter → push onto stack* → pop from stack (removes closest left character)At the end, build result from stack contentsJava Codepublic String removeStars(String s) {Stack<Character> st = new Stack<>();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (!st.empty()) {st.pop();}} else {st.push(c);}}StringBuilder sb = new StringBuilder();while (!st.empty()) {sb.append(st.pop());}return sb.reverse().toString();}Step-by-Step Dry Run — "leet**cod*e"StepCharacterActionStack State1lpush[l]2epush[l,e]3epush[l,e,e]4tpush[l,e,e,t]5*pop t[l,e,e]6*pop e[l,e]7cpush[l,e,c]8opush[l,e,c,o]9dpush[l,e,c,o,d]10*pop d[l,e,c,o]11epush[l,e,c,o,e]✅ Final Answer: "lecoe"Time and Space ComplexityComplexityValueReasonTimeO(n)Single pass through the stringSpaceO(n)Stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅IdeaThis is the best and most optimized approach. A StringBuilder can act as a stack:append(c) → works like pushdeleteCharAt(sb.length() - 1) → works like popNo reverse needed at the end unlike the Stack approachJava Codepublic String removeStars(String s) {StringBuilder sb = new StringBuilder();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '*') {if (sb.length() > 0) {sb.deleteCharAt(sb.length() - 1);}} else {sb.append(c);}}return sb.toString();}Step-by-Step Dry Run — "erase*****"StepCharacterActionStringBuilder1eappend"e"2rappend"er"3aappend"era"4sappend"eras"5eappend"erase"6*delete last"eras"7*delete last"era"8*delete last"er"9*delete last"e"10*delete last""✅ Final Answer: ""Why StringBuilder Beats Stack in JavaFactorStack<Character>StringBuilderMemoryBoxes char → Character objectWorks on primitives directlyReverse neededYesNoCode lengthMore verboseCleaner and shorterPerformanceSlightly slowerFasterTime and Space ComplexityComplexityValueReasonTimeO(n)One pass, each character processed onceSpaceO(n)StringBuilder storageAll Approaches Comparison TableApproachTimeSpacePasses LeetCode?Best ForBrute ForceO(n²)O(n)❌ TLEUnderstanding conceptStackO(n)O(n)✅ YesInterview explanationStringBuilderO(n)O(n)✅ YesBest solutionHow This Relates to LeetCode 3174 Clear DigitsIf you have already solved LeetCode 3174 Clear Digits, you will notice this problem is nearly identical:Feature3174 Clear Digits2390 Removing StarsTriggerDigit 0-9Star *RemovesClosest left non-digitClosest left non-starDifficultyEasyMediumBest approachStringBuilderStringBuilderThe exact same solution pattern works for both. This is why learning patterns matters more than memorizing individual solutions!Common Mistakes to Avoid1. Not checking sb.length() > 0 before deleting Even though the problem guarantees valid input, always add this guard. It shows clean, defensive coding in interviews.2. Forgetting to reverse when using Stack Stack gives you characters in reverse order. If you forget .reverse(), your answer will be backwards.3. Using Brute Force for large inputs With n up to 100,000, O(n²) will time out. Always use the O(n) approach.FAQs — People Also AskQ1. What data structure is best for LeetCode 2390? A Stack or StringBuilder used as a stack is the best data structure. Both give O(n) time complexity. StringBuilder is slightly more optimal in Java because it avoids object boxing overhead.Q2. Why does a star remove the closest left character? Because the problem defines it that way — think of * as a backspace key on a keyboard. It always deletes the character immediately before the cursor position.Q3. What is the time complexity of LeetCode 2390? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 2390 asked in Google interviews? Yes, this type of stack simulation problem is commonly asked at Google, Amazon, Microsoft, and Meta interviews as it tests understanding of LIFO operations and string manipulation.Q5. What is the difference between LeetCode 2390 and LeetCode 844? Both use the same backspace simulation pattern. In 844 Backspace String Compare, # is the backspace character and you compare two strings. In 2390, * is the backspace and you return the final string.Similar LeetCode Problems to Practice NextProblemDifficultyPattern844. Backspace String CompareEasyStack simulation1047. Remove All Adjacent Duplicates In StringEasyStack simulation3174. Clear DigitsEasyStack simulation20. Valid ParenthesesEasyClassic stack735. Asteroid CollisionMediumStack simulationConclusionLeetCode 2390 Removing Stars From a String is a classic stack simulation problem that every developer preparing for coding interviews should master. The key insight is recognizing that * behaves exactly like a backspace key, which makes a stack or StringBuilder the perfect tool.Quick Recap:Brute force works conceptually but TLEs on large inputsStack solution is clean and great for explaining in interviewsStringBuilder solution is the most optimal in Java — no boxing, no reversal

StringStackMediumLeetCode
Stack Data Structure in Java: The Complete In-Depth Guide

Stack Data Structure in Java: The Complete In-Depth Guide

1. What Is a Stack?A Stack is a linear data structure that stores elements in a sequential order, but with one strict rule — you can only insert or remove elements from one end, called the top.It is one of the simplest yet most powerful data structures in computer science. Its strength comes from its constraint. Because everything happens at one end, the behavior of a stack is completely predictable.The formal definition: A Stack is a linear data structure that follows the Last In, First Out (LIFO) principle — the element inserted last is the first one to be removed.Here is what a stack looks like visually: ┌──────────┐ │ 50 │ ← TOP (last inserted, first removed) ├──────────┤ │ 40 │ ├──────────┤ │ 30 │ ├──────────┤ │ 20 │ ├──────────┤ │ 10 │ ← BOTTOM (first inserted, last removed) └──────────┘When you push 60 onto this stack, it goes on top. When you pop, 60 comes out first. That is LIFO.2. Real-World AnalogiesBefore writing a single line of code, it helps to see stacks in the real world. These analogies will make the concept permanently stick.A Pile of Plates In a cafeteria, clean plates are stacked on top of each other. You always pick the top plate. You always place a new plate on top. You never reach into the middle. This is a stack.Browser Back Button Every time you visit a new webpage, it gets pushed onto a history stack. When you press the Back button, the browser pops the most recent page off the stack and takes you there. The page you visited first is at the bottom — you only reach it after going back through everything else.Undo Feature in Text Editors When you type in a document and press Ctrl+Z, the most recent action is undone first. That is because every action you perform is pushed onto a stack. Undo simply pops from that stack.Call Stack in Programming When a function calls another function, the current function's state is pushed onto the call stack. When the inner function finishes, it is popped off and execution returns to the outer function. This is the literal stack your programs run on.A Stack of Books Put five books on a table, one on top of another. You can only take the top book without knocking the pile over. That is a stack.3. The LIFO Principle ExplainedLIFO stands for Last In, First Out.It means whatever you put in last is the first thing to come out. This is the exact opposite of a Queue (which is FIFO — First In, First Out).Let us trace through an example step by step:Start: Stack is empty → []Push 10 → [10] (10 is at the top)Push 20 → [10, 20] (20 is at the top)Push 30 → [10, 20, 30] (30 is at the top)Pop → returns 30 (30 was last in, first out) Stack: [10, 20]Pop → returns 20 Stack: [10]Peek → returns 10 (just looks, does not remove) Stack: [10]Pop → returns 10 Stack: [] (stack is now empty)Every single operation happens only at the top. The bottom of the stack is never directly accessible.4. Stack Operations & Time ComplexityA stack supports the following core operations:OperationDescriptionTime Complexitypush(x)Insert element x onto the top of the stackO(1)pop()Remove and return the top elementO(1)peek() / top()Return the top element without removing itO(1)isEmpty()Check if the stack has no elementsO(1)isFull()Check if the stack has reached its capacity (Array only)O(1)size()Return the number of elements in the stackO(1)search(x)Find position of element from top (Java built-in only)O(n)All primary stack operations — push, pop, peek, isEmpty — run in O(1) constant time. This is what makes the stack so efficient. It does not matter whether the stack has 10 elements or 10 million — these operations are always instant.Space complexity for a stack holding n elements is O(n).5. Implementation 1 — Using a Static ArrayThis is the most fundamental way to implement a stack. We use a fixed-size array and a variable called top to track where the top of the stack currently is.How it works:top starts at -1 (stack is empty)On push: increment top, then place the element at arr[top]On pop: return arr[top], then decrement topOn peek: return arr[top] without changing it// StackUsingArray.javapublic class StackUsingArray { private int[] arr; private int top; private int capacity; // Constructor — initialize with a fixed capacity public StackUsingArray(int capacity) { this.capacity = capacity; arr = new int[capacity]; top = -1; } // Push: add element to the top public void push(int value) { if (isFull()) { System.out.println("Stack Overflow! Cannot push " + value); return; } arr[++top] = value; System.out.println("Pushed: " + value); } // Pop: remove and return top element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } return arr[top--]; } // Peek: view the top element without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return arr[top]; } // Check if stack is empty public boolean isEmpty() { return top == -1; } // Check if stack is full public boolean isFull() { return top == capacity - 1; } // Return current size public int size() { return top + 1; } // Display all elements public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = top; i >= 0; i--) { System.out.print(arr[i] + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArray stack = new StackUsingArray(5); stack.push(10); stack.push(20); stack.push(30); stack.push(40); stack.push(50); stack.push(60); // This will trigger Stack Overflow stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 10Pushed: 20Pushed: 30Pushed: 40Pushed: 50Stack Overflow! Cannot push 60Stack (top → bottom): 50 40 30 20 10Peek: 50Pop: 50Pop: 40Stack (top → bottom): 30 20 10Size: 3Key Points about Array Implementation:Fixed size — you must declare capacity upfrontVery fast — direct array index accessStack Overflow is possible if capacity is exceededMemory is pre-allocated even if stack is not full6. Implementation 2 — Using an ArrayListAn ArrayList-based stack removes the fixed-size limitation. The ArrayList grows dynamically, so you never have to worry about stack overflow due to capacity.How it works:The end of the ArrayList acts as the topadd() is used for pushremove(size - 1) is used for popget(size - 1) is used for peek// StackUsingArrayList.javaimport java.util.ArrayList;public class StackUsingArrayList { private ArrayList<Integer> list; // Constructor public StackUsingArrayList() { list = new ArrayList<>(); } // Push: add to the end (which is our top) public void push(int value) { list.add(value); System.out.println("Pushed: " + value); } // Pop: remove and return the last element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int top = list.get(list.size() - 1); list.remove(list.size() - 1); return top; } // Peek: view the last element public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return list.get(list.size() - 1); } // Check if stack is empty public boolean isEmpty() { return list.isEmpty(); } // Return size public int size() { return list.size(); } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = list.size() - 1; i >= 0; i--) { System.out.print(list.get(i) + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArrayList stack = new StackUsingArrayList(); stack.push(5); stack.push(15); stack.push(25); stack.push(35); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Is Empty: " + stack.isEmpty()); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 5Pushed: 15Pushed: 25Pushed: 35Stack (top → bottom): 35 25 15 5Peek: 35Pop: 35Pop: 25Stack (top → bottom): 15 5Is Empty: falseSize: 2Key Points about ArrayList Implementation:Dynamic size — grows automatically as neededNo overflow riskSlight overhead compared to raw array due to ArrayList internalsExcellent for most practical use cases7. Implementation 3 — Using a LinkedListA LinkedList-based stack is the most memory-efficient approach when you do not know the stack size in advance. Each element (node) holds data and a pointer to the next node. The head of the LinkedList acts as the top of the stack.How it works:Each node stores a value and a reference to the node below itPush creates a new node and makes it the new headPop removes the head node and returns its valuePeek returns the head node's value without removing it// StackUsingLinkedList.javapublic class StackUsingLinkedList { // Inner Node class private static class Node { int data; Node next; Node(int data) { this.data = data; this.next = null; } } private Node top; // Head of the linked list = top of stack private int size; // Constructor public StackUsingLinkedList() { top = null; size = 0; } // Push: create new node and link it to top public void push(int value) { Node newNode = new Node(value); newNode.next = top; // new node points to current top top = newNode; // new node becomes the new top size++; System.out.println("Pushed: " + value); } // Pop: remove and return top node's data public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int value = top.data; top = top.next; // move top pointer to next node size--; return value; } // Peek: return top node's data without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return top.data; } // Check if empty public boolean isEmpty() { return top == null; } // Return size public int size() { return size; } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); Node current = top; while (current != null) { System.out.print(current.data + " "); current = current.next; } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingLinkedList stack = new StackUsingLinkedList(); stack.push(100); stack.push(200); stack.push(300); stack.push(400); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 100Pushed: 200Pushed: 300Pushed: 400Stack (top → bottom): 400 300 200 100Peek: 400Pop: 400Pop: 300Stack (top → bottom): 200 100Size: 2Key Points about LinkedList Implementation:Truly dynamic — each node allocated only when neededNo wasted memory from pre-allocationSlightly more memory per element (each node carries a pointer)Ideal for stacks where size is completely unknown8. Java's Built-in Stack ClassJava provides a ready-made Stack class inside java.util. It extends Vector and is thread-safe by default.// JavaBuiltinStack.javaimport java.util.Stack;public class JavaBuiltinStack { public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); // Push elements stack.push(10); stack.push(20); stack.push(30); stack.push(40); System.out.println("Stack: " + stack); // Peek — look at top without removing System.out.println("Peek: " + stack.peek()); // Pop — remove top System.out.println("Pop: " + stack.pop()); System.out.println("After pop: " + stack); // Search — returns 1-based position from top System.out.println("Search 20: position " + stack.search(20)); // isEmpty System.out.println("Is Empty: " + stack.isEmpty()); // Size System.out.println("Size: " + stack.size()); }}```**Output:**```Stack: [10, 20, 30, 40]Peek: 40Pop: 40After pop: [10, 20, 30]Search 20: position 2Is Empty: falseSize: 3Important Note: In modern Java development, it is often recommended to use Deque (specifically ArrayDeque) instead of Stack for better performance, since Stack is synchronized and carries the overhead of Vector.// Using ArrayDeque as a stack (modern preferred approach)import java.util.ArrayDeque;import java.util.Deque;public class ModernStack { public static void main(String[] args) { Deque<Integer> stack = new ArrayDeque<>(); stack.push(10); // pushes to front stack.push(20); stack.push(30); System.out.println("Top: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Stack: " + stack); }}9. Comparison of All ImplementationsFeatureArrayArrayListLinkedListJava StackArrayDequeSizeFixedDynamicDynamicDynamicDynamicStack Overflow RiskYesNoNoNoNoMemory UsagePre-allocatedAuto-growsPer-node overheadAuto-growsAuto-growsPush TimeO(1)O(1) amortizedO(1)O(1)O(1)Pop TimeO(1)O(1)O(1)O(1)O(1)Peek TimeO(1)O(1)O(1)O(1)O(1)Thread SafeNoNoNoYesNoBest ForKnown size, max speedGeneral useUnknown/huge sizeLegacy codeModern Java10. Advantages & DisadvantagesAdvantagesAdvantageExplanationSimple to implementVery few rules and operations to worry aboutO(1) operationsPush, pop, and peek are all constant timeMemory efficientNo extra pointers needed (array-based)Supports recursionThe call stack is itself a stackEasy undo/redoNatural fit for reversible action trackingBacktrackingPerfectly suited for maze, puzzle, and game solvingExpression evaluationPowers compilers and calculatorsDisadvantagesDisadvantageExplanationLimited accessCannot access elements in the middle directlyFixed size (array)Array-based stacks overflow if size is exceededNo random accessYou cannot do stack[2] — only top is accessibleMemory waste (array)Pre-allocated array wastes space if underusedNot suitable for all problemsMany problems need queues, trees, or graphs insteadStack overflow in recursionVery deep recursion can overflow the JVM call stack11. Real-World Use Cases of StackUnderstanding when to use a stack is just as important as knowing how to implement one. Here is where stacks show up in real software:Function Call Management (Call Stack) Every time your Java program calls a method, the JVM pushes that method's frame onto the call stack. When the method returns, the frame is popped. This is why you see "StackOverflowError" when you write infinite recursion.Undo and Redo Operations Text editors, image editors (Photoshop), and IDEs use two stacks — one for undo history and one for redo history. Every action pushes onto the undo stack. Ctrl+Z pops from it and pushes to the redo stack.Browser Navigation Your browser maintains a back-stack and a forward-stack. Visiting a new page pushes to the back-stack. Pressing Back pops from it and pushes to the forward-stack.Expression Evaluation and Conversion Compilers use stacks to evaluate arithmetic expressions and convert between infix, prefix, and postfix notations. For example: 3 + 4 * 2 must be evaluated considering operator precedence — this is done with a stack.Balanced Parentheses Checking Linters, compilers, and IDEs use stacks to check if brackets are balanced: {[()]} is valid, {[(])} is not.Backtracking Algorithms Maze solving, N-Queens, Sudoku solvers, and depth-first search all use stacks (explicitly or via recursion) to backtrack to previous states when a path fails.Syntax Parsing Compilers parse source code using stacks to match opening and closing constructs like if/else, try/catch, { and }.12. Practice Problems with Full SolutionsHere is where things get really interesting. These problems will sharpen your stack intuition and prepare you for coding interviews.Problem 1 — Reverse a String Using a StackDifficulty: EasyProblem: Write a Java program to reverse a string using a Stack.Approach: Push every character of the string onto a stack, then pop them all. Since LIFO reverses the order, the characters come out reversed.// ReverseString.javaimport java.util.Stack;public class ReverseString { public static String reverse(String str) { Stack<Character> stack = new Stack<>(); // Push all characters for (char c : str.toCharArray()) { stack.push(c); } // Pop all characters to build reversed string StringBuilder reversed = new StringBuilder(); while (!stack.isEmpty()) { reversed.append(stack.pop()); } return reversed.toString(); } public static void main(String[] args) { System.out.println(reverse("hello")); // olleh System.out.println(reverse("java")); // avaj System.out.println(reverse("racecar")); // racecar (palindrome) System.out.println(reverse("datastructure")); // erutcurtasatad }}Problem 2 — Check Balanced ParenthesesDifficulty: Easy–MediumProblem: Given a string containing (, ), {, }, [, ], determine if the brackets are balanced.Approach: Push every opening bracket onto the stack. When you see a closing bracket, check if it matches the top of the stack. If it does, pop. If it does not, the string is unbalanced.// BalancedParentheses.javaimport java.util.Stack;public class BalancedParentheses { public static boolean isBalanced(String expr) { Stack<Character> stack = new Stack<>(); for (char c : expr.toCharArray()) { // Push all opening brackets if (c == '(' || c == '{' || c == '[') { stack.push(c); } // For closing brackets, check the top of stack else if (c == ')' || c == '}' || c == ']') { if (stack.isEmpty()) return false; char top = stack.pop(); if (c == ')' && top != '(') return false; if (c == '}' && top != '{') return false; if (c == ']' && top != '[') return false; } } // Stack must be empty at the end for a balanced expression return stack.isEmpty(); } public static void main(String[] args) { System.out.println(isBalanced("{[()]}")); // true System.out.println(isBalanced("{[(])}")); // false System.out.println(isBalanced("((()))")); // true System.out.println(isBalanced("{]")); // false System.out.println(isBalanced("")); // true (empty is balanced) }}Problem 3 — Reverse a Stack (Without Extra Data Structure)Difficulty: Medium–HardProblem: Reverse all elements of a stack using only recursion — no array or extra stack allowed.Approach: This is a classic recursion problem. You need two recursive functions:insertAtBottom(stack, item) — inserts an element at the very bottom of the stackreverseStack(stack) — pops all elements, reverses, and uses insertAtBottom to rebuild// ReverseStack.javaimport java.util.Stack;public class ReverseStack { // Insert an element at the bottom of the stack public static void insertAtBottom(Stack<Integer> stack, int item) { if (stack.isEmpty()) { stack.push(item); return; } int top = stack.pop(); insertAtBottom(stack, item); stack.push(top); } // Reverse the stack using insertAtBottom public static void reverseStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); reverseStack(stack); // reverse the remaining stack insertAtBottom(stack, top); // insert popped element at bottom } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(1); stack.push(2); stack.push(3); stack.push(4); stack.push(5); System.out.println("Before: " + stack); // [1, 2, 3, 4, 5] reverseStack(stack); System.out.println("After: " + stack); // [5, 4, 3, 2, 1] }}Problem 4 — Evaluate a Postfix ExpressionDifficulty: MediumProblem: Evaluate a postfix (Reverse Polish Notation) expression. Example: "2 3 4 * +" should return 14 because it is 2 + (3 * 4).Approach: Scan left to right. If you see a number, push it. If you see an operator, pop two numbers, apply the operator, and push the result.// PostfixEvaluation.javaimport java.util.Stack;public class PostfixEvaluation { public static int evaluate(String expression) { Stack<Integer> stack = new Stack<>(); String[] tokens = expression.split(" "); for (String token : tokens) { // If it's a number, push it if (token.matches("-?\\d+")) { stack.push(Integer.parseInt(token)); } // If it's an operator, pop two and apply else { int b = stack.pop(); // second operand int a = stack.pop(); // first operand switch (token) { case "+": stack.push(a + b); break; case "-": stack.push(a - b); break; case "*": stack.push(a * b); break; case "/": stack.push(a / b); break; } } } return stack.pop(); } public static void main(String[] args) { System.out.println(evaluate("2 3 4 * +")); // 14 → 2 + (3*4) System.out.println(evaluate("5 1 2 + 4 * + 3 -")); // 14 → 5+((1+2)*4)-3 System.out.println(evaluate("3 4 +")); // 7 }}Problem 5 — Next Greater ElementDifficulty: MediumProblem: For each element in an array, find the next greater element to its right. If none exists, output -1.Example: Input: [4, 5, 2, 10, 8] → Output: [5, 10, 10, -1, -1]Approach: Iterate right to left. Maintain a stack of candidates. For each element, pop all stack elements that are smaller than or equal to it — they can never be the answer for any element to the left. The top of the stack (if not empty) is the next greater element.// NextGreaterElement.javaimport java.util.Stack;import java.util.Arrays;public class NextGreaterElement { public static int[] nextGreater(int[] arr) { int n = arr.length; int[] result = new int[n]; Stack<Integer> stack = new Stack<>(); // stores elements, not indices // Traverse from right to left for (int i = n - 1; i >= 0; i--) { // Pop elements smaller than or equal to current while (!stack.isEmpty() && stack.peek() <= arr[i]) { stack.pop(); } // Next greater element result[i] = stack.isEmpty() ? -1 : stack.peek(); // Push current element for future comparisons stack.push(arr[i]); } return result; } public static void main(String[] args) { int[] arr1 = {4, 5, 2, 10, 8}; System.out.println(Arrays.toString(nextGreater(arr1))); // [5, 10, 10, -1, -1] int[] arr2 = {1, 3, 2, 4}; System.out.println(Arrays.toString(nextGreater(arr2))); // [3, 4, 4, -1] int[] arr3 = {5, 4, 3, 2, 1}; System.out.println(Arrays.toString(nextGreater(arr3))); // [-1, -1, -1, -1, -1] }}Problem 6 — Sort a Stack Using RecursionDifficulty: HardProblem: Sort a stack in ascending order (smallest on top) using only recursion — no loops, no extra data structure.// SortStack.javaimport java.util.Stack;public class SortStack { // Insert element in correct sorted position public static void sortedInsert(Stack<Integer> stack, int item) { if (stack.isEmpty() || item > stack.peek()) { stack.push(item); return; } int top = stack.pop(); sortedInsert(stack, item); stack.push(top); } // Sort the stack public static void sortStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); sortStack(stack); // sort remaining sortedInsert(stack, top); // insert top in sorted position } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(34); stack.push(3); stack.push(31); stack.push(98); stack.push(92); stack.push(23); System.out.println("Before sort: " + stack); sortStack(stack); System.out.println("After sort: " + stack); // smallest on top }}13. Summary & Key TakeawaysA stack is a simple, elegant, and powerful data structure. Here is everything in one place:What it is: A linear data structure that follows LIFO — Last In, First Out.Core operations: push (add to top), pop (remove from top), peek (view top), isEmpty — all in O(1) time.Three ways to implement it in Java:Array-based: fast, fixed size, risk of overflowArrayList-based: dynamic, easy, slightly more overheadLinkedList-based: truly dynamic, memory-efficient per-element, best for unknown sizesWhen to use it:Undo/redo systemsBrowser navigationBalancing brackets and parenthesesEvaluating mathematical expressionsBacktracking problemsManaging recursive function callsDepth-first searchWhen NOT to use it:When you need random access to elementsWhen insertion/deletion is needed from both ends (use Deque)When you need to search efficiently (use HashMap or BST)Modern Java recommendation: Prefer ArrayDeque over the legacy Stack class for non-thread-safe scenarios. Use Stack only when you need synchronized access.The stack is one of those data structures that once you truly understand, you start seeing it everywhere — in your browser, in your IDE, in recursive algorithms, and deep within the operating system itself.This article covered everything from the fundamentals of the Stack data structure to multiple Java implementations, time complexity analysis, real-world applications, and six practice problems of increasing difficulty. Bookmark it as a reference and revisit the practice problems regularly — they are the real test of your understanding.

DataStructuresJavaStackDataStructureLIFO
LeetCode 1047: Remove All Adjacent Duplicates In String — Java Solution With All Approaches Explained

LeetCode 1047: Remove All Adjacent Duplicates In String — Java Solution With All Approaches Explained

Introduction: What Is LeetCode 1047 Remove All Adjacent Duplicates In String?If you are grinding LeetCode for coding interviews at companies like Google, Amazon, or Microsoft, LeetCode 1047 Remove All Adjacent Duplicates In String is a problem you cannot skip. It is one of the most elegant examples of the stack simulation pattern and appears frequently as a warmup or follow-up question in technical rounds.In this article we will cover everything you need — plain English explanation, real life analogy, 3 Java approaches with dry runs, complexity analysis, common mistakes, FAQs, and similar problems to practice next.Here is the problem link-: Leetcode 1047 What Is the Problem Really Asking?You are given a string. Keep scanning it and whenever you find two same letters sitting next to each other, remove both of them. After removing, the letters around them might now become adjacent and form a new pair — so you keep doing this until no more adjacent duplicates exist.Example walkthrough for "abbaca":"abbaca" → bb are adjacent duplicates → remove → "aaca""aaca" → aa are adjacent duplicates → remove → "ca""ca" → no adjacent duplicates → done!✅ Output: "ca"Real Life Analogy — Think of Popping BubblesImagine a row of colored bubbles. Whenever two bubbles of the same color are next to each other, they pop and disappear. After they pop, the bubbles on either side might now touch each other — and if they are the same color, they pop too! You keep going until no two same-colored bubbles are touching.That chain reaction is exactly what this problem simulates. And the best tool to handle that chain reaction? A stack.Approach 1: Brute Force (Beginner Friendly)The IdeaScan the string repeatedly. Every time you find two adjacent equal characters, remove them. Keep doing this until a full pass finds nothing to remove.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(s); boolean found = true; while (found) { found = false; for (int i = 0; i < sb.length() - 1; i++) { if (sb.charAt(i) == sb.charAt(i + 1)) { sb.deleteCharAt(i); sb.deleteCharAt(i); found = true; break; } } } return sb.toString();}This is easy to understand but very slow. For each pair found, you restart the entire scan. With n up to 100,000, this will get Time Limit Exceeded on LeetCode. Use it only to build intuition.Time Complexity: O(n²) — repeated passes over the string Space Complexity: O(n) — StringBuilder storageApproach 2: Stack Based Solution (Classic Interview Approach)The IdeaA stack is perfect here because of one key observation — when you remove a pair, the character that was before the pair is now adjacent to the character after the pair. That is a Last In First Out situation, which is exactly what a stack handles naturally.Algorithm:If the current character matches the top of the stack → pop (they cancel each other)Otherwise → push the current character onto the stackAt the end, the stack contains your final answerpublic String removeDuplicates(String s) { Stack<Character> st = new Stack<>(); StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (!st.empty() && c == st.peek()) { st.pop(); // adjacent duplicate found, cancel both } else { st.push(c); } } while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString();}Dry Run — "abbaca"We go character by character and check against the top of the stack:a → stack empty, push → stack: [a]b → top is a, not equal, push → stack: [a, b]b → top is b, equal! pop → stack: [a]a → top is a, equal! pop → stack: []c → stack empty, push → stack: [c]a → top is c, not equal, push → stack: [c, a]Stack remaining: [c, a] → reverse → ✅ "ca"Notice how after removing bb, the two as automatically become adjacent and get caught — the stack handles this chain reaction naturally without any extra logic!Time Complexity: O(n) — single pass through the string Space Complexity: O(n) — stack holds up to n charactersApproach 3: StringBuilder as Stack (Optimal Solution) ✅The IdeaThis is your own solution and the best one! Instead of using a separate Stack<Character>, we use StringBuilder itself as a stack:sb.append(c) acts as pushsb.deleteCharAt(sb.length() - 1) acts as popsb.charAt(sb.length() - 1) acts as peekNo extra data structure, no boxing of char into Character objects, and no reversal needed at the end. Clean, fast, and minimal.public String removeDuplicates(String s) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (sb.length() != 0 && c == sb.charAt(sb.length() - 1)) { sb.deleteCharAt(sb.length() - 1); // adjacent duplicate, remove both } else { sb.append(c); } } return sb.toString();}Dry Run — "azxxzy"a → sb empty, append → "a"z → last char is a, not equal, append → "az"x → last char is z, not equal, append → "azx"x → last char is x, equal! delete → "az"z → last char is z, equal! delete → "a"y → last char is a, not equal, append → "ay"✅ Final Answer: "ay"Again, notice the chain reaction — after xx was removed, z and z became adjacent and got removed too. The StringBuilder handles this perfectly in a single pass!Time Complexity: O(n) — one pass, every character processed exactly once Space Complexity: O(n) — StringBuilder storageWhy StringBuilder Beats Stack in JavaWhen you use Stack<Character> in Java, every char primitive gets auto-boxed into a Character object. That means extra memory allocation for every single character. With StringBuilder, you work directly on the underlying char array — faster and leaner. Plus you skip the reversal step entirely.For an interview, the Stack approach is great for explaining your thought process clearly. But for the final submitted solution, StringBuilder is the way to go.Common Mistakes to AvoidNot checking sb.length() != 0 before peeking If the StringBuilder is empty and you call sb.charAt(sb.length() - 1), you will get a StringIndexOutOfBoundsException. Always guard this check — even if the problem guarantees valid input, it shows clean coding habits.Thinking you need multiple passes Many beginners think you need to scan the string multiple times because of chain reactions. The stack handles chain reactions automatically in a single pass. Trust the process!Forgetting to reverse when using Stack Since a stack gives you characters in reverse order when you pop them, you must call .reverse() at the end. With StringBuilder you do not need this.How This Fits Into the Stack Simulation PatternBy now you might be noticing a theme across multiple problems:LeetCode 3174 Clear Digits — digit acts as backspace, deletes closest left non-digit LeetCode 2390 Removing Stars — star acts as backspace, deletes closest left non-star LeetCode 1047 Remove Adjacent Duplicates — character cancels itself if it matches the top of stackAll three use the exact same StringBuilder-as-stack pattern. The only difference is the condition that triggers a deletion. This is why pattern recognition is the real skill — once you internalize this pattern, you can solve a whole family of problems in minutes.FAQs — People Also AskQ1. What is the best approach for LeetCode 1047 in Java? The StringBuilder approach is the best. It runs in O(n) time, uses O(n) space, requires no extra data structure, and avoids the reversal step needed with a Stack.Q2. Why does a stack work for removing adjacent duplicates? Because whenever you remove a pair, the characters around them become the new neighbors. A stack naturally keeps track of the most recently seen character, so it catches these chain reactions without any extra logic.Q3. What is the time complexity of LeetCode 1047? The optimal solution runs in O(n) time and O(n) space, where n is the length of the input string.Q4. Is LeetCode 1047 asked in coding interviews? Yes, it is commonly asked as a warmup problem or follow-up at companies like Google, Amazon, and Adobe. It tests your understanding of stack-based string manipulation.Q5. What is the difference between LeetCode 1047 and LeetCode 1209? LeetCode 1047 removes pairs of adjacent duplicates. LeetCode 1209 is the harder version — it removes groups of k adjacent duplicates, requiring you to store counts alongside characters in the stack.Similar LeetCode Problems to Practice Next2390. Removing Stars From a String — Medium — star as backspace3174. Clear Digits — Easy — digit as backspace844. Backspace String Compare — Easy — compare two strings after backspaces1209. Remove All Adjacent Duplicates in String II — Medium — harder version with k duplicates735. Asteroid Collision — Medium — stack simulation with collision logicConclusionLeetCode 1047 Remove All Adjacent Duplicates In String is a beautiful problem that teaches you one of the most powerful and reusable patterns in DSA — stack simulation. The moment you spot that a removal can cause a chain reaction of more removals, you know a stack is your best friend.The StringBuilder solution is clean, optimal, and interview-ready. Master it, understand why it works, and you will be able to tackle the entire family of stack simulation problems with confidence.Found this helpful? Share it with friends preparing for coding interviews

LeetCodeJavaStackStringEasy
LeetCode 290: Word Pattern – Multiple Ways to Verify Bijection Between Pattern Characters and Words

LeetCode 290: Word Pattern – Multiple Ways to Verify Bijection Between Pattern Characters and Words

Try the ProblemYou can practice the problem here:https://leetcode.com/problems/word-pattern/Problem DescriptionYou are given:A string patternA string sThe string s consists of words separated by spaces.Your task is to determine whether s follows the same pattern defined by the string pattern.To follow the pattern, there must be a bijection between pattern characters and words.Understanding the Meaning of BijectionA bijection means a one-to-one relationship between two sets.For this problem it means:Every character in the pattern maps to exactly one word.Every word maps to exactly one pattern character.Two characters cannot map to the same word.Two words cannot map to the same character.This ensures the mapping is unique in both directions.Example WalkthroughExample 1Inputpattern = "abba"s = "dog cat cat dog"OutputtrueExplanationMapping:a → dogb → catPattern:a b b aWords:dog cat cat dogThe mapping is perfectly consistent.Example 2Inputpattern = "abba"s = "dog cat cat fish"OutputfalseExplanationThe last word "fish" breaks the pattern because "a" was already mapped to "dog".Example 3Inputpattern = "aaaa"s = "dog cat cat dog"OutputfalseExplanationPattern requires:a → same word every timeBut the words differ.Constraints1 <= pattern.length <= 300pattern contains lowercase English letters1 <= s.length <= 3000s contains lowercase letters and spaceswords are separated by a single spaceno leading or trailing spacesCore ObservationBefore applying any algorithm, we should verify one simple condition.If the number of pattern characters does not match the number of words, then the pattern cannot match.Example:pattern = "abba"s = "dog cat dog"Pattern length = 4Words = 3This automatically returns false.Thinking About Possible ApproachesWhile solving this problem, several strategies may come to mind:Use one HashMap to store pattern → word mapping and check duplicates manually.Use two HashMaps to enforce bijection from both directions.Track first occurrence indices of pattern characters and words.Compare mapping patterns using arrays or maps.Let’s explore these approaches one by one.Approach 1: Single HashMap (Your Solution)IdeaWe store mapping:pattern character → wordWhile iterating:If the character already exists in the map→ check if it maps to the same word.If it does not exist→ ensure that no other character already maps to that word.This ensures bijection.Java Implementationclass Solution { public boolean wordPattern(String pattern, String s) { String words[] = s.split(" "); // Length mismatch means impossible mapping if(pattern.length() != words.length) return false; HashMap<Character,String> mp = new HashMap<>(); for(int i = 0; i < words.length; i++){ char ch = pattern.charAt(i); if(mp.containsKey(ch)){ if(!mp.get(ch).equals(words[i])){ return false; } }else{ // Prevent two characters mapping to same word if(mp.containsValue(words[i])){ return false; } } mp.put(ch, words[i]); } return true; }}Time ComplexityO(n²)Because containsValue() can take O(n) time in worst case.Space ComplexityO(n)Approach 2: Two HashMaps (Cleaner Bijection Enforcement)IdeaInstead of checking containsValue, we maintain two maps.pattern → wordword → patternThis ensures bijection naturally.Java Implementationclass Solution { public boolean wordPattern(String pattern, String s) { String[] words = s.split(" "); if(pattern.length() != words.length) return false; HashMap<Character, String> map1 = new HashMap<>(); HashMap<String, Character> map2 = new HashMap<>(); for(int i = 0; i < pattern.length(); i++){ char ch = pattern.charAt(i); String word = words[i]; if(map1.containsKey(ch) && !map1.get(ch).equals(word)) return false; if(map2.containsKey(word) && map2.get(word) != ch) return false; map1.put(ch, word); map2.put(word, ch); } return true; }}Time ComplexityO(n)Because both maps allow constant-time lookups.Space ComplexityO(n)Approach 3: Index Mapping Technique (Elegant Trick)IdeaAnother clever technique is to compare first occurrence indices.Example:pattern = abbawords = dog cat cat dogPattern index sequence:a → 0b → 1b → 1a → 0Words index sequence:dog → 0cat → 1cat → 1dog → 0If the index sequences match, then the pattern holds.Java Implementationclass Solution { public boolean wordPattern(String pattern, String s) { String[] words = s.split(" "); if(pattern.length() != words.length) return false; HashMap<Character,Integer> map1 = new HashMap<>(); HashMap<String,Integer> map2 = new HashMap<>(); for(int i = 0; i < pattern.length(); i++){ char ch = pattern.charAt(i); String word = words[i]; if(!map1.getOrDefault(ch, -1) .equals(map2.getOrDefault(word, -1))){ return false; } map1.put(ch, i); map2.put(word, i); } return true; }}Time ComplexityO(n)Space ComplexityO(n)Comparison of ApproachesApproachTime ComplexitySpace ComplexityNotesSingle HashMapO(n²)O(n)Simple but slowerTwo HashMapsO(n)O(n)Cleaner bijection enforcementIndex MappingO(n)O(n)Elegant and interview-friendlyKey Interview InsightProblems like this test your understanding of:Bijection MappingSimilar problems include:Isomorphic StringsWord Pattern IISubstitution Cipher ProblemsUnderstanding how to enforce one-to-one mappings is a powerful technique.ConclusionThe Word Pattern problem is an excellent example of how HashMaps can enforce relationships between two datasets.While a simple HashMap solution works, more optimized methods like two-way mapping or index comparison provide cleaner and more efficient implementations.Mastering these techniques will help you solve many pattern-matching and mapping problems commonly asked in coding interviews.

HashMapString ManipulationBijection MappingTwo HashMapsIndex MappingLeetCode Easy
LeetCode 20: Valid Parentheses — Java Solution Explained

LeetCode 20: Valid Parentheses — Java Solution Explained

IntroductionLeetCode 20 Valid Parentheses is arguably the single most asked Easy problem in coding interviews. It appears at Google, Amazon, Microsoft, Meta, and virtually every company that does technical interviews. It is the textbook introduction to the Stack data structure and teaches you a pattern that shows up in compilers, code editors, HTML parsers, and mathematical expression evaluators.Here is the Link of Question -: LeetCode 20In this article we cover plain English explanation, real life analogy, the optimal stack solution with detailed dry run, all tricky edge cases, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You are given a string containing only bracket characters — (, ), {, }, [, ]. You need to check if the brackets are correctly matched and nested.Three rules must hold:Every opening bracket must be closed by the same type of closing bracketBrackets must be closed in the correct order — the most recently opened must be closed firstEvery closing bracket must have a corresponding opening bracketReal Life Analogy — Russian Nesting DollsThink of Russian nesting dolls. You open the biggest doll first, then a medium one inside it, then a small one inside that. To close them back, you must close the smallest first, then medium, then biggest. You cannot close the biggest doll while the smallest is still open inside.That is exactly how brackets work. The last opened bracket must be the first one closed. This Last In First Out behavior is precisely what a Stack is built for.Another analogy — think of a text editor like VS Code. When you type (, it automatically adds ). If you try to close with ] instead, the editor highlights an error. This problem is essentially building that validation logic.The Only Approach You Need: StackThe IdeaScan the string left to rightIf you see an opening bracket → push it onto the stackIf you see a closing bracket → check the top of the stack. If the top is the matching opening bracket, pop it. Otherwise the string is invalid.At the end, if the stack is empty → all brackets matched → return true. If stack still has elements → some brackets were never closed → return false.public boolean isValid(String s) {if (s.length() == 1) return false; // single char can never be validStack<Character> st = new Stack<>();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '(' || c == '{' || c == '[') {st.push(c); // opening bracket — push and wait for its match} else {if (!st.empty()) {// check if top of stack is the matching openerif ((c == ')' && st.peek() != '(') ||(c == '}' && st.peek() != '{') ||(c == ']' && st.peek() != '[')) {return false; // wrong type of closing bracket} else {st.pop(); // matched! remove the opener}} else {return false; // closing bracket with nothing open}}}return st.empty(); // true only if all openers were matched}Detailed Dry Run — s = "([)]"This is the trickiest example. Looks balanced at first glance but is actually invalid.( → opening, push → stack: [(][ → opening, push → stack: [(, []) → closing, peek is [, but ) needs ( → mismatch → return false ✅The stack correctly catches that [ was opened after ( but we tried to close ( before closing [ — wrong order!Dry Run — s = "([{}])"( → push → stack: [(][ → push → stack: [(, []{ → push → stack: [(, [, {]} → peek is {, match! pop → stack: [(, []] → peek is [, match! pop → stack: [(]) → peek is (, match! pop → stack: []Stack is empty → return true ✅Dry Run — s = "(["( → push → stack: [(][ → push → stack: [(, []Loop ends. Stack is NOT empty → return false ✅Two brackets were opened but never closed.All the Edge Cases You Must KnowSingle character like "(" or ")" A single character can never be valid — an opener has nothing to close it, a closer has nothing before it. The early return if (s.length() == 1) return false handles this cleanly.Only closing brackets like "))" The stack is empty when the first ) arrives → return false immediately.Only opening brackets like "(((" All get pushed, nothing gets popped, stack is not empty at end → return false.Interleaved wrong types like "([)]" Caught by the mismatch check when the closing bracket does not match the stack top.Empty string Stack stays empty → st.empty() returns true → returns true. An empty string is technically valid since there are no unmatched brackets. The constraints say length ≥ 1 so this is just good to know.A Cleaner Variation Using HashMapSome developers prefer using a HashMap to store bracket pairs, making the matching condition more readable:public boolean isValid(String s) {Stack<Character> st = new Stack<>();Map<Character, Character> map = new HashMap<>();map.put(')', '(');map.put('}', '{');map.put(']', '[');for (char c : s.toCharArray()) {if (map.containsKey(c)) {// closing bracketif (st.empty() || st.peek() != map.get(c)) {return false;}st.pop();} else {st.push(c); // opening bracket}}return st.empty();}The HashMap maps each closing bracket to its expected opening bracket. This makes adding new bracket types trivial — just add one line to the map. Great for extensibility in real world code.Both versions are O(n) time and O(n) space. Choose whichever feels more readable to you.Time Complexity: O(n) — single pass through the string Space Complexity: O(n) — stack holds at most n/2 opening bracketsWhy Stack Is the Perfect Data Structure HereThe key property this problem exploits is LIFO — Last In First Out. The most recently opened bracket must be the first one closed. That is literally the definition of a stack's behavior.Any time you see a problem where the most recently seen item determines what comes next — think Stack immediately. Valid Parentheses is the purest example of this principle.How This Fits Into the Bigger Stack PatternLooking at everything you have solved so far, notice the pattern evolution:844 Backspace String Compare — # pops the last character 1047 Remove Adjacent Duplicates — matching character pops itself 2390 Removing Stars — * pops the last character 3174 Clear Digits — digit pops the last character 20 Valid Parentheses — closing bracket pops its matching openerAll of these are stack simulations. The difference here is that instead of any character being popped, only the correct matching opener is popped. This matching condition is what makes Valid Parentheses a step up in logic from the previous problems.Common Mistakes to AvoidNot checking if stack is empty before peeking If a closing bracket arrives and the stack is empty, calling peek() throws an EmptyStackException. Always check !st.empty() before peeking or popping.Returning true without checking if stack is empty Even if the loop completes without returning false, unclosed openers remain on the stack. Always return st.empty() at the end, not just true.Pushing closing brackets onto the stack Only push opening brackets. Pushing closing brackets gives completely wrong results and is the most common beginner mistake.Not handling odd length strings If s.length() is odd, it is impossible for all brackets to be matched — you can add if (s.length() % 2 != 0) return false as an early exit for a small optimization.FAQs — People Also AskQ1. Why is a Stack used to solve Valid Parentheses? Because the problem requires LIFO matching — the most recently opened bracket must be the first one closed. Stack's Last In First Out behavior maps perfectly to this requirement, making it the natural and optimal data structure choice.Q2. What is the time complexity of LeetCode 20? O(n) time where n is the length of the string. We make a single pass through the string, and each character is pushed and popped at most once. Space complexity is O(n) in the worst case when all characters are opening brackets.Q3. Can LeetCode 20 be solved without a Stack? Technically yes for simple cases using counters, but only when dealing with a single type of bracket. With three types of brackets that can be nested, a Stack is the only clean solution. Counter-based approaches break down on cases like "([)]".Q4. Is LeetCode 20 asked in FAANG interviews? Absolutely. It is one of the most commonly asked problems across all major tech companies. It tests understanding of the Stack data structure and is often used as a warmup before harder stack problems like Largest Rectangle in Histogram or Decode String.Q5. What happens if the input string has an odd length? An odd-length string can never be valid since brackets always come in pairs. You can add if (s.length() % 2 != 0) return false as an early optimization, though the stack logic handles this correctly on its own.Similar LeetCode Problems to Practice Next1047. Remove All Adjacent Duplicates In String — Easy — stack pattern with characters394. Decode String — Medium — nested brackets with encoding678. Valid Parenthesis String — Medium — wildcards added32. Longest Valid Parentheses — Hard — longest valid substring1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets to make validConclusionLeetCode 20 Valid Parentheses is the definitive introduction to the Stack data structure in competitive programming and technical interviews. The logic is elegant — push openers, pop on matching closers, check empty at the end. Three rules, one data structure, one pass.Master this problem thoroughly, understand every edge case, and you will have a rock-solid foundation for every stack problem that follows — from Decode String to Largest Rectangle in Histogram.

StringStackEasyLeetCode
LeetCode 387: First Unique Character in a String – Java HashMap Solution Explained

LeetCode 387: First Unique Character in a String – Java HashMap Solution Explained

IntroductionLeetCode 387 – First Unique Character in a String is one of the most common beginner-friendly string and hashing interview problems.This problem helps developers understand:Frequency countingHashMap usageString traversalCharacter manipulationEfficient lookup techniquesIt is frequently asked in coding interviews because it tests both:Logical thinkingTime complexity optimizationProblem Link🔗 https://leetcode.com/problems/first-unique-character-in-a-string/Problem StatementGiven a string:sReturn:Index of the first non-repeating characterIf no unique character exists:Return -1Example 1Inputs = "leetcode"Output0Explanation:'l'appears only once and is the first unique character.Example 2Inputs = "loveleetcode"Output2Explanation:'v'is the first character that appears only once.Example 3Inputs = "aabb"Output-1All characters repeat.IntuitionTo identify the first unique character:We first need to know:How many times every character appearsA HashMap is perfect for frequency counting.After counting:We traverse the string again and return the first character whose frequency is:1Brute Force ApproachIdeaFor every character:Traverse the entire stringCount occurrencesReturn the first character with count = 1Brute Force ComplexityTime ComplexityO(N²)because nested traversal is required.Space ComplexityO(1)Optimized HashMap ApproachIdeaUse a HashMap to store:character → frequencyThen scan the string again.The first character with frequency:1is the answer.Java Solutionclass Solution {public int firstUniqChar(String s) {HashMap<Character, Integer> mp = new HashMap<>();for(int i = 0; i < s.length(); i++) {mp.put(s.charAt(i), mp.getOrDefault(s.charAt(i), 0) + 1);}for(int i = 0; i < s.length(); i++) {if(mp.get(s.charAt(i)) == 1) {return i;}}return -1;}}Cleaner Optimized Versionclass Solution {public int firstUniqChar(String s) {int[] freq = new int[26];for(char ch : s.toCharArray()) {freq[ch - 'a']++;}for(int i = 0; i < s.length(); i++) {if(freq[s.charAt(i) - 'a'] == 1) {return i;}}return -1;}}Why This WorksThe algorithm works in two passes.First PassStore frequency of every character.Example:"leetcode"Frequency map:l → 1e → 3t → 1c → 1o → 1d → 1Second PassTraverse string from left to right.The first character whose frequency equals:1is returned.Dry RunInputs = "loveleetcode"Step 1: Frequency Countingl → 2o → 2v → 1e → 4t → 1c → 1d → 1Step 2: Traverse AgainIndex 0:'l' → frequency 2Index 1:'o' → frequency 2Index 2:'v' → frequency 1Return:2Time Complexity AnalysisOptimized HashMap SolutionTime ComplexityO(N)because string traversal happens twice.Space ComplexityO(1)Only lowercase English letters exist.Maximum storage remains fixed.Brute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashMap / Frequency ArrayO(N)O(1)Interview ExplanationIn interviews, explain:We use a frequency map to count occurrences of every character. Then we scan the string again to locate the first character whose frequency is exactly one.This demonstrates:Hashing knowledgeFrequency countingEfficient lookup usageOptimization skillsCommon Mistakes1. Returning Character Instead of IndexThe problem asks for:indexnot the character itself.2. Using Nested LoopsNested traversal increases complexity unnecessarily.3. Forgetting Second TraversalHashMap only stores frequencies.You still need:left-to-right traversalto find the first unique character.FAQsQ1. Why use HashMap?Because frequency lookup becomes very efficient.Q2. Can we use arrays instead?Yes.Since only lowercase letters exist:int[26]works perfectly.Q3. Why traverse the string twice?First pass counts frequency.Second pass preserves original order.Q4. Is this problem important for interviews?Yes.It is one of the most common hashing interview questions.Related ProblemsPractice these next:Valid AnagramRansom NoteCount the Number of Special CharactersConclusionLeetCode 387 is an excellent beginner-level problem for learning:Frequency countingHashMap usageString traversalEfficient lookup techniquesThe key insight is:Count character frequencies first, then find the first character with frequency equal to one.This pattern is widely used in many real interview problems involving strings and hashing.

LeetCodeJavaHashMapStringEasy
Reverse Only Letters – Two Pointer Strategy Explained (LeetCode 917)

Reverse Only Letters – Two Pointer Strategy Explained (LeetCode 917)

🔗 Problem LinkLeetCode 917 – Reverse Only Letters 👉 https://leetcode.com/problems/reverse-only-letters/IntroductionThis is a very clean two-pointer problem.The challenge is not just reversing a string — it’s reversing only the letters while keeping all non-letter characters in their original positions.This problem strengthens:Two pointer techniqueCharacter validation logicIn-place string manipulationLet’s break it down.📌 Problem UnderstandingYou are given a string s.Rules:All non-English letters must remain at the same index.Only English letters (uppercase or lowercase) should be reversed.Return the modified string.Example 1Input: "ab-cd"Output: "dc-ba"Only letters are reversed. Hyphen stays at same position.Example 2Input: "a-bC-dEf-ghIj"Output: "j-Ih-gfE-dCba"Example 3Input: "Test1ng-Leet=code-Q!"Output: "Qedo1ct-eeLg=ntse-T!"Notice:Numbers, -, =, ! stay fixed.Only letters move.🧠 IntuitionThe first thought might be:Extract all lettersReverse themPut them backBut that would require extra space.Instead, we can solve this efficiently using Two Pointers.🚀 Two Pointer ApproachWe use:i → starting from leftj → starting from rightSteps:Convert string into char array.Move i forward until it points to a letter.Move j backward until it points to a letter.Swap letters.Continue until i < j.💻 Your Codeclass Solution { public String reverseOnlyLetters(String s) { int i = 0; int j = s.length() - 1; char arr[] = s.toCharArray(); while(i < j){ boolean l = ('A' <= s.charAt(i) && s.charAt(i) <= 'Z') || ('a' <= s.charAt(i) && s.charAt(i) <= 'z'); boolean r = ('A' <= s.charAt(j) && s.charAt(j) <= 'Z') || ('a' <= s.charAt(j) && s.charAt(j) <= 'z'); if(l && r){ char temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; i++; j--; }else if(l){ j--; }else if(r){ i++; }else{ i++; j--; } } return new String(arr); }}🔍 Step-by-Step Explanation1️⃣ Convert to Character Arraychar arr[] = s.toCharArray();Strings are immutable in Java. So we convert to char array to modify it.2️⃣ Initialize Two Pointersint i = 0;int j = s.length() - 1;We start from both ends.3️⃣ Check If Characters Are Lettersboolean l = ('A' <= s.charAt(i) && s.charAt(i) <= 'Z') || ('a' <= s.charAt(i) && s.charAt(i) <= 'z');You manually check ASCII ranges for uppercase and lowercase letters.Same logic for r.4️⃣ Swap When Both Are Lettersif(l && r){ char temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; i++; j--;}Only swap letters.5️⃣ Move Pointers When One Is Not LetterIf left is letter but right is not → move jIf right is letter but left is not → move iIf both are not letters → move bothThis ensures:Non-letter characters remain in their positions.🎯 Why This WorksWe never move non-letter characters.We only swap valid letters.Since we use two pointers:Time complexity stays linear.No extra array needed for letters.⏱ Complexity AnalysisTime Complexity: O(n)Each character is visited at most once.Space Complexity: O(n)Because we convert string to char array.(If considering output string creation, still O(n))🔥 Cleaner OptimizationInstead of manually checking ASCII ranges, Java provides:Character.isLetter(c)Cleaner version:class Solution { public String reverseOnlyLetters(String s) { int i = 0, j = s.length() - 1; char[] arr = s.toCharArray(); while(i < j){ if(!Character.isLetter(arr[i])){ i++; }else if(!Character.isLetter(arr[j])){ j--; }else{ char temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; i++; j--; } } return new String(arr); }}Much cleaner and readable.🏁 Final ThoughtsThis problem teaches:Two pointer patternIn-place string reversalCharacter validation logicClean pointer movement strategyIt’s a simple but powerful pattern that appears often in interviews.If you master this, you can easily solve:Reverse Vowels of a StringValid PalindromeReverse String IIPalindrome with One Removal

Two PointersString ManipulationLeetCodeEasy
LeetCode 1021: Remove Outermost Parentheses — Java Solution Explained

LeetCode 1021: Remove Outermost Parentheses — Java Solution Explained

IntroductionLeetCode 1021 Remove Outermost Parentheses sounds intimidating with words like "primitive decomposition" but once you strip away the fancy terminology, it is a beautifully simple problem. It builds directly on the depth-counting technique from LeetCode 1614 and is a perfect example of how one clean insight can collapse a seemingly complex problem into just a few lines of code.Here is the Link of Question -: LeetCode 1021In this article we cover plain English explanation, what "primitive" really means, two Java approaches with detailed dry runs, complexity analysis, and everything you need to ace this in an interview.What Is the Problem Really Asking?Let us ignore the formal definition for a moment and think practically.A primitive string is the smallest self-contained valid bracket group. Think of it as a top-level unit — it opens, closes completely, and is not part of a bigger bracket group.For "(()())(())":"(()())" is one primitive — it opens and fully closes"(())" is another primitive — it opens and fully closes afterNow from each primitive, remove only the outermost opening and closing bracket, keep everything inside."(()())" → remove outer → "()()""(())" → remove outer → "()"Combined → "()()()"That is literally the whole problem!Real Life Analogy — Gift Boxes Inside a Shipping BoxImagine you ordered gifts online. They all arrive in one big shipping box. Inside that box are individual gift boxes. Inside some gift boxes are smaller boxes.The "primitive decomposition" is identifying each individual gift box inside the shipping box. Removing the outermost parentheses is like removing just the outer gift box wrapping but keeping everything inside it intact.You are not unpacking the inner boxes — just peeling off one layer from each top-level group.Understanding Primitive Decomposition VisuallyFor s = "(()())(())(()(()))":( ( ) ( ) ) ( ( ) ) ( ( ) ( ( ) ) )|_________| |_______| |_____________| primitive1 primitive2 primitive3Each group that starts at depth 0 and returns to depth 0 is one primitive. Remove the outermost ( and ) from each and concatenate what remains.The depth analogy from LeetCode 1614 is the key — a primitive starts when depth goes from 0 to 1 and ends when depth returns to 0.Approach 1: Counter With Substring (Your Solution) ✅The IdeaTrack depth with a counter. Use start and end pointers to mark the boundaries of each primitive. When depth hits 0, you have found a complete primitive — append everything between start+1 and end (skipping the outermost brackets) to the result.public String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); int c = 0; int start = 0; int end = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { c++; } else { c--; } if (c == 0) { // primitive found from index start to end (inclusive) sb.append(s.substring(start + 1, end)); // skip outermost ( and ) start = end + 1; // next primitive starts after current end } end++; } return sb.toString();}Dry Run — s = "(()())(())"Tracking c, start, end at each step:i=0, ( → c=1, end=1i=1, ( → c=2, end=2i=2, ) → c=1, end=3i=3, ( → c=2, end=4i=4, ) → c=1, end=5i=5, ) → c=0 → primitive found! append s.substring(1, 5) = "()()" → start=6, end=6i=6, ( → c=1, end=7i=7, ( → c=2, end=8i=8, ) → c=1, end=9i=9, ) → c=0 → primitive found! append s.substring(7, 9) = "()" → start=10, end=10Result: "()()" + "()" = "()()()" ✅Time Complexity: O(n) — single pass plus substring operations Space Complexity: O(n) — StringBuilder stores the resultApproach 2: Counter With Depth Filter (Cleaner & More Intuitive)The IdeaInstead of tracking start/end pointers, use depth directly to decide whether to include each character. The insight is:The outermost ( of each primitive is always encountered when c goes from 0 to 1 — skip itThe outermost ) of each primitive is always encountered when c goes from 1 to 0 — skip itEvery other character is inside some primitive — include itpublic String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); int depth = 0; for (char c : s.toCharArray()) { if (c == '(') { if (depth > 0) { sb.append(c); // not the outermost (, include it } depth++; } else { depth--; if (depth > 0) { sb.append(c); // not the outermost ), include it } } } return sb.toString();}This is arguably the most elegant solution. No pointers, no substring, just one rule — if depth is already greater than 0 when you see (, it is not the outer one. If depth is still greater than 0 after decrementing on ), it is not the outer one.Dry Run — s = "()()" (Edge Case)( → depth=0, skip it, depth becomes 1) → depth becomes 0, depth=0 so skip it( → depth=0, skip it, depth becomes 1) → depth becomes 0, depth=0 so skip itResult: "" ✅ Both are primitives "()" and "()", removing outer from each gives empty string.Dry Run — s = "(()())(())(()(()))"Let us trace just which characters get included vs skipped:For the first primitive "(()())":( at depth 0 → skip (outermost opener)( at depth 1 → include) at depth 2→1 → include( at depth 1 → include) at depth 2→1 → include) at depth 1→0 → skip (outermost closer)Inner content "()()" included ✅Same logic applies to each subsequent primitive. Final result: "()()()()(())" ✅Time Complexity: O(n) — single pass Space Complexity: O(n) — StringBuilder stores resultApproach 3: Stack Based (Verbose but Clear)The IdeaUse an explicit stack to track open brackets. When the stack becomes empty after a ), you have found a complete primitive. Collect all characters between the outermost brackets.public String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); Stack<Character> st = new Stack<>(); int start = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { st.push('('); } else { st.pop(); } if (st.empty()) { // primitive ends at i, extract inner content sb.append(s.substring(start + 1, i)); start = i + 1; } } return sb.toString();}This is the most verbose but makes the primitive detection very explicit — stack empty means primitive complete. Great for explaining your thought process in an interview before optimizing.Time Complexity: O(n) Space Complexity: O(n) — stack storageApproach ComparisonThe Stack approach is clearest for explaining primitive detection. The pointer-based counter approach (your solution) is direct and efficient. The depth-filter counter approach is the most elegant — no pointers, no substrings, just a single depth check per character. All three are O(n) time. The depth-filter approach wins on code clarity.How This Connects to the Full SeriesLooking at the bracket problem series you have been building:20 Valid Parentheses — is the string valid? 1614 Maximum Nesting Depth — how deep is the nesting? 1021 Remove Outermost Parentheses — identify and strip top-level groupsEach problem adds one more layer of understanding about bracket strings. The depth counter technique from 1614 directly powers the optimal solution here. This is pattern building at its best.Common Mistakes to AvoidOff-by-one in substring indices In your solution, s.substring(start+1, end) skips the outermost ( by using start+1, and end (not end+1) naturally excludes the outermost ) since end points to it. Getting these indices wrong by even one position gives completely wrong output.Appending the outermost brackets in the depth-filter approach The condition order matters — for (, check depth BEFORE incrementing. For ), check depth AFTER decrementing. Flipping these gives wrong results.Forgetting to update start after each primitive In pointer-based approaches, always set start = end + 1 (or start = i + 1) after appending each primitive, otherwise the next primitive's start index is wrong.FAQs — People Also AskQ1. What is a primitive valid parentheses string in LeetCode 1021? A primitive is the smallest self-contained valid bracket group that cannot be split into two smaller valid groups. It starts when depth goes from 0 to 1 and ends when depth returns to 0. For example in "(()())(())", the primitives are "(()())" and "(())".Q2. What is the most elegant solution for LeetCode 1021? The depth-filter counter approach — increment depth on (, decrement on ), and only append characters when depth is greater than 0 for ( and still greater than 0 after decrement for ). This skips outermost brackets naturally without tracking indices.Q3. What is the time complexity of LeetCode 1021? All approaches run in O(n) time with a single pass. Space complexity is O(n) for storing the output string in StringBuilder.Q4. How is LeetCode 1021 different from LeetCode 1614? LeetCode 1614 finds the maximum depth by tracking a counter. LeetCode 1021 uses the same counter technique but to identify primitive boundaries and strip their outermost characters. 1614 returns a number, 1021 returns a modified string.Q5. Is LeetCode 1021 asked in coding interviews? It appears occasionally as a follow-up to Valid Parentheses or Nesting Depth problems. The real skill it tests is understanding primitive decomposition — identifying self-contained units within a bracket string — which appears in real world parser and compiler design.Similar LeetCode Problems to Practice Next20. Valid Parentheses — Easy — validate bracket structure1614. Maximum Nesting Depth of Parentheses — Easy — find max depth1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets394. Decode String — Medium — nested brackets with encoding32. Longest Valid Parentheses — Hard — longest valid substringConclusionLeetCode 1021 Remove Outermost Parentheses is a satisfying problem once you realize that "primitive decomposition" is just a fancy way of saying "find each top-level bracket group." The depth counter is the key — depth 0 to 1 marks the start of a primitive, depth 1 to 0 marks its end.The depth-filter approach is the cleanest solution — one pass, one counter, one condition. No substring, no pointers, just elegance. Master this alongside LeetCode 20 and 1614 and you will have a complete toolkit for any bracket string problem that comes your way.

StringStackEasyLeetCode
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
Valid Anagram – Frequency Counting Pattern Explained (LeetCode 242)

Valid Anagram – Frequency Counting Pattern Explained (LeetCode 242)

🔗 Problem LinkLeetCode 242 – Valid Anagram 👉 https://leetcode.com/problems/valid-anagram/IntroductionThis is one of the most important string frequency problems in coding interviews.The idea of checking whether two strings are anagrams appears in many variations:Group AnagramsRansom NoteFind the DifferencePermutation in StringIf you master this pattern, you unlock a whole category of problems.Let’s break it down step by step.📌 Problem UnderstandingTwo strings are anagrams if:They contain the same charactersWith the same frequenciesOrder does not matterExample 1Input: s = "anagram" t = "nagaram"Output: trueBoth contain:a → 3n → 1g → 1r → 1m → 1Example 2Input: s = "rat" t = "car"Output: falseDifferent character frequencies.🧠 IntuitionThe core idea:If two strings are anagrams, their character frequencies must match exactly.So we:Check if lengths are equal.Count frequency of characters in first string.Subtract frequencies using second string.If at any point frequency becomes negative → not anagram.💻 Your Codeclass Solution { public boolean isAnagram(String s, String t) { if(s.length() != t.length()) return false; HashMap<Character,Integer> mp = new HashMap<>(); for(int i =0;i<s.length();i++){ mp.put(s.charAt(i),mp.getOrDefault(s.charAt(i),0)+1); } for(int i =0; i < t.length();i++){ if(mp.containsKey(t.charAt(i)) && mp.get(t.charAt(i)) > 0){ mp.put(t.charAt(i),mp.get(t.charAt(i))-1); }else{ return false; } } return true; }}🔍 Step-by-Step Explanation1️⃣ Length Checkif(s.length() != t.length()) return false;If lengths differ → cannot be anagrams.2️⃣ Build Frequency Mapmp.put(s.charAt(i), mp.getOrDefault(s.charAt(i), 0) + 1);Count occurrences of each character in s.3️⃣ Subtract Using Second Stringif(mp.containsKey(t.charAt(i)) && mp.get(t.charAt(i)) > 0)If character exists and frequency is available → reduce it.Otherwise → return false immediately.🎯 Why This WorksWe treat:First string as frequency builderSecond string as frequency consumerIf all frequencies match perfectly, we return true.⏱ Complexity AnalysisTime Complexity: O(n)One pass to build mapOne pass to compareSpace Complexity: O(26) ≈ O(1)Only lowercase English letters allowed.🔥 Optimized Approach – Using Array Instead of HashMapSince the problem guarantees:s and t consist of lowercase English lettersWe can replace HashMap with an integer array of size 26.This is faster and cleaner.Optimized Versionclass Solution { public boolean isAnagram(String s, String t) { if(s.length() != t.length()) return false; int[] freq = new int[26]; for(char c : s.toCharArray()){ freq[c - 'a']++; } for(char c : t.toCharArray()){ freq[c - 'a']--; if(freq[c - 'a'] < 0){ return false; } } return true; }}🚀 Why This Is BetterNo HashMap overheadDirect index accessCleaner codeFaster in interviews🏁 Final ThoughtsThis problem teaches:Frequency counting patternEarly exit optimizationUsing arrays instead of HashMap when character set is limitedThinking in terms of resource balanceValid Anagram is a foundation problem.Once you master it, you can easily solve:Ransom NoteFind the DifferenceGroup AnagramsCheck Equal Character Occurrences

HashMapStringFrequency CountArraysLeetCodeEasy
LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

IntroductionIn coding interviews and competitive programming, many problems test how well you can manipulate numbers and arrays together. One such beginner-friendly problem is LeetCode 2553 – Separate the Digits in an Array.In this problem, we are given an integer array, and we need to separate every digit of every number while maintaining the original order.This problem is excellent for practicing:Array traversalDigit extractionReverse processingArrayList usage in JavaThinking about order preservationProblem Link🔗 ProblemLeetCode 2553: Separate the Digits in an ArrayProblem StatementGiven an array of positive integers nums, return an array containing all digits of each integer in the same order they appear.ExampleInput:nums = [13,25,83,77]Output:[1,3,2,5,8,3,7,7]IntuitionThe main challenge is:Extract digits from each numberPreserve the original left-to-right orderNormally, extracting digits using % 10 gives digits in reverse order.Example:83 → 3 → 8So we need a way to restore the correct order.Approach 1 – Using String ConversionIdeaConvert every number into a string and then traverse each character.This is the simplest and most beginner-friendly approach.AlgorithmTraverse every number in the array.Convert the number into a string.Traverse each character of the string.Convert character back to integer.Store digits into ArrayList.Convert ArrayList to array.Java Code – String Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int num : nums) { String str = String.valueOf(num); for (char ch : str.toCharArray()) { list.add(ch - '0'); } } int[] ans = new int[list.size()]; for (int i = 0; i < list.size(); i++) { ans[i] = list.get(i); } return ans; }}Dry Run (String Approach)Input:nums = [13,25]Step 113 → "13"Digits added:1, 3Step 225 → "25"Digits added:2, 5Final Array:[1,3,2,5]Time Complexity & Space ComplexityTime ComplexityO(N × D)Where:N = number of elementsD = number of digitsSpace ComplexityO(N × D)For storing digits.Approach 2 – Mathematical Digit Extraction (Optimal Without String)This is the approach you implemented in your code.Instead of converting numbers into strings, we extract digits mathematically using:digit = num % 10num = num / 10But digits come in reverse order.To fix this:Traverse the original array from back to frontStore extracted digitsReverse the final resultThis avoids string conversion completely.Intuition Behind Reverse TraversalSuppose:nums = [13,25]If we traverse from the end:25 → 5,213 → 3,1Stored list:[5,2,3,1]Now reverse the list:[1,3,2,5]Correct answer achieved.Java Code – Mathematical Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int i = nums.length - 1; i >= 0; i--) { if (nums[i] < 10) { list.add(nums[i]); } else { int val = nums[i]; while (val != 0) { int digit = val % 10; val = val / 10; list.add(digit); } } } int[] ans = new int[list.size()]; int k = 0; for (int i = list.size() - 1; i >= 0; i--) { ans[k++] = list.get(i); } return ans; }}Dry Run (Mathematical Approach)Input:nums = [13,25,83]Traverse from Back83Digits extracted:3, 8List:[3,8]25Digits extracted:5,2List:[3,8,5,2]13Digits extracted:3,1List:[3,8,5,2,3,1]Reverse Final List[1,3,2,5,8,3]Correct answer.Time Complexity Analysis & Space ComplexityTime ComplexityO(N × D)Because every digit is processed once.Space ComplexityO(N × D)For storing final digits.Which Approach is Better?ApproachAdvantagesDisadvantagesString ConversionEasy to understandUses extra string conversionMathematical ExtractionBetter DSA practiceSlightly harder logicInterview PerspectiveIn interviews:Beginners should first explain the string approach.Then discuss optimization using mathematical extraction.Interviewers like when candidates:Understand digit manipulationThink about order preservationCompare multiple approachesCommon Mistakes1. Forgetting Reverse OrderUsing % 10 extracts digits backward.Example:123 → 3,2,1You must reverse later.2. Not Handling Single Digit NumbersSingle digit numbers should directly be added.3. Character Conversion MistakeWrong:list.add(ch);Correct:list.add(ch - '0');Frequently Asked Questions (FAQs)Q1. Why do digits come in reverse order?Because % 10 always extracts the last digit first.Example:123 % 10 = 3Q2. Can we solve this without ArrayList?Yes, but ArrayList makes dynamic storage easier.Q3. Which approach is more optimal?Both have similar complexity.Mathematical extraction avoids string conversion and is preferred in interviews.Q4. Is this problem important for interviews?Yes. It teaches:Number manipulationOrder handlingArray traversalBasic optimization thinkingConclusionLeetCode 2553 is a simple yet valuable beginner problem for understanding:Digit extractionArray handlingReverse traversalOrder preservationYou learned two approaches:String Conversion ApproachMathematical Digit Extraction ApproachThe mathematical solution is especially useful because it strengthens core DSA concepts and improves problem-solving skills for interviews.If you're preparing for coding interviews in Java, this is a great problem to master before moving to harder digit manipulation questions.

ArrayEasyLeetcodeDigit ExtractionJava
LeetCode 1614: Maximum Nesting Depth of Parentheses — Java Solution Explained

LeetCode 1614: Maximum Nesting Depth of Parentheses — Java Solution Explained

IntroductionLeetCode 1614 Maximum Nesting Depth of Parentheses is a natural follow-up to LeetCode 20 Valid Parentheses. While LeetCode 20 asks "are the brackets valid?", this problem asks "how deeply are they nested?" It is a clean, focused problem that teaches you how to think about bracket depth — a concept that appears in compilers, parsers, JSON validators, and XML processors in real world software.Here is the Link of Question -: LeetCode 1614In this article we cover plain English explanation, real life analogy, two Java approaches with dry runs, complexity analysis, and all the important details you need for interviews.What Is the Problem Really Asking?You are given a valid parentheses string. You need to find the maximum number of nested (not just sequential) open parentheses at any point in the string.The key distinction here is nested vs sequential:"()()()" → depth is 1, brackets are sequential not nested"((()))" → depth is 3, brackets are fully nested inside each other"()(())" → depth is 2, the second pair is nested one level deepReal Life Analogy — Folders Inside FoldersThink of your computer's file system. You have a folder, inside that a subfolder, inside that another subfolder. The depth is how many folders deep you are at the deepest point."(1+(2*3)+((8)/4))+1" is like:Outer folder ( → depth 1Inner folder ( inside it → depth 2Innermost folder (( → depth 3The answer is how deep the deepest file is buried. You do not care about other folders — just the maximum depth reached at any single moment.Approach 1: Stack Based Solution (Classic)The IdeaUse a stack exactly like LeetCode 20. Every time you push an opening bracket, increment a counter. Every time you pop a closing bracket, record the max before decrementing. The stack size at any moment represents current depth.public int maxDepth(String s) { Stack<Character> st = new Stack<>(); int current = 0; int max = 0; for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (c == '(') { st.push(c); current++; max = Math.max(max, current); // record depth when going deeper } else if (c == ')') { if (!st.empty() && st.peek() == '(') { max = Math.max(max, current); current--; st.pop(); } } } return max;}Dry Run — s = "()(())((()()))"( → push, current = 1, max = 1) → pop, current = 0( → push, current = 1, max = 1( → push, current = 2, max = 2) → pop, current = 1) → pop, current = 0( → push, current = 1, max = 2( → push, current = 2, max = 2( → push, current = 3, max = 3 ✅) → pop, current = 2( → push, current = 3, max = 3) → pop, current = 2) → pop, current = 1) → pop, current = 0✅ Output: 3Time Complexity: O(n) — single pass Space Complexity: O(n) — stack holds up to n/2 opening bracketsApproach 2: Counter Only — No Stack (Optimal) ✅The IdeaThis is the smartest approach and the real insight of this problem. You do not actually need a stack at all! Think about it — the depth at any moment is simply how many unmatched opening brackets we have seen so far. That is just a counter!( → increment counter, update max) → decrement counterEverything else → ignorepublic int maxDepth(String s) { int current = 0; int max = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { current++; max = Math.max(max, current); } else if (s.charAt(i) == ')') { current--; } } return max;}This is beautifully simple. No stack, no extra memory, just two integer variables.Dry Run — s = "(1+(2*3)+((8)/4))+1"Only tracking ( and ), ignoring digits and operators:( → current = 1, max = 1( → current = 2, max = 2) → current = 1( → current = 2, max = 2( → current = 3, max = 3 ✅) → current = 2) → current = 1) → current = 0✅ Output: 3Time Complexity: O(n) — single pass Space Complexity: O(1) — only two integer variables, no extra storage!Why Update Max on ( Not on )?This is the most important implementation detail. You update max when you open a bracket, not when you close it. Why?Because when you encounter (, your depth just increased to a new level — that is when you might have hit a new maximum. When you encounter ), you are going back up — depth is decreasing, so it can never be a new maximum.Always capture the peak on the way down into nesting, not on the way back out.Stack vs Counter — Which to Use?The counter approach is strictly better here — same time complexity but O(1) space instead of O(n). In an interview, start by mentioning the stack approach to show you recognize the stack pattern, then immediately offer the counter optimization to show deeper understanding.This mirrors the same progression as LeetCode 844 Backspace String Compare — where the O(1) two pointer follow-up impressed interviewers more than the standard stack solution.How This Fits the Stack Pattern SeriesLooking at the full series you have been solving:20 Valid Parentheses — are brackets correctly matched? 1614 Maximum Nesting Depth — how deeply are they nested?These two problems are complementary. One validates structure, the other measures depth. Together they cover the two most fundamental questions you can ask about a bracket string. Real world parsers need to answer both — "is this valid?" and "how complex is the nesting?"Common Mistakes to AvoidUpdating max after decrementing on ) If you write current-- before Math.max, you will always be one level too low and miss the true maximum. Always capture max before or at the moment of increment, never after decrement.Counting all characters not just brackets Digits, operators like +, -, *, / must be completely ignored. Only ( and ) affect depth.Using a Stack when a counter suffices Since the problem guarantees a valid parentheses string, you never need to validate matching — just track depth. A Stack adds unnecessary complexity and memory overhead here.FAQs — People Also AskQ1. What is nesting depth in LeetCode 1614? Nesting depth is the maximum number of open parentheses that are simultaneously unclosed at any point in the string. For example "((()))" has depth 3 because at the innermost point, three ( are open at the same time.Q2. What is the best approach for LeetCode 1614 in Java? The counter approach is optimal — O(n) time and O(1) space. Increment a counter on (, update max, decrement on ). No stack needed since the string is guaranteed to be a valid parentheses string.Q3. What is the time complexity of LeetCode 1614? Both approaches are O(n) time. The Stack approach uses O(n) space while the counter approach uses O(1) space, making the counter approach strictly better.Q4. What is the difference between LeetCode 20 and LeetCode 1614? LeetCode 20 validates whether a bracket string is correctly formed. LeetCode 1614 assumes the string is already valid and asks how deeply the brackets are nested. LeetCode 20 needs a stack for matching; LeetCode 1614 only needs a counter.Q5. Is LeetCode 1614 asked in coding interviews? It appears occasionally as a warmup or follow-up after LeetCode 20. The more important skill it tests is recognizing when a stack can be replaced by a simpler counter — that kind of space optimization thinking is valued in interviews.Similar LeetCode Problems to Practice Next20. Valid Parentheses — Easy — validate bracket structure1021. Remove Outermost Parentheses — Easy — depth-based filtering1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets32. Longest Valid Parentheses — Hard — longest valid substring394. Decode String — Medium — nested brackets with encodingConclusionLeetCode 1614 Maximum Nesting Depth of Parentheses teaches a deceptively simple but important lesson — not every bracket problem needs a stack. When the string is guaranteed valid and you only need to measure depth, a counter is all you need.The progression from LeetCode 20 to 1614 perfectly illustrates how understanding the core problem deeply leads to elegant simplifications. Master both, understand why one needs a stack and the other does not, and you will have a strong foundation for every bracket problem in your interview journey.

StringStackLeetCodeEasy
LeetCode 3174: Clear Digits — Multiple Approaches Explained

LeetCode 3174: Clear Digits — Multiple Approaches Explained

What's the Problem Really Asking?Imagine you're editing a text document and every time you type a number, it acts like a backspace key — it deletes itself AND the character just before it. That's exactly what this problem is!Given a string like "cb34":3 deletes b → "c4"4 deletes c → ""Simple idea, right? Let's look at all the ways to solve it.Here is the problem link-: Leetcode 3174Approach 1: Using a Stack (Classic & Intuitive)The IdeaA stack is the most natural fit here. Think of it like a stack of plates:If the character is a letter → push it onto the stack (add a plate)If the character is a digit → pop from the stack (remove the top plate, the digit deletes itself too)At the end, whatever's left on the stack is your answer.Codepublic String clearDigits(String s) { Stack<Character> st = new Stack<>(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (c >= '0' && c <= '9') { if (!st.empty()) { st.pop(); // digit eats the closest left non-digit } } else { st.push(c); // letter goes in } } StringBuilder sb = new StringBuilder(); while (!st.empty()) { sb.append(st.pop()); } return sb.reverse().toString(); // stack gives reverse order}Real Life AnalogyThink of a Jenga tower. Every time a digit appears, it pulls out the topmost block (the closest left letter). At the end, whatever blocks remain standing — that's your result.ComplexityTime: O(n) — single pass through the stringSpace: O(n) — stack can hold up to n characters in worst case (no digits)Approach 2: StringBuilder as a Stack (Optimal & Clean) ✅The IdeaThis is the smartest approach and the one you already have in your solution. A StringBuilder naturally behaves like a stack:Append letters to the endWhen a digit appears, delete the last character (.deleteCharAt(sb.length() - 1))No extra data structure needed!Codepublic String clearDigits(String s) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < s.length(); i++) { char c = s.charAt(i); if (c >= '0' && c <= '9') { sb.deleteCharAt(sb.length() - 1); // digit acts as backspace } else { sb.append(c); // letter gets added } } return sb.toString();}Walkthrough with ExampleLet's trace "cb34" step by step:StepCharacterActionStringBuilder1cappend"c"2bappend"cb"33delete last"c"44delete last""Final answer: ""Another example — "a1b2c3":StepCharacterActionStringBuilder1aappend"a"21delete last""3bappend"b"42delete last""5cappend"c"63delete last""Final answer: ""ComplexityTime: O(n) — one pass, each character processed onceSpace: O(n) — StringBuilder storageApproach 3: Brute Force / Simulation (Beginner-Friendly)The IdeaJust simulate exactly what the problem says — find the first digit, remove it and its closest left non-digit, repeat.public String clearDigits(String s) { StringBuilder sb = new StringBuilder(s); boolean found = true; while (found) { found = false; for (int i = 0; i < sb.length(); i++) { if (Character.isDigit(sb.charAt(i))) { sb.deleteCharAt(i); // delete the digit if (i > 0) { sb.deleteCharAt(i - 1); // delete closest left non-digit } found = true; break; // restart the search } } } return sb.toString();}ComplexityTime: O(n²) — for each digit found, we restart scanning from the beginningSpace: O(n) — StringBuilder storageThis works fine for the given constraints (n ≤ 100), but it's not scalable for large inputs.Approach ComparisonApproachTimeSpaceCode SimplicityBest ForBrute ForceO(n²)O(n)⭐⭐⭐Understanding the problemStackO(n)O(n)⭐⭐⭐⭐Interviews (clear intent)StringBuilderO(n)O(n)⭐⭐⭐⭐⭐Production / Best solutionKey Takeaways1. Recognize the Stack Pattern Anytime a problem says "delete the closest left element," your brain should immediately scream stack. This pattern appears in many problems like Valid Parentheses, Asteroid Collision, and Backspace String Compare.2. StringBuilder is a hidden stack In Java, StringBuilder supports append() (push) and deleteCharAt(length-1) (pop). Using it directly instead of a Stack<Character> saves you the overhead of boxing/unboxing characters and the extra reverse step.3. The problem guarantees all digits can be deleted This means you'll never call deleteCharAt on an empty StringBuilder. In a real interview, you'd still want to add a guard check (if (sb.length() > 0)) to be safe and show defensive coding habits.Similar Problems to Practice844. Backspace String Compare — almost identical concept1047. Remove All Adjacent Duplicates In String — same stack pattern2390. Removing Stars From a String — stars act as backspace, same idea

StringStackString BuilderEasyLeetCode
LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

IntroductionThe Letter Case Permutation problem is a classic example of recursion and backtracking, often asked in coding interviews and frequently searched by learners preparing for platforms like LeetCode.This problem helps in understanding:Decision-making at each stepRecursive branchingString manipulationIn this article, we’ll break down the intuition, visualize the decision process using your decision tree, and implement an efficient Java solution.🔗 Problem LinkLeetCode: Letter Case PermutationProblem StatementGiven a string s, you can transform each alphabet character into:LowercaseUppercaseDigits remain unchanged.👉 Return all possible strings formed by these transformations.ExamplesExample 1Input:s = "a1b2"Output:["a1b2","a1B2","A1b2","A1B2"]Example 2Input:s = "3z4"Output:["3z4","3Z4"]Key InsightAt each character:If it's a digit → only one choiceIf it's a letter → two choices:lowercase OR uppercaseSo total combinations:2^(number of letters)Intuition (Using Your Decision Tree)For input: "a1b2"Start from index 0: "" / \ "a" "A" | | "a1" "A1" / \ / \ "a1b" "a1B" "A1b" "A1B" | | | | "a1b2" "a1B2" "A1b2" "A1B2"Understanding the TreeAt 'a' → branch into 'a' and 'A''1' → no branching (digit)'b' → again branching'2' → no branching📌 Leaf nodes = final answersApproach: Recursion + BacktrackingIdeaTraverse the string character by characterIf digit → move forwardIf letter → branch into:lowercaseuppercaseJava Codeimport java.util.*;class Solution { // List to store all results List<String> lis = new ArrayList<>(); public void solve(String s, int ind, String ans) { // Base case: reached end of string if (ind == s.length()) { lis.add(ans); // store generated string return; } char ch = s.charAt(ind); // If character is a digit → only one option if (ch >= '0' && ch <= '9') { solve(s, ind + 1, ans + ch); } else { // Choice 1: convert to lowercase solve(s, ind + 1, ans + Character.toLowerCase(ch)); // Choice 2: convert to uppercase solve(s, ind + 1, ans + Character.toUpperCase(ch)); } } public List<String> letterCasePermutation(String s) { solve(s, 0, ""); // start recursion return lis; }}Step-by-Step ExecutionFor "a1b2":Start → ""'a' → "a", "A"'1' → "a1", "A1"'b' → "a1b", "a1B", "A1b", "A1B"'2' → final stringsComplexity AnalysisTime Complexity: O(2^n)(n = number of letters)Space Complexity: O(2^n)(for storing results)Why This Approach WorksRecursion explores all possibilitiesEach letter creates a branching pointDigits pass through unchangedBacktracking ensures all combinations are generatedKey TakeawaysThis is a binary decision recursion problemLetters → 2 choicesDigits → 1 choiceDecision tree directly maps to recursionPattern similar to:SubsetsPermutations with conditionsWhen This Problem Is AskedCommon in:Coding interviewsRecursion/backtracking roundsString manipulation problemsConclusionThe Letter Case Permutation problem is a perfect example of how recursion can be used to explore all possible combinations efficiently.Once the decision tree is clear, the implementation becomes straightforward. This pattern is widely used in many advanced problems, making it essential to master.Frequently Asked Questions (FAQs)1. Why don’t digits create branches?Because they have only one valid form.2. What is the main concept used?Recursion with decision-making (backtracking).3. Can this be solved iteratively?Yes, using BFS or iterative expansion, but recursion is more intuitive.

LeetCodeMediumJavaRecursion
LeetCode 3121: Count the Number of Special Characters II – Java HashMap Solution Explained

LeetCode 3121: Count the Number of Special Characters II – Java HashMap Solution Explained

IntroductionLeetCode 3121 – Count the Number of Special Characters II is an interesting string and hashing problem that extends the logic of the previous Special Characters problem.This problem tests:Character indexingString traversalHashMap usageUppercase and lowercase handlingOrder-based conditionsUnlike Part I, this version adds an important restriction:Every lowercase occurrence must appear before the first uppercase occurrence.This additional condition makes the problem more challenging and interview-relevant.Problem Link🔗 https://leetcode.com/problems/count-the-number-of-special-characters-ii/Problem StatementYou are given a string:wordA character is called:specialif:It appears in both lowercase and uppercaseEvery lowercase occurrence appears before the first uppercase occurrenceReturn:Number of special charactersExample 1Inputword = "aaAbcBC"Output3ExplanationSpecial characters:'a''b''c'because:Lowercase letters appear firstUppercase letters appear laterExample 2Inputword = "abc"Output:0No uppercase letters exist.Example 3Inputword = "AbBCab"Output:0Explanation:Lowercase letters appear after uppercase letters.Condition fails.Key ObservationFor a character to be special:Last lowercase index < First uppercase indexThis is the entire logic of the problem.IntuitionWe need two pieces of information.For every character:Last occurrence of lowercase letterFirst occurrence of uppercase letterIf:lastLowercase < firstUppercasethen character is special.Brute Force ApproachIdeaFor every character:Traverse entire stringFind lowercase occurrencesFind uppercase occurrencesVerify ordering conditionBrute Force ComplexityTime ComplexityO(N²)because repeated traversal is required.Space ComplexityO(1)Optimized HashMap ApproachIdeaUse two HashMaps:Lowercase map stores last indexUppercase map stores first indexThen compare indices.Java Solutionclass Solution { public int numberOfSpecialChars(String word) { HashMap<Character, Integer> lower = new HashMap<>(); HashMap<Character, Integer> upper = new HashMap<>(); for(int i = 0; i < word.length(); i++) { if(word.charAt(i) >= 'a' && word.charAt(i) <= 'z') { lower.put(word.charAt(i), i); } else { if(!upper.containsKey(word.charAt(i))) { upper.put(word.charAt(i), i); } } } int ans = 0; for(int i = 0; i < word.length(); i++) { char up = Character.toUpperCase(word.charAt(i)); if(lower.containsKey(word.charAt(i)) && upper.containsKey(up)) { if(lower.get(word.charAt(i)) < upper.get(up)) { ans++; lower.remove(word.charAt(i)); upper.remove(up); } } } return ans; }}Cleaner Optimized Versionclass Solution { public int numberOfSpecialChars(String word) { int[] lastLower = new int[26]; int[] firstUpper = new int[26]; Arrays.fill(lastLower, -1); Arrays.fill(firstUpper, Integer.MAX_VALUE); for(int i = 0; i < word.length(); i++) { char ch = word.charAt(i); if(Character.isLowerCase(ch)) { lastLower[ch - 'a'] = i; } else { firstUpper[ch - 'A'] = Math.min(firstUpper[ch - 'A'], i); } } int count = 0; for(int i = 0; i < 26; i++) { if(lastLower[i] != -1 && firstUpper[i] != Integer.MAX_VALUE && lastLower[i] < firstUpper[i]) { count++; } } return count; }}Why This WorksFor every character:We store:last lowercase positionand:first uppercase positionThen simply check:lastLowercase < firstUppercaseIf true:Character satisfies problem condition.Dry RunInputword = "aaAbcBC"Step 1: Store IndicesLowercase positions:'a' → 1'b' → 3'c' → 4Uppercase positions:'A' → 2'B' → 5'C' → 6Step 2: Compare1 < 2 → valid3 < 5 → valid4 < 6 → validCount becomes:3Final Answer3Time Complexity AnalysisOptimized HashMap SolutionTime ComplexityO(N)because string traversal happens once.Space ComplexityO(1)Maximum alphabet size remains fixed.Brute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashMap / Array ApproachO(N)O(1)Interview ExplanationIn interviews, explain:A character is special only if its last lowercase occurrence appears before its first uppercase occurrence. We track indices efficiently using HashMaps or arrays.This demonstrates:String manipulation skillsIndex trackingHashing knowledgeOptimization thinkingCommon Mistakes1. Checking Only PresenceMany solutions only verify:lowercase exists && uppercase existsBut ordering condition is also required.2. Storing Wrong IndicesWe need:Last lowercase indexFirst uppercase indexnot the opposite.3. Double Counting CharactersAlways remove counted characters or use controlled traversal.4. Ignoring Case ConversionAlways convert correctly using:Character.toUpperCase(ch)FAQsQ1. Why store last lowercase occurrence?Because all lowercase letters must appear before uppercase.Q2. Why store first uppercase occurrence?Because it defines the earliest uppercase appearance.Q3. Can arrays replace HashMaps?Yes.Arrays are even more optimized because alphabet size is fixed.Q4. Is this problem interview important?Yes.It tests:String traversalIndex trackingCharacter handlingOptimization techniquesRelated ProblemsPractice these next:Count the Number of Special Characters IFirst Unique Character in a StringValid AnagramConclusionLeetCode 3121 is an excellent medium-level hashing and string problem.It teaches:Efficient index trackingHashMap usageOrder-based validationCharacter manipulationThe key insight is:A character is special only if its last lowercase occurrence appears before its first uppercase occurrence.Once this pattern becomes clear, many advanced string indexing problems become much easier.

LeetCodeJavaHashMapStringMedium
LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

IntroductionLeetCode 3120 – Count the Number of Special Characters I is a beginner-friendly string and hashing problem.This problem focuses on:Character manipulationUppercase and lowercase conversionHashSet usageString traversalBasic optimization techniquesIt is a good interview problem for testing:Understanding of ASCII charactersJava Character methodsSet operationsProblem-solving logicProblem Link🔗 https://leetcode.com/problems/count-the-number-of-special-characters-i/Problem StatementYou are given a string:wordA character is called:specialif it appears in both:LowercaseUppercaseReturn:Total number of special charactersExample 1Inputword = "aaAbcBC"Output3ExplanationCharacters:'a' and 'A''b' and 'B''c' and 'C'All appear in both cases.So answer is:3Example 2Inputword = "abc"Output:0No uppercase letters exist.Example 3Inputword = "abBCab"Output:1Only:'b' and 'B'appear in both forms.IntuitionWe need to check:For every lowercase character:Does its uppercase version exist?Using HashSet makes lookup very fast.Brute Force ApproachIdeaFor every character:Traverse entire stringSearch for uppercase/lowercase pairCount valid matchesBrute Force ComplexityTime ComplexityO(N²)because nested traversal is required.Space ComplexityO(1)Optimized HashSet ApproachIdeaUse two sets:One for lowercase lettersOne for uppercase lettersThen check matching pairs.Java Solutionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(int i = 0; i < word.length(); i++) {if(word.charAt(i) >= 'a' && word.charAt(i) <= 'z') {lower.add(word.charAt(i));}else {upper.add(word.charAt(i));}}int ans = 0;for(int i = 0; i < word.length(); i++) {char up = Character.toUpperCase(word.charAt(i));if(lower.contains(word.charAt(i)) && upper.contains(up)) {ans++;lower.remove(word.charAt(i));upper.remove(up);}}return ans;}}Cleaner Optimized Versionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(char ch : word.toCharArray()) {if(Character.isLowerCase(ch)) {lower.add(ch);}else {upper.add(ch);}}int count = 0;for(char ch : lower) {if(upper.contains(Character.toUpperCase(ch))) {count++;}}return count;}}Why This WorksWe separate:Lowercase charactersUppercase charactersThen for every lowercase letter:We check whether uppercase version exists.HashSet lookup works in:O(1)average time.Dry RunInputword = "aaAbcBC"Step 1Lowercase set:[a, b, c]Uppercase set:[A, B, C]Step 2Check:'a' → 'A' exists'b' → 'B' exists'c' → 'C' existsCount becomes:3Final Answer3Time Complexity AnalysisOptimized HashSet SolutionTime ComplexityO(N)because string traversal happens only once.Space ComplexityO(1)Maximum alphabet size is fixed:26 lowercase + 26 uppercaseBrute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashSet ApproachO(N)O(1)Interview ExplanationIn interviews, explain:We use two HashSets to separately store lowercase and uppercase letters. Then we check whether a lowercase character has its uppercase counterpart.This demonstrates:Efficient lookup usageHashing knowledgeCharacter manipulation skillsCommon Mistakes1. Double Counting CharactersWithout removing counted characters:same letter may be counted multiple times2. Forgetting Case ConversionAlways convert:Character.toUpperCase(ch)before comparison.3. Using Nested Loops UnnecessarilyHashSet reduces lookup complexity significantly.FAQsQ1. Why use HashSet?Because lookup operations are very fast.Q2. Can this be solved without extra space?Yes.Using arrays of size 26 is also possible.Q3. Why remove characters after counting?To avoid duplicate counting.Q4. Is this problem important for interviews?Yes.It tests:String handlingCharacter conversionHashSet usageOptimization thinkingRelated ProblemsPractice these next:Valid AnagramFirst Unique Character in a StringRansom NoteConclusionLeetCode 3120 is a simple but effective problem for learning:HashSet operationsString traversalCase conversionEfficient lookup techniquesThe key idea is:Store lowercase and uppercase letters separately, then check matching pairs efficiently.Once this pattern becomes clear, many string hashing problems become much easier.

LeetCodeJavaHashSetStringEasy
LeetCode 3838: Weighted Word Mapping – Java Solution Explained with Multiple Approaches

LeetCode 3838: Weighted Word Mapping – Java Solution Explained with Multiple Approaches

IntroductionLeetCode 3838, Weighted Word Mapping, is a straightforward yet interesting problem that combines several fundamental programming concepts:Character mappingHashingModular arithmeticString processingOptimization techniquesAt first glance, the problem appears to be a simple implementation exercise. However, it provides a great opportunity to discuss different approaches and understand how fixed-size alphabets can help us write more efficient code.In this article, we'll explore the problem step-by-step, discuss multiple solutions, perform a dry run, and analyze the complexity of each approach.Problem Link -: Weighted Word MappingProblem StatementYou are given:An array of strings wordsAn integer array weights of length 26Each index in the weights array corresponds to a lowercase English letter.For every word:Calculate the sum of character weights.Take the result modulo 26.Convert the modulo result into a letter using reverse alphabetical order:0 → z1 → y2 → x...25 → aReturn a string formed by concatenating all mapped letters.ExampleInputwords = ["abcd", "def", "xyz"]Output"rij"ExplanationFor the word "abcd":a = 5b = 3c = 12d = 14Total Weight = 3434 % 26 = 88 → rFor "def":14 + 1 + 2 = 1717 % 26 = 1717 → iFor "xyz":7 + 7 + 2 = 1616 % 26 = 1616 → jFinal Answer:"rij"Understanding the Core IdeaThe problem consists of three independent operations:Step 1: Calculate Word WeightFor each word:Weight(word) = Sum of character weightsExample:abca = 5b = 3c = 12Weight = 20Step 2: Apply Modulo 26The problem requires:Weight % 26This guarantees that the result always lies between:0 and 25Step 3: Reverse Alphabet MappingUnlike normal alphabet indexing:0 → a1 → b2 → cthe problem uses:0 → z1 → y2 → x...25 → aThis reverse mapping generates the final encoded character.Approach 1: HashMap-Based SolutionIntuitionCreate:Map 1Character → WeightExample:a → 5b → 3c → 12Map 2Modulo Value → CharacterExample:0 → z1 → y2 → xThen process each word and build the answer.Java Implementationclass Solution { public String mapWordWeights(String[] words, int[] weights) { HashMap<Character,Integer> weightMap = new HashMap<>(); HashMap<Integer,Character> reverseMap = new HashMap<>(); for(int i = 0; i < 26; i++) { char letter = (char)('a' + i); char reverseLetter = (char)('z' - i); weightMap.put(letter, weights[i]); reverseMap.put(i, reverseLetter); } StringBuilder answer = new StringBuilder(); for(String word : words) { int sum = 0; for(char ch : word.toCharArray()) { sum += weightMap.get(ch); } answer.append(reverseMap.get(sum % 26)); } return answer.toString(); }}Approach 2: Optimized Array SolutionObservationThe English alphabet contains only 26 letters.Instead of using HashMaps:weightMap.get(ch)we can directly access:weights[ch - 'a']This eliminates hashing overhead entirely.Why Is This Better?HashMap operations are O(1) on average, but they still involve:Hash computationBucket lookupInternal object handlingArray indexing is faster because it directly accesses memory.Optimized Java Solutionclass Solution { public String mapWordWeights(String[] words, int[] weights) { StringBuilder answer = new StringBuilder(); for(String word : words) { int sum = 0; for(char ch : word.toCharArray()) { sum += weights[ch - 'a']; } int mod = sum % 26; answer.append((char)('z' - mod)); } return answer.toString(); }}Dry RunInputwords = ["abcd"]Assume:a = 7b = 5c = 3d = 4Calculate Weight7 + 5 + 3 + 4 = 19Apply Modulo19 % 26 = 19Reverse Mapping0 → z1 → y2 → x...19 → gResult:"g"Complexity AnalysisHashMap SolutionTime ComplexityO(T)where T is the total number of characters across all words.Space ComplexityO(1)Only fixed-size maps of 26 elements are stored.Optimized Array SolutionTime ComplexityO(T)Space ComplexityO(1)No additional data structures are required.Which Solution Should You Use?ApproachTimeSpaceInterview PreferenceHashMapO(T)O(1)GoodDirect ArrayO(T)O(1)BestBoth solutions are efficient.However, the array-based approach is typically preferred in coding interviews because:Simpler implementationFaster executionLower memory overheadNo unnecessary hashingInterview DiscussionA common follow-up question is:Can we eliminate both HashMaps?Yes.Since:'a' to 'z'are contiguous ASCII characters, we can directly compute:weights[ch - 'a']Similarly:(char)('z' - mod)can generate the reverse mapping without storing another lookup table.This reduces code complexity while maintaining the same asymptotic performance.Key TakeawaysFixed-size alphabets often allow array-based optimizations.HashMaps improve readability but may not always be necessary.Modular arithmetic is useful for reducing values into a bounded range.Character arithmetic can replace lookup tables in many string problems.Always look for opportunities to replace generic data structures with direct indexing when the input domain is small and fixed.ConclusionLeetCode 3838: Weighted Word Mapping is an excellent beginner-friendly problem that demonstrates the practical use of hashing, modular arithmetic, and character manipulation.While a HashMap-based solution is intuitive and easy to understand, recognizing that the alphabet size is fixed allows us to develop a cleaner and more optimized array-based solution.Understanding both approaches not only helps solve this problem efficiently but also strengthens the problem-solving mindset needed for technical interviews and competitive programming.

LeetCodeEasyArrayHashMapStringFrequencyJava
LeetCode 402: Remove K Digits — Java Solution Explained

LeetCode 402: Remove K Digits — Java Solution Explained

IntroductionLeetCode 402 Remove K Digits is one of those problems where the brute force solution feels obvious but completely falls apart at scale — and the optimal solution requires a genuinely clever insight that, once you see it, feels like magic.This problem sits at the intersection of two powerful techniques — Greedy thinking and Monotonic Stack. If you have already solved Next Greater Element and Asteroid Collision, you have all the building blocks you need. This is where those patterns level up.You can find the problem here — LeetCode 402 Remove K Digits.What Is the Problem Really Asking?You are given a number as a string and an integer k. Remove exactly k digits from the number such that the resulting number is as small as possible. Return it as a string without leading zeros.Example:num = "1432219", k = 3We want to remove 3 digits to make the number as small as possibleRemove 4, 3, 2 → remaining is "1219"Output: "1219"Simple goal — smallest possible number after exactly k removals.Real Life Analogy — Choosing the Best Price TagImagine you are reading a price tag digit by digit from left to right. Every time you see a digit that is bigger than the next one coming, you have a chance to remove it and make the price smaller. You have a limited number of removals — use them wisely on the biggest offenders from the left side, because leftmost digits have the most impact on the overall value.Removing a 9 from the front of a number shrinks it far more than removing a 9 from the end. This left-to-right priority with greedy removal is the entire insight of this problem.The Core Greedy InsightHere is the key question — which digit should we remove first to make the number as small as possible?Think about it this way. In the number "1432219", which digit is hurting us the most? It is 4 — because it is large and sits early in the number. After removing 4 we get "132219". Now 3 is the biggest early offender. And so on.More precisely — whenever you see a digit that is greater than the digit immediately after it, removing it makes the number smaller. This is because a larger digit sitting before a smaller digit inflates the overall value.This is the Greedy rule: scan left to right, and whenever the current digit on the stack is greater than the incoming digit, remove it (if we still have removals left).A Monotonic Increasing Stack enforces exactly this — it keeps digits in non-decreasing order, automatically kicking out any digit that is larger than what comes next.The Solution — Monotonic Stackpublic String removeKdigits(String num, int k) { Stack<Character> st = new Stack<>(); // build monotonic increasing stack for (int i = 0; i < num.length(); i++) { // while stack top is greater than current digit and we still have removals while (!st.empty() && k != 0 && st.peek() > num.charAt(i)) { st.pop(); // remove the larger digit — greedy choice k--; } st.push(num.charAt(i)); } // if k removals still remaining, remove from the end (largest digits are at top) while (k != 0) { st.pop(); k--; } // build result string from stack StringBuilder sb = new StringBuilder(); while (!st.empty()) { sb.append(st.pop()); } sb.reverse(); // stack gives reverse order // remove leading zeros while (sb.length() > 0 && sb.charAt(0) == '0') { sb.deleteCharAt(0); } // if nothing left, return "0" return sb.length() == 0 ? "0" : sb.toString();}Step-by-Step Dry Run — num = "1432219", k = 3Processing 1: Stack empty → push. Stack: [1]Processing 4: Stack top 1 < 4 → no pop. Push 4. Stack: [1, 4]Processing 3: Stack top 4 > 3 and k=3 → pop 4, k=2. Stack: [1] Stack top 1 < 3 → stop. Push 3. Stack: [1, 3]Processing 2: Stack top 3 > 2 and k=2 → pop 3, k=1. Stack: [1] Stack top 1 < 2 → stop. Push 2. Stack: [1, 2]Processing 2: Stack top 2 == 2 → not greater, stop. Push 2. Stack: [1, 2, 2]Processing 1: Stack top 2 > 1 and k=1 → pop 2, k=0. Stack: [1, 2] k=0, stop. Push 1. Stack: [1, 2, 1]Processing 9: k=0, no more removals. Push 9. Stack: [1, 2, 1, 9]k is now 0, skip the cleanup loop.Build result: pop all → "9121" → reverse → "1219" No leading zeros. Return "1219" ✅Step-by-Step Dry Run — num = "10200", k = 1Processing 1: stack empty → push. Stack: [1]Processing 0: Stack top 1 > 0 and k=1 → pop 1, k=0. Stack: [] Push 0. Stack: [0]Processing 2: k=0, no removals. Push. Stack: [0, 2]Processing 0: k=0. Push. Stack: [0, 2, 0]Processing 0: k=0. Push. Stack: [0, 2, 0, 0]k=0, skip cleanup.Build result: "0020" → reverse → "0200" Remove leading zero → "200" Return "200" ✅Step-by-Step Dry Run — num = "10", k = 2Processing 1: push. Stack: [1]Processing 0: Stack top 1 > 0 and k=2 → pop 1, k=1. Stack: [] Push 0. Stack: [0]k=1 remaining → cleanup loop → pop 0, k=0. Stack: []Build result: empty string. Remove leading zeros: nothing to remove. Length is 0 → return "0" ✅The Three Tricky Cases You Must HandleCase 1 — k is not fully used after the loop This happens with a non-decreasing number like "12345" with k=2. No element ever gets popped during the loop because no digit is greater than the next one. The stack ends up as [1,2,3,4,5] with k still = 2. The solution is to pop from the top of the stack — which holds the largest digits — until k hits 0.Case 2 — Leading zeros After removing digits, the remaining number might start with zeros. "10200" becomes "0200" after removing 1. We strip leading zeros with a while loop. But we must be careful not to strip the only zero — that is why we check length > 0 before each removal.Case 3 — Empty result If all digits are removed (like "10" with k=2), the StringBuilder ends up empty. We return "0" because an empty number is represented as zero.Why Remaining k Gets Removed From the EndAfter the main loop, if k is still greater than 0, why do we remove from the top of the stack (which corresponds to the end of the number)?Because the stack at this point holds a non-decreasing sequence. In a non-decreasing sequence, the largest values are at the end. Removing from the end removes the largest remaining digits — which is exactly the greedy choice to minimize the number.For example in "12345" with k=2: the stack is [1,2,3,4,5]. Pop top twice → remove 5 and 4 → [1,2,3] → result is "123". Correct!Time and Space ComplexityTime Complexity: O(n) — each digit is pushed onto the stack exactly once and popped at most once. Even with the while loop inside the for loop, total push and pop operations across the entire run never exceed 2n. The leading zero removal is also O(n) in the worst case. Overall stays linear.Space Complexity: O(n) — the stack holds at most n digits in the worst case when no removals happen during the main loop.Common Mistakes to AvoidNot handling remaining k after the loop This is the most common mistake. If the number is already non-decreasing, the loop never pops anything. Forgetting the cleanup loop gives the wrong answer for inputs like "12345" with k=2.Not removing leading zeros After removals, the result might start with zeros. "0200" should be returned as "200". Skipping this step gives wrong output.Returning empty string instead of "0" When all digits are removed, return "0" not "". An empty string is not a valid number representation.Using >= instead of > in the pop condition If you pop on equal digits too, you remove more than necessary and might get wrong results. Only pop when strictly greater — equal digits in sequence are fine to keep.How This Connects to the Monotonic Stack SeriesLooking at the stack problems you have been solving:496 Next Greater Element — monotonic decreasing stack, find first bigger to the right 735 Asteroid Collision — stack simulation, chain reactions 402 Remove K Digits — monotonic increasing stack, greedy removal for minimum numberThe direction of the monotonic stack flips based on what you are optimizing. For "next greater" you keep a decreasing stack. For "smallest number" you keep an increasing stack. Recognizing which direction to go is the skill that connects all these problems.FAQs — People Also AskQ1. Why does a Monotonic Stack give the smallest number in LeetCode 402? A monotonic increasing stack ensures that at every point, the digits we have kept so far are in the smallest possible order. Whenever a smaller digit arrives and the stack top is larger, removing that larger digit can only make the number smaller — this greedy choice is always optimal.Q2. What happens if k is not fully used after the main loop in LeetCode 402? The number is already in non-decreasing order so no removals happened during the loop. The remaining removals should be made from the end of the number (top of stack) since those are the largest values in a non-decreasing sequence.Q3. How are leading zeros handled in LeetCode 402? After building the result string, strip any leading zeros with a while loop. If stripping leaves an empty string, return "0" because the empty case represents zero.Q4. What is the time complexity of LeetCode 402? O(n) time because each digit is pushed and popped at most once across the entire algorithm. Space complexity is O(n) for the stack.Q5. Is LeetCode 402 asked in coding interviews? Yes, it is frequently asked at companies like Google, Amazon, and Microsoft. It tests greedy thinking combined with monotonic stack — two patterns that interviewers love because they require genuine insight rather than memorization.Similar LeetCode Problems to Practice Next496. Next Greater Element I — Easy — monotonic decreasing stack739. Daily Temperatures — Medium — next greater with distances316. Remove Duplicate Letters — Medium — similar greedy stack with constraints1081. Smallest Subsequence of Distinct Characters — Medium — same approach as 31684. Largest Rectangle in Histogram — Hard — advanced monotonic stackConclusionLeetCode 402 Remove K Digits is a beautiful problem that rewards clear thinking. The greedy insight — always remove a digit when a smaller digit comes after it — naturally leads to the monotonic stack solution. The three edge cases (remaining k, leading zeros, empty result) are what separate a buggy solution from a clean, accepted one.Work through all three dry runs carefully. Once you see how the stack stays increasing and how each pop directly corresponds to a greedy removal decision, this pattern will click permanently and carry you through harder stack problems ahead.

LeetCodeJavaStackMonotonic StackGreedyStringMedium
What Is Dynamic Programming? Origin Story, Real-Life Uses, LeetCode Problems & Complete Beginner Guide

What Is Dynamic Programming? Origin Story, Real-Life Uses, LeetCode Problems & Complete Beginner Guide

Introduction — Why Dynamic Programming Feels Hard (And Why It Isn't)If you've ever stared at a LeetCode problem, read the solution, understood every single line, and still had absolutely no idea how someone arrived at it — welcome. You've just experienced the classic Dynamic Programming (DP) confusion.DP has a reputation. People treat it like some dark art reserved for competitive programmers or Google engineers. The truth? Dynamic Programming is one of the most logical, learnable, and satisfying techniques in all of computer science. Once it clicks, it really clicks.This guide will take you from zero to genuinely confident. We'll cover where DP came from, how it works, what patterns to learn, how to recognize DP problems, real-world places it shows up, LeetCode problems to practice, time complexity analysis, and the mistakes that trip up even experienced developers.Let's go.The Origin Story — Who Invented Dynamic Programming and Why?The term "Dynamic Programming" was coined by Richard Bellman in the early 1950s while working at RAND Corporation. Here's the funny part: the name was deliberately chosen to sound impressive and vague.Bellman was doing mathematical research that his employer — the US Secretary of Defense, Charles Wilson — would have found difficult to fund if described accurately. Wilson had a well-known distaste for the word "research." So Bellman invented a name that sounded suitably grand and mathematical: Dynamic Programming.In his autobiography, Bellman wrote that he picked the word "dynamic" because it had a precise technical meaning and was also impossible to use negatively. "Programming" referred to the mathematical sense — planning and decision-making — not computer programming.The underlying idea? Break a complex problem into overlapping subproblems, solve each subproblem once, and store the result so you never solve it twice.Bellman's foundational contribution was the Bellman Equation, which underpins not just algorithms but also economics, operations research, and modern reinforcement learning.So the next time DP feels frustrating, remember — even its inventor named it specifically to confuse people. You're in good company.What Is Dynamic Programming? (Simple Definition)Dynamic Programming is an algorithmic technique used to solve problems by:Breaking them down into smaller overlapping subproblemsSolving each subproblem only onceStoring the result (memoization or tabulation)Building up the final solution from those stored resultsThe key insight is overlapping subproblems + optimal substructure.Overlapping subproblems means the same smaller problems come up again and again. Instead of solving them every time (like plain recursion does), DP solves them once and caches the answer.Optimal substructure means the optimal solution to the whole problem can be built from optimal solutions to its subproblems.If a problem has both these properties — it's a DP problem.The Two Approaches to Dynamic Programming1. Top-Down with Memoization (Recursive + Cache)You write a recursive solution exactly as you would naturally, but add a cache (usually a dictionary or array) to store results you've already computed.fib(n):if n in cache: return cache[n]if n <= 1: return ncache[n] = fib(n-1) + fib(n-2)return cache[n]This is called memoization — remember what you computed so you don't repeat yourself.Pros: Natural to write, mirrors the recursive thinking, easy to reason about. Cons: Stack overhead from recursion, risk of stack overflow on large inputs.2. Bottom-Up with Tabulation (Iterative)You figure out the order in which subproblems need to be solved, then solve them iteratively from the smallest up, filling a table.fib(n):dp = [0, 1]for i from 2 to n:dp[i] = dp[i-1] + dp[i-2]return dp[n]This is called tabulation — fill a table, cell by cell, bottom to top.Pros: No recursion overhead, usually faster in practice, easier to optimize space. Cons: Requires thinking about the order of computation upfront.🧩 Dynamic Programming Template CodeBefore diving into how to recognize DP problems, here are ready-to-use Java templates for every major DP pattern. Think of these as your reusable blueprints — every DP problem you ever solve will fit into one of these structures. Just define your state, plug in your recurrence relation, and you are good to go.Template 1 — Top-Down (Memoization)import java.util.HashMap;import java.util.Map;public class TopDownDP {Map<Integer, Integer> memo = new HashMap<>();public int solve(int n) {// Base caseif (n <= 1) return n;// Check cacheif (memo.containsKey(n)) return memo.get(n);// Recurrence relation — change this part for your problemint result = solve(n - 1) + solve(n - 2);// Store in cachememo.put(n, result);return result;}}Template 2 — Bottom-Up (Tabulation)public class BottomUpDP {public int solve(int n) {// Create DP tableint[] dp = new int[n + 1];// Base casesdp[0] = 0;dp[1] = 1;// Fill the table bottom-upfor (int i = 2; i <= n; i++) {// Recurrence relation — change this part for your problemdp[i] = dp[i - 1] + dp[i - 2];}return dp[n];}}Template 3 — Bottom-Up with Space Optimizationpublic class SpaceOptimizedDP {public int solve(int n) {// Only keep last two values instead of full tableint prev2 = 0;int prev1 = 1;for (int i = 2; i <= n; i++) {// Recurrence relation — change this part for your problemint curr = prev1 + prev2;prev2 = prev1;prev1 = curr;}return prev1;}}Template 4 — 2D DP (Two Sequences or Grid)public class TwoDimensionalDP {public int solve(String s1, String s2) {int m = s1.length();int n = s2.length();// Create 2D DP tableint[][] dp = new int[m + 1][n + 1];// Base cases — first row and columnfor (int i = 0; i <= m; i++) dp[i][0] = i;for (int j = 0; j <= n; j++) dp[0][j] = j;// Fill table cell by cellfor (int i = 1; i <= m; i++) {for (int j = 1; j <= n; j++) {// Recurrence relation — change this part for your problemif (s1.charAt(i - 1) == s2.charAt(j - 1)) {dp[i][j] = dp[i - 1][j - 1];} else {dp[i][j] = 1 + Math.min(dp[i - 1][j],Math.min(dp[i][j - 1], dp[i - 1][j - 1]));}}}return dp[m][n];}}Template 5 — Knapsack Patternpublic class KnapsackDP {public int solve(int[] weights, int[] values, int capacity) {int n = weights.length;// dp[i][w] = max value using first i items with capacity wint[][] dp = new int[n + 1][capacity + 1];for (int i = 1; i <= n; i++) {for (int w = 0; w <= capacity; w++) {// Don't take item idp[i][w] = dp[i - 1][w];// Take item i if it fitsif (weights[i - 1] <= w) {dp[i][w] = Math.max(dp[i][w],values[i - 1] + dp[i - 1][w - weights[i - 1]]);}}}return dp[n][capacity];}}💡 How to use these templates:Step 1 — Identify which pattern your problem fits into. Step 2 — Define what dp[i] or dp[i][j] means in plain English before writing any code. Step 3 — Write your recurrence relation on paper first. Step 4 — Plug it into the matching template above. Step 5 — Handle your specific base cases carefully.🎥 Visual Learning Resource — Watch This Before Moving ForwardIf you prefer learning by watching before reading, this free full-length course by freeCodeCamp is one of the best Dynamic Programming resources on the internet. Watch it alongside this guide for maximum understanding.Credit: freeCodeCamp — a free, nonprofit coding education platform.How to Recognize a Dynamic Programming ProblemAsk yourself these four questions:1. Can I define the problem in terms of smaller versions of itself? If you can write a recursive formula (recurrence relation), DP might apply.2. Do the subproblems overlap? If a naive recursive solution would recompute the same thing many times, DP is the right tool.3. Is there an optimal substructure? Is the best answer to the big problem made up of best answers to smaller problems?4. Are you looking for a count, minimum, maximum, or yes/no answer? DP problems often ask: "What is the minimum cost?", "How many ways?", "Can we achieve X?"Red flag words in problem statements: minimum, maximum, shortest, longest, count the number of ways, can we reach, is it possible, fewest steps.The Core DP Patterns You Must LearnMastering DP is really about recognizing patterns. Here are the most important ones:Pattern 1 — 1D DP (Linear) Problems where the state depends on previous elements in a single sequence. Examples: Fibonacci, Climbing Stairs, House Robber.Pattern 2 — 2D DP (Grid / Two-sequence) Problems with two dimensions of state, often grids or two strings. Examples: Longest Common Subsequence, Edit Distance, Unique Paths.Pattern 3 — Interval DP You consider all possible intervals or subarrays and build solutions from them. Examples: Matrix Chain Multiplication, Burst Balloons, Palindrome Partitioning.Pattern 4 — Knapsack DP (0/1 and Unbounded) You decide whether to include or exclude items under a capacity constraint. Examples: 0/1 Knapsack, Coin Change, Partition Equal Subset Sum.Pattern 5 — DP on Trees State is defined per node; you combine results from children. Examples: Diameter of Binary Tree, House Robber III, Maximum Path Sum.Pattern 6 — DP on Subsets / Bitmask DP State includes a bitmask representing which elements have been chosen. Examples: Travelling Salesman Problem, Shortest Superstring.Pattern 7 — DP on Strings Matching, editing, or counting arrangements within strings. Examples: Longest Palindromic Subsequence, Regular Expression Matching, Wildcard Matching.Top LeetCode Problems to Practice Dynamic Programming (With Links)Here are the essential problems, organized by difficulty and pattern. Solve them in this order.Beginner — Warm UpProblemPatternLinkClimbing Stairs1D DPhttps://leetcode.com/problems/climbing-stairs/Fibonacci Number1D DPhttps://leetcode.com/problems/fibonacci-number/House Robber1D DPhttps://leetcode.com/problems/house-robber/Min Cost Climbing Stairs1D DPhttps://leetcode.com/problems/min-cost-climbing-stairs/Best Time to Buy and Sell Stock1D DPhttps://leetcode.com/problems/best-time-to-buy-and-sell-stock/Intermediate — Core PatternsProblemPatternLinkCoin ChangeKnapsackhttps://leetcode.com/problems/coin-change/Longest Increasing Subsequence1D DPhttps://leetcode.com/problems/longest-increasing-subsequence/Longest Common Subsequence2D DPhttps://leetcode.com/problems/longest-common-subsequence/0/1 Knapsack (via Subset Sum)Knapsackhttps://leetcode.com/problems/partition-equal-subset-sum/Unique Paths2D Grid DPhttps://leetcode.com/problems/unique-paths/Jump Game1D DP / Greedyhttps://leetcode.com/problems/jump-game/Word BreakString DPhttps://leetcode.com/problems/word-break/Decode Ways1D DPhttps://leetcode.com/problems/decode-ways/Edit Distance2D String DPhttps://leetcode.com/problems/edit-distance/Triangle2D DPhttps://leetcode.com/problems/triangle/Advanced — Interview LevelProblemPatternLinkBurst BalloonsInterval DPhttps://leetcode.com/problems/burst-balloons/Regular Expression MatchingString DPhttps://leetcode.com/problems/regular-expression-matching/Wildcard MatchingString DPhttps://leetcode.com/problems/wildcard-matching/Palindrome Partitioning IIInterval DPhttps://leetcode.com/problems/palindrome-partitioning-ii/Maximum Profit in Job SchedulingDP + Binary Searchhttps://leetcode.com/problems/maximum-profit-in-job-scheduling/Distinct Subsequences2D DPhttps://leetcode.com/problems/distinct-subsequences/Cherry Pickup3D DPhttps://leetcode.com/problems/cherry-pickup/Real-World Use Cases of Dynamic ProgrammingDP is not just for coding interviews. It is deeply embedded in the technology you use every day.1. Google Maps & Navigation (Shortest Path) The routing engines behind GPS apps use DP-based algorithms like Dijkstra and Bellman-Ford to find the shortest or fastest path between two points across millions of nodes.2. Spell Checkers & Autocorrect (Edit Distance) When your phone corrects "teh" to "the," it is computing Edit Distance — a classic DP problem — between what you typed and every word in the dictionary.3. DNA Sequence Alignment (Bioinformatics) Researchers use the Needleman-Wunsch and Smith-Waterman algorithms — both DP — to align DNA and protein sequences and find similarities between species or identify mutations.4. Video Compression (MPEG, H.264) Modern video codecs use DP to determine the most efficient way to encode video frames, deciding which frames to store as full images and which to store as differences from the previous frame.5. Financial Portfolio Optimization Investment algorithms use DP to find the optimal allocation of assets under risk constraints — essentially a variant of the knapsack problem.6. Natural Language Processing (NLP) The Viterbi algorithm — used in speech recognition, part-of-speech tagging, and machine translation — is a DP algorithm. Every time Siri or Google Assistant understands your sentence, DP played a role.7. Game AI (Chess, Checkers) Game trees and minimax algorithms with memoization use DP to evaluate board positions and find the best move without recomputing already-seen positions.8. Compiler Optimization Compilers use DP to decide the optimal order of operations and instruction scheduling to generate the most efficient machine code.9. Text Justification (Word Processors) Microsoft Word and LaTeX use DP to optimally break paragraphs into lines — minimizing raggedness and maximizing visual appeal.10. Resource Scheduling in Cloud Computing AWS, Google Cloud, and Azure use DP-based scheduling to assign computational tasks to servers in the most cost-efficient way possible.Time Complexity Analysis of Common DP ProblemsUnderstanding the time complexity of DP is critical for interviews and for building scalable systems.ProblemTime ComplexitySpace ComplexityNotesFibonacci (naive recursion)O(2ⁿ)O(n)Exponential — terribleFibonacci (DP)O(n)O(1) with optimizationLinear — excellentLongest Common SubsequenceO(m × n)O(m × n)m, n = lengths of two stringsEdit DistanceO(m × n)O(m × n)Can optimize space to O(n)0/1 KnapsackO(n × W)O(n × W)n = items, W = capacityCoin ChangeO(n × amount)O(amount)Classic tabulationLongest Increasing SubsequenceO(n²) or O(n log n)O(n)Binary search version is fasterMatrix Chain MultiplicationO(n³)O(n²)Interval DPTravelling Salesman (bitmask)O(2ⁿ × n²)O(2ⁿ × n)Still exponential but manageable for small nThe general rule: DP trades time for space. You use memory to avoid recomputation. The time complexity equals the number of unique states multiplied by the work done per state.How to Learn and Master Dynamic Programming — Step by StepHere is an honest, structured path to mastery:Step 1 — Get recursion absolutely solid first. DP is memoized recursion at its core. If you cannot write clean recursive solutions confidently, DP will remain confusing. Practice at least 20 pure recursion problems first.Step 2 — Start with the classics. Fibonacci → Climbing Stairs → House Robber → Coin Change. These teach you the core pattern of defining state and transition without overwhelming you.Step 3 — Learn to define state explicitly. Before writing any code, ask: "What does dp[i] represent?" Write it in plain English. "dp[i] = the minimum cost to reach step i." This single habit separates good DP thinkers from struggling ones.Step 4 — Write the recurrence relation before coding. On paper or in a comment. Example: dp[i] = min(dp[i-1] + cost[i-1], dp[i-2] + cost[i-2]). If you can write the recurrence, the code writes itself.Step 5 — Master one pattern at a time. Don't jump between knapsack and interval DP in the same week. Spend a few days on each pattern until it feels intuitive.Step 6 — Solve the same problem both ways. Top-down and bottom-up. This builds deep understanding of what DP is actually doing.Step 7 — Optimize space after getting correctness. Many 2D DP solutions can use a single row instead of a full matrix. Learn this optimization after you understand the full solution.Step 8 — Do timed practice under interview conditions. Give yourself 35 minutes per problem. Review what you got wrong. DP is a muscle — it builds with reps.Common Mistakes in Dynamic Programming (And How to Avoid Them)Mistake 1 — Jumping to code before defining state. The most common DP error. Always define what dp[i] or dp[i][j] means before writing a single line of code.Mistake 2 — Wrong base cases. A single wrong base case corrupts every answer built on top of it. Trace through your base cases manually on a tiny example before running code.Mistake 3 — Off-by-one errors in indexing. Whether your dp array is 0-indexed or 1-indexed must be 100% consistent throughout. This causes more bugs in DP than almost anything else.Mistake 4 — Confusing top-down with bottom-up state order. In bottom-up DP, you must ensure that when you compute dp[i], all values it depends on are already filled. If you compute in the wrong order, you get garbage answers.Mistake 5 — Memoizing in the wrong dimension. In 2D problems, some people cache only one dimension when the state actually requires two. Always identify all variables that affect the outcome.Mistake 6 — Using global mutable state in recursion. If you use a shared array and don't clear it between test cases, you'll get wrong answers on subsequent inputs. Always scope your cache correctly.Mistake 7 — Not considering the full state space. In problems like Knapsack, forgetting that the state is (item index, remaining capacity) — not just item index — leads to fundamentally wrong solutions.Mistake 8 — Giving up after not recognizing the pattern immediately. DP problems don't announce themselves. The skill is learning to ask "is there overlapping subproblems here?" on every problem. This takes time. Don't mistake unfamiliarity for inability.Frequently Asked Questions About Dynamic ProgrammingQ: Is Dynamic Programming the same as recursion? Not exactly. Recursion is a technique for breaking problems into smaller pieces. DP is recursion plus memoization — or iterative tabulation. All DP can be written recursively, but not all recursion is DP.Q: What is the difference between DP and Divide and Conquer? Divide and Conquer (like Merge Sort) breaks problems into non-overlapping subproblems. DP is used when subproblems overlap — meaning the same subproblem is solved multiple times in a naive approach.Q: How do I know when NOT to use DP? If the subproblems don't overlap (no repeated computation), greedy or divide-and-conquer may be better. If the problem has no optimal substructure, DP won't give a correct answer.Q: Do I need to memorize DP solutions for interviews? No. You need to recognize patterns and be able to derive the recurrence relation. Memorizing solutions without understanding them will fail you in interviews. Focus on the thinking process.Q: How long does it take to get good at DP? Most people start to feel genuinely comfortable after solving 40–60 varied DP problems with deliberate practice. The first 10 feel impossible. The next 20 feel hard. After 50, patterns start feeling obvious.Q: What programming language is best for DP? Any language works. Python is often used for learning because its dictionaries make memoization trivial. C++ is preferred in competitive programming for its speed. For interviews, use whatever language you're most comfortable in.Q: What is space optimization in DP? Many DP problems only look back one or two rows to compute the current row. In those cases, you can replace an n×m table with just two arrays (or even one), reducing space complexity from O(n×m) to O(m). This is called space optimization or rolling array technique.Q: Can DP be applied to graph problems? Absolutely. Shortest path algorithms like Bellman-Ford are DP. Longest path in a DAG is DP. DP on trees is a rich subfield. Anywhere you have states and transitions, DP can potentially apply.Q: Is Greedy a type of Dynamic Programming? Greedy is related but distinct. Greedy makes locally optimal choices without reconsidering. DP considers all choices and picks the globally optimal one. Some DP solutions reduce to greedy when the structure allows, but they are different techniques.Q: What resources should I use to learn DP? For structured learning: Neetcode.io (organized problem list), Striver's DP Series on YouTube, and the book "Introduction to Algorithms" (CLRS) for theoretical depth. For practice: LeetCode's Dynamic Programming study plan and Codeforces for competitive DP.Final Thoughts — Dynamic Programming Is a SuperpowerDynamic Programming is genuinely one of the most powerful ideas in computer science. It shows up in your GPS, your autocorrect, your streaming video, your bank's risk models, and the AI assistants you talk to daily.The path to mastering it is not memorization. It is developing the habit of asking: can I break this into smaller problems that overlap? And then learning to define state clearly, write the recurrence, and trust the process.Start with Climbing Stairs. Write dp[i] in plain English before every problem. Solve everything twice — top-down and bottom-up. Do 50 problems with genuine reflection, not just accepted solutions.The click moment will come. And when it does, you'll wonder why it ever felt hard.

Dynamic ProgrammingMemoizationTabulationJavaOrigin StoryRichard Bellman
Find the Difference – Smart ASCII Sum Trick (LeetCode 389)

Find the Difference – Smart ASCII Sum Trick (LeetCode 389)

🔗 Problem LinkLeetCode 389 – Find the Difference 👉 https://leetcode.com/problems/find-the-difference/IntroductionThis is a very clever problem.At first glance, you might think:Use a HashMapCount frequenciesCompare both stringsBut there’s a much smarter and cleaner way to solve it using character arithmetic (ASCII values).This problem teaches an important lesson:Sometimes math can replace extra space.Let’s break it down.📌 Problem UnderstandingYou are given two strings:stString t is created by:Shuffling string sAdding one extra character at a random positionYour task:Return the extra character added to t.Example 1Input: s = "abcd" t = "abcde"Output: "e"Example 2Input: s = "" t = "y"Output: "y"🧠 First Intuition (Brute Force Thinking)When solving this for the first time, a common approach would be:Count frequency of characters in sCount frequency of characters in tCompare bothThe one with extra count is the answerThat works in O(n) time and O(26) space.But we can do better.🚀 Smarter Approach – ASCII Sum Trick💡 Key InsightCharacters are stored as integer ASCII values.If:We add all ASCII values of characters in tSubtract all ASCII values of characters in sWhat remains?👉 The ASCII value of the extra character.Because:All matching characters cancel out.Only the added character remains.💻 Your Codeclass Solution { public char findTheDifference(String s, String t) { int tot = 0; for(int i = 0; i < t.length(); i++){ tot += (int)t.charAt(i); } for(int i = 0; i < s.length(); i++){ tot -= (int)s.charAt(i); } return (char)tot; }}🔍 Step-by-Step Explanation1️⃣ Initialize Totalint tot = 0;This will store the running ASCII difference.2️⃣ Add All Characters of ttot += (int)t.charAt(i);We add ASCII values of every character in t.3️⃣ Subtract All Characters of stot -= (int)s.charAt(i);We subtract ASCII values of every character in s.4️⃣ Return Remaining Characterreturn (char)tot;After subtraction, only the extra character’s ASCII value remains.We convert it back to char.🎯 Why This WorksLet’s take example:s = "abcd"t = "abcde"ASCII Sum:t = a + b + c + d + es = a + b + c + dSubtract:(t sum) - (s sum) = eEverything cancels except the extra letter.Simple and powerful.⏱ Complexity AnalysisTime Complexity: O(n)One loop over tOne loop over sSpace Complexity: O(1)No extra data structure used.🔥 Even Smarter Approach – XOR TrickAnother elegant method is using XOR:Why XOR Works?Properties:a ^ a = 0a ^ 0 = aXOR is commutativeIf we XOR all characters in both strings:Matching characters cancel out.Only the extra character remains.XOR Versionclass Solution { public char findTheDifference(String s, String t) { char result = 0; for(char c : s.toCharArray()){ result ^= c; } for(char c : t.toCharArray()){ result ^= c; } return result; }}This is considered the most elegant solution.🏁 Final ThoughtsThis problem teaches:Thinking beyond brute forceUsing mathematical propertiesUnderstanding ASCII representationUsing XOR smartlySometimes the best solution is not about data structures — it’s about recognizing hidden math patterns.

StringMath TrickASCIIBit ManipulationLeetCodeEasy
Longest Substring with K Unique Characters – Efficient Sliding Window Solution

Longest Substring with K Unique Characters – Efficient Sliding Window Solution

IntroductionFinding substrings with unique characters is a common problem in string manipulation and interview questions.GFG’s Longest Substring with K Unique Characters problem challenges you to find the length of the longest substring containing exactly K distinct characters.The focus is not just on brute-force solutions, but on using sliding window with a HashMap to efficiently track character frequencies and window boundaries.If you’d like to try solving the problem first, you can attempt it here: Try the problem on GeeksforGeeks: https://leetcode.com/problems/max-consecutive-ones-iii/Problem UnderstandingYou are given:A string s of lowercase lettersAn integer kYour task: Return the length of the longest substring containing exactly k distinct characters.Examples:Input: s = "aabacbebebe", k = 3Output: 7Explanation: "cbebebe" is the longest substring with 3 distinct characters.Input: s = "aaaa", k = 2Output: -1Explanation: No substring contains exactly 2 distinct characters.Input: s = "aabaaab", k = 2Output: 7Explanation: "aabaaab" has exactly 2 unique characters.A naive approach would try all possible substrings, count unique characters, and track the max length.Time Complexity: O(n²)Inefficient for large stringsKey Idea: Sliding Window + HashMapInstead of recomputing the unique characters for every substring:Use a HashMap to store character frequencies in the current windowUse two pointers (i and j) to maintain the windowExpand the window by moving j and add characters to the mapShrink the window from the left when the number of unique characters exceeds kUpdate the max length whenever the window has exactly k unique charactersThis ensures each character is processed only once, giving a linear solution.Approach (Step-by-Step)Initialize a HashMap mp to store character countsUse two pointers i (window start) and j (window end)Iterate over the string with jAdd s[j] to the map and update its countCheck the map size:If size < k → move j forwardIf size == k → update max length, move j forwardIf size > k → shrink window from i until map size <= kAfter iterating, return max (or -1 if no valid substring exists)Optimization:Using a HashMap avoids recalculating the number of unique characters for every substringSliding window ensures O(n) complexityImplementation (Java)class Solution {public int longestKSubstr(String s, int k) {HashMap<Character,Integer> mp = new HashMap<>();int i = 0, j = 0;int max = -1;while (j < s.length()) {// Add current character to mapmp.put(s.charAt(j), mp.getOrDefault(s.charAt(j), 0) + 1);if (mp.size() < k) {j++;}else if (mp.size() == k) {// Update max length when exactly k unique charactersmax = Math.max(max, j - i + 1);j++;}else {// Shrink window until map size <= kwhile (mp.size() > k) {mp.put(s.charAt(i), mp.get(s.charAt(i)) - 1);if (mp.get(s.charAt(i)) == 0) {mp.remove(s.charAt(i));}i++;}max = Math.max(max, j - i + 1);j++;}}return max;}}Dry Run ExampleInput:s = "aabacbebebe", k = 3Execution:Window [0-4] = "aaba" → unique = 2 → continueWindow [1-6] = "abacb" → unique = 3 → max = 5Window [4-10] = "cbebebe" → unique = 3 → max = 7Output:7Complexity AnalysisTime Complexity: O(n) → Each character enters and leaves the window onceSpace Complexity: O(k) → HashMap stores at most k unique charactersEdge Cases Consideredk greater than number of unique characters → return -1Entire string has exactly k unique charactersString with repeated characters onlyMinimum string length (1)Sliding Window Pattern ImportanceThis problem reinforces a common sliding window + hashmap pattern used in:Longest substring problems with constraintsCounting substrings with exactly K conditionsOptimizing brute-force approaches to linear solutionsConclusionBy combining sliding window with HashMap frequency tracking, we reduce an O(n²) problem to O(n).Once you master this approach, many string and substring problems with constraints on unique characters become much easier to solve efficiently.

SlidingWindowHashMapStringsGFG
Roman to Integer – Easy Explanation with Java Solution (LeetCode 13)

Roman to Integer – Easy Explanation with Java Solution (LeetCode 13)

Try the QuestionYou can try solving the problem here before reading the solution:👉 https://leetcode.com/problems/roman-to-integer/Practicing it yourself first helps you understand the logic better.Roman to Integer – Complete GuideRoman numerals are an ancient numbering system used by the Romans. Instead of digits like 1, 2, 3, they used specific characters to represent values.This problem asks us to convert a Roman numeral string into its corresponding integer value.It is a very common interview question and frequently appears in coding platforms like LeetCode, HackerRank, and coding interviews at product-based companies.Roman Numeral SymbolsRoman numerals consist of seven characters, each representing a fixed value.SymbolValueI1V5X10L50C100D500M1000Example conversions:III = 3 → 1 + 1 + 1XII = 12 → 10 + 1 + 1XXVII = 27 → 10 + 10 + 5 + 1 + 1Normally, Roman numerals are written from largest to smallest from left to right.But there is an important exception.The Subtraction RuleIn some cases, Roman numerals use subtraction instead of addition.If a smaller value appears before a larger value, it means we subtract it.Examples:RomanCalculationResultIV5 − 14IX10 − 19XL50 − 1040XC100 − 1090CD500 − 100400CM1000 − 100900These are the only valid subtraction cases.Example WalkthroughExample 1Inputs = "III"ExplanationI + I + I = 1 + 1 + 1 = 3Output3Example 2Inputs = "LVIII"ExplanationL = 50V = 5III = 350 + 5 + 3 = 58Output58Example 3Inputs = "MCMXCIV"ExplanationM = 1000CM = 900XC = 90IV = 4Total = 1994Output1994Intuition Behind the SolutionThe key idea is to compare each Roman numeral with the numeral to its right.Two situations occur:Case 1 — Normal AdditionIf the current value ≥ next valueWe simply add it to the total.ExampleVI5 + 1 = 6Case 2 — Subtraction CaseIf the current value < next valueWe subtract it.ExampleIV5 - 1 = 4Strategy to SolveCreate a HashMap to store Roman numeral values.Start from the rightmost character.Initialize total with the last character's value.Move from right to left.Compare the current numeral with the next numeral.If smaller → subtract.Otherwise → add.Continue until the beginning of the string.This approach works because Roman numerals follow a local comparison rule.Java Implementationclass Solution { public int romanToInt(String s) { HashMap<Character,Integer> mp = new HashMap<>(); mp.put('I',1); mp.put('V',5); mp.put('X',10); mp.put('L',50); mp.put('C',100); mp.put('D',500); mp.put('M',1000); int tot = mp.get(s.charAt(s.length()-1)); char arr[] = s.toCharArray(); int j = s.length()-2; for(int i = arr.length-1; i >= 0; i--){ if(j >= 0){ if(mp.get(arr[j]) < mp.get(arr[i])){ tot -= mp.get(arr[j]); }else if(mp.get(arr[j]) > mp.get(arr[i])){ tot += mp.get(arr[j]); }else{ tot += mp.get(arr[j]); } } j--; } return tot; }}Code ExplanationStep 1 — Store Roman ValuesWe create a HashMap so we can quickly get the numeric value of each Roman character.I → 1V → 5X → 10...This allows O(1) lookup time.Step 2 — Initialize TotalWe start with the last character.int tot = mp.get(s.charAt(s.length()-1));Why?Because the last numeral is always added, never subtracted.Step 3 — Traverse from Right to LeftWe move backward through the string.for(int i = arr.length-1; i >= 0; i--)And compare with the previous character.Step 4 — Apply Roman RulesIf the previous numeral is smaller than the current numeral:tot -= valueExampleIV5 - 1If it is greater or equal:tot += valueExampleVI5 + 1Time ComplexityO(n)Where n = length of the string.We only traverse the string once.Space ComplexityO(1)The HashMap size is constant (only 7 entries).Key Takeaways✔ Roman numerals mostly use addition✔ Subtraction occurs only in six specific cases✔ Comparing current and next value is the simplest approach✔ A single pass solution (O(n)) is enoughThis is why this problem is commonly used to test string processing and logical reasoning in coding interviews.Final ThoughtsThe Roman to Integer problem is a great beginner-friendly problem that teaches:HashMap usageString traversalConditional logicPattern recognitionMastering these simple problems builds a strong foundation for more complex algorithmic questions.If you're preparing for coding interviews, this is definitely a problem you should practice.

LeetCodeJavaString ProblemsEasyRoman Numerals
LeetCode 682 Baseball Game - Java Solution Explained

LeetCode 682 Baseball Game - Java Solution Explained

IntroductionLeetCode 682 Baseball Game is one of the cleanest and most beginner-friendly stack simulation problems on LeetCode. It does not require any fancy algorithm or deep insight — it purely tests whether you can carefully read the rules and simulate them faithfully using the right data structure.But do not let "Easy" fool you. This problem is a great place to practice thinking about which data structure fits best and why. We will solve it three different ways — Stack, ArrayList, and Deque — so you can see the tradeoffs and pick the one that makes most sense to you.You can find the problem here — LeetCode 682 Baseball Game.What Is the Problem Really Asking?You are keeping score for a baseball game with four special rules. You process a list of operations one by one and maintain a record of scores. At the end, return the total sum of all scores in the record.The four operations are:A number (like "5" or "-2") — just add that number as a new score to the record."C" — the last score was invalid, remove it from the record."D" — add a new score that is double the most recent score."+" — add a new score that is the sum of the two most recent scores.That is it. Four rules, simulate them in order, sum up what is left.Real Life Analogy — A Scoreboard With CorrectionsImagine a scoreboard operator at a sports event. They write scores on a whiteboard as the game progresses:A player scores 5 points → write 5Another player scores 2 → write 2Referee says last score was invalid → erase the last number (C)Special bonus rule kicks in → double the last valid score (D)Two scores combine → add the last two scores as one entry (+)At the end, add up everything on the whiteboard. The stack is your whiteboard — you write on top and erase from the top.Why Stack Is the Natural FitAll four operations only ever look at or modify the most recently added scores. C removes the last one. D doubles the last one. + uses the last two. This "most recent first" access pattern is the definition of LIFO — Last In First Out — which is exactly what a Stack provides.Any time a problem says "the previous score" or "the last two scores," your brain should immediately think Stack.Approach 1: Stack (Your Solution) ✅The IdeaUse a Stack of integers. For each operation:Number → parse and pushC → pop the topD → peek the top, push doubled value+ → pop top two, push both back, push their sumpublic int calPoints(String[] operations) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < operations.length; i++) { String op = operations[i]; if (op.equals("C")) { st.pop(); // remove last score } else if (op.equals("D")) { st.push(st.peek() * 2); // double of last score } else if (op.equals("+")) { int prev1 = st.pop(); // most recent score int prev2 = st.pop(); // second most recent score int sum = prev1 + prev2; st.push(prev2); // put them back st.push(prev1); st.push(sum); // push the new score } else { st.push(Integer.parseInt(op)); // regular number } } // sum all remaining scores int total = 0; while (!st.empty()) { total += st.pop(); } return total;}One small improvement over your original solution — using op.equals("C") instead of op.charAt(0) == 'C'. This is cleaner and handles edge cases better since negative numbers like "-2" also start with - not a digit, so charAt(0) comparisons can get tricky. Using equals is always safer for string operations.Why the + Operation Needs Pop-Push-PopThe trickiest part is the + operation. You need the two most recent scores. Stack only lets you see the top. So you pop the first, then the second, compute the sum, then push both back before pushing the sum. This restores the record correctly — the previous two scores stay, and the new sum score is added on top.Detailed Dry Run — ops = ["5","2","C","D","+"]Let us trace every step carefully:"5" → number, parse and push Stack: [5]"2" → number, parse and push Stack: [5, 2]"C" → remove last score, pop Stack: [5]"D" → double last score, peek=5, push 10 Stack: [5, 10]"+" → sum of last two:pop prev1 = 10pop prev2 = 5sum = 15push prev2=5, push prev1=10, push sum=15 Stack: [5, 10, 15]Sum all: 5 + 10 + 15 = 30 ✅Detailed Dry Run — ops = ["5","-2","4","C","D","9","+","+"]"5" → push 5. Stack: [5]"-2" → push -2. Stack: [5, -2]"4" → push 4. Stack: [5, -2, 4]"C" → pop 4. Stack: [5, -2]"D" → peek=-2, push -4. Stack: [5, -2, -4]"9" → push 9. Stack: [5, -2, -4, 9]"+" → prev1=9, prev2=-4, sum=5. Push -4, 9, 5. Stack: [5, -2, -4, 9, 5]"+" → prev1=5, prev2=9, sum=14. Push 9, 5, 14. Stack: [5, -2, -4, 9, 5, 14]Sum: 5 + (-2) + (-4) + 9 + 5 + 14 = 27 ✅Approach 2: ArrayList (Most Readable)The IdeaArrayList gives you index-based access which makes the + operation much cleaner — no need to pop and push back. Just access the last two elements directly using size()-1 and size()-2.public int calPoints(String[] operations) { ArrayList<Integer> record = new ArrayList<>(); for (String op : operations) { int n = record.size(); if (op.equals("C")) { record.remove(n - 1); // remove last element } else if (op.equals("D")) { record.add(record.get(n - 1) * 2); // double last } else if (op.equals("+")) { // sum of last two — no need to remove and re-add! record.add(record.get(n - 1) + record.get(n - 2)); } else { record.add(Integer.parseInt(op)); } } int total = 0; for (int score : record) { total += score; } return total;}See how the + operation becomes a single line with ArrayList? record.get(n-1) + record.get(n-2) directly accesses the last two elements without any pop-push gymnastics.Dry Run — ops = ["5","2","C","D","+"]"5" → add 5. List: [5]"2" → add 2. List: [5, 2]"C" → remove last. List: [5]"D" → 5×2=10, add 10. List: [5, 10]"+" → get(0)+get(1) = 5+10=15, add 15. List: [5, 10, 15]Sum: 30 ✅Time Complexity: O(n) — single pass through operations Space Complexity: O(n) — ArrayList stores at most n scoresThe one tradeoff — remove(n-1) on an ArrayList is O(1) for the last element (no shifting needed). And get() is O(1). So this is fully O(n) overall and arguably the cleanest solution to read and understand.Approach 3: Deque (ArrayDeque — Fastest in Java)The IdeaArrayDeque is faster than Stack in Java because Stack is synchronized (thread-safe overhead) and ArrayDeque is not. For single-threaded LeetCode problems, ArrayDeque is always the better choice over Stack.public int calPoints(String[] operations) { Deque<Integer> deque = new ArrayDeque<>(); for (String op : operations) { if (op.equals("C")) { deque.pollLast(); // remove last } else if (op.equals("D")) { deque.offerLast(deque.peekLast() * 2); // double last } else if (op.equals("+")) { int prev1 = deque.pollLast(); int prev2 = deque.pollLast(); int sum = prev1 + prev2; deque.offerLast(prev2); // restore deque.offerLast(prev1); // restore deque.offerLast(sum); // new score } else { deque.offerLast(Integer.parseInt(op)); } } int total = 0; for (int score : deque) { total += score; } return total;}The logic is identical to the Stack approach. The only difference is the method names — offerLast instead of push, pollLast instead of pop, peekLast instead of peek.Time Complexity: O(n) Space Complexity: O(n)For iterating a Deque to sum, you can use a for-each loop directly — no need to pop everything out like with Stack.Approach ComparisonApproachTimeSpaceBest ForStackO(n)O(n)Classic interview answer, clear LIFO intentArrayListO(n)O(n)Cleanest code, easiest to readArrayDequeO(n)O(n)Best performance, preferred in productionAll three approaches have identical time and space complexity. The difference is purely in code style and readability. In an interview, any of these is perfectly acceptable. Mention that ArrayDeque is preferred over Stack in Java for performance if you want to impress.Why op.equals() Is Better Than op.charAt(0)Your original solution uses operations[i].charAt(0) == 'C' to check operations. This works but has a subtle risk — the + character check with charAt(0) is fine, but imagine if a future test had a number starting with C or D (it will not in this problem but defensive coding is a good habit). More importantly, "-2".charAt(0) is '-' which is fine, but using equals is semantically clearer — you are comparing the whole string, not just the first character. This shows cleaner coding habits in interviews.Edge Cases to KnowNegative numbers like "-2" Integer.parseInt("-2") handles negatives perfectly. The D operation on -2 gives -4. The + operation works correctly with negatives too. No special handling needed."C" after a "+" that added a score The problem guarantees C always has at least one score to remove. So after + adds a score, a C removes just that one new score — the previous two scores that + used remain intact. This is correct behavior and our solution handles it automatically.All scores removed If all operations are numbers followed by C operations removing every score, the stack ends up empty and the sum is 0. Our while loop handles this correctly — it simply never executes and returns 0.Only one operation A single number like ["5"] → push 5, sum is 5. Works fine.Common Mistakes to AvoidIn the + operation, forgetting to push both numbers back When you pop prev1 and prev2 to compute the sum, you must push them back onto the stack before pushing the sum. If you only push the sum without restoring prev1 and prev2, those scores disappear from the record permanently — which is wrong. The + operation only adds a new score, it does not remove the previous ones.Using charAt(0) comparison for detecting numbers Negative numbers start with -, not a digit. If you check charAt(0) >= '0' && charAt(0) <= '9' to detect numbers, you will miss negatives. The safest approach is to check for C, D, and + explicitly using equals, and fall through to the else for everything else (which covers both positive and negative numbers).Calling st.peek() or st.pop() without checking empty The problem guarantees valid operations — C always has something to remove, + always has two previous scores, D always has one. But in real code and defensive interview solutions, adding empty checks shows good habits even when the constraints guarantee safety.FAQs — People Also AskQ1. Why is Stack a good choice for LeetCode 682 Baseball Game? Because all four operations only access the most recently added scores — the last score for C and D, the last two for +. This "most recent first" access pattern is exactly what LIFO (Last In First Out) provides. Stack's push, pop, and peek all run in O(1) making it perfectly efficient.Q2. What is the time complexity of LeetCode 682? O(n) time where n is the number of operations. Each operation performs a constant number of stack operations (at most 3 pushes/pops for the + case). Space complexity is O(n) for storing scores.Q3. Why does the + operation need to pop and push back in the Stack approach? Stack only gives direct access to the top element. To get the second most recent score, you must pop the first one, peek/pop the second, then push the first one back. The ArrayList approach avoids this by using index-based access directly.Q4. What is the difference between Stack and ArrayDeque in Java for this problem? Both work correctly. ArrayDeque is faster because Stack is a legacy class that extends Vector and is synchronized (thread-safe), adding unnecessary overhead for single-threaded use. ArrayDeque has no synchronization overhead. For LeetCode and interviews, either is acceptable but ArrayDeque is technically better.Q5. Is LeetCode 682 asked in coding interviews? It appears occasionally as a warmup or screening problem. Its main value is testing whether you can carefully simulate rules without making logical errors — a skill that matters in systems programming, game development, and any domain with complex state management.Similar LeetCode Problems to Practice Next71. Simplify Path — Medium — stack simulation with path operations1047. Remove All Adjacent Duplicates In String — Easy — stack simulation735. Asteroid Collision — Medium — stack simulation with conditions150. Evaluate Reverse Polish Notation — Medium — stack with arithmetic operations, very similar pattern227. Basic Calculator II — Medium — stack with operator precedenceConclusionLeetCode 682 Baseball Game is a perfect problem to build confidence with stack simulation. The four operations are clearly defined, the rules are unambiguous, and the stack maps naturally to every operation. Once you understand why pop-push-back is needed for + in the stack approach and how ArrayList simplifies that with index access, you have genuinely understood the tradeoffs between these data structures.If you are newer to stacks, start with the ArrayList solution for clarity. Once that clicks, rewrite it with Stack to understand the LIFO mechanics. Then try ArrayDeque to understand why it is preferred in modern Java code.

LeetCodeJavaStackArrayListDequeEasy
Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

IntroductionThe Permutation with Spaces problem is a classic recursion question that helps build a strong understanding of decision-making and backtracking patterns.Instead of generating permutations by rearranging characters, this problem focuses on inserting spaces between characters in all possible ways.What makes this problem powerful is its decision tree structure, which you’ve already visualized perfectly. In this article, we will directly connect that intuition with code.Link of Problem: GeeksforGeeks – Permutation with SpacesProblem StatementGiven a string s, generate all possible strings by placing:Either a spaceOr no spacebetween every pair of characters.Return all results in sorted order.ExampleInput:s = "ABC"Output:A B CA BCAB CABCUnderstanding Your Decision Tree (Very Important)Two Choices at Each Step:❌ Do NOT add space before the character✔️ Add space before the characterMapping TreeFrom diagram:At B:"AB" → no space"A B" → spaceAt C:From "AB":"ABC""AB C"From "A B":"A BC""A B C"Final Output (Leaf Nodes)As shown in your diagram:ABC, AB C, A BC, A B C📌 This is exactly what recursion generates.Key InsightAt every index (except first), we have:2 choices → space OR no spaceSo total combinations:2^(n-1)Approach: Recursion + Decision MakingIdeaFix the first characterFor every next character:Add space + characterAdd character directlyContinue recursivelyJava Code with Detailed Commentsimport java.util.*;class Solution { // List to store all results ArrayList<String> lis = new ArrayList<>(); void solve(String s, int ind, String curr) { // Base case: // If index reaches end of string, // we have formed one valid permutation if (ind == s.length()) { lis.add(curr); // store the result return; } // Choice 1: Add SPACE before current character // Example: "A" → "A B" solve(s, ind + 1, curr + " " + s.charAt(ind)); // Choice 2: Do NOT add space // Example: "A" → "AB" solve(s, ind + 1, curr + s.charAt(ind)); } ArrayList<String> permutation(String s) { // Start with first character (no space before it) String curr = "" + s.charAt(0); // Start recursion from index 1 solve(s, 1, curr); // Sort results as required in problem Collections.sort(lis); return lis; }}Step-by-Step Execution (Using Your Tree)For "ABC":Start → "A"At "B":"AB""A B"At "C":"ABC", "AB C""A BC", "A B C"Exactly matches your decision tree leaf nodes ✅Complexity AnalysisTime Complexity: O(2ⁿ)Space Complexity: O(2ⁿ)Why This Approach WorksRecursion explores every possible choiceEach level = one characterEach branch = decision (space / no space)Leaf nodes = final answersKey TakeawaysThis is a binary decision recursion problemAlways identify:ChoicesBase conditionYour decision tree = direct blueprint of recursionSame pattern applies to:SubsetsBinary choices problemsConclusionThe Permutation with Spaces problem becomes extremely simple once the decision tree is understood—and your diagram already captures that perfectly.The recursion directly follows the same structure:Every branch = one decisionEvery leaf = one answerMaster this pattern, and you’ll find many recursion problems much easier to solve.

MediumGeeksforGeeksRecursionJava
LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

IntroductionThe Generate Parentheses problem is one of the most important and frequently asked backtracking questions in coding interviews.At first glance, it may look like a simple string generation problem—but the real challenge is to generate only valid (well-formed) parentheses combinations.This problem is a perfect example of:Constraint-based recursionBacktracking with conditionsDecision tree pruningIn this article, we’ll break down the intuition, understand the constraints, and implement a clean and efficient solution.🔗 Problem LinkLeetCode: Generate ParenthesesProblem StatementGiven n pairs of parentheses:👉 Generate all combinations of well-formed parenthesesExamplesExample 1Input:n = 3Output:["((()))","(()())","(())()","()(())","()()()"]Example 2Input:n = 1Output:["()"]Key InsightWe are not generating all possible strings—we are generating only valid parentheses.Rules of Valid ParenthesesNumber of ( must equal number of )At any point:closing brackets should never exceed opening bracketsIntuition (Decision Making)At every step, we have two choices:Add "(" OR Add ")"But we cannot always take both choices.Valid ConditionsWhen can we add "("?If open > 0When can we add ")"?If close > open👉 This ensures the string always remains valid.Decision Tree (n = 3)👉 You can add your tree diagram here for better visualization.Conceptual FlowStart: ""→ "(" → "(("→ "(((" → "((()"→ ...Invalid paths like ")(" are never explored because of constraints.Approach: Backtracking with ConstraintsIdeaKeep track of:Remaining open bracketsRemaining close bracketsBuild string step by stepOnly take valid decisionsJava Codeimport java.util.*;class Solution {// List to store all valid combinationsList<String> lis = new ArrayList<>();public void solve(int open, int close, String curr) {// Base case: no brackets leftif (open == 0 && close == 0) {lis.add(curr); // valid combinationreturn;}// Choice 1: Add opening bracket "("// Allowed only if we still have opening brackets leftif (open > 0) {solve(open - 1, close, curr + "(");}// Choice 2: Add closing bracket ")"// Allowed only if closing brackets > opening bracketsif (open < close) {solve(open, close - 1, curr + ")");}}public List<String> generateParenthesis(int n) {solve(n, n, ""); // start recursionreturn lis;}}Step-by-Step Execution (n = 2)Start: ""→ "("→ "(("→ "(())"→ "()"→ "()()"Complexity AnalysisTime Complexity: O(4ⁿ / √n) (Catalan Number)Space Complexity: O(n) recursion stackWhy Catalan Number?The number of valid parentheses combinations is:Cn = (1 / (n+1)) * (2n choose n)Why This Approach WorksIt avoids invalid combinations earlyUses constraints to prune recursion treeGenerates only valid resultsEfficient compared to brute force❌ Naive Approach (Why It Fails)Generate all combinations of ( and ):Total combinations = 2^(2n)Then filter valid ones👉 Very inefficient → TLEKey TakeawaysThis is a constraint-based recursion problemAlways:Add "(" if availableAdd ")" only if validBacktracking avoids invalid pathsImportant pattern for interviewsCommon Interview VariationsValid parentheses checkingLongest valid parenthesesRemove invalid parenthesesBalanced expressionsConclusionThe Generate Parentheses problem is a must-know backtracking problem. It teaches how to apply constraints during recursion to efficiently generate valid combinations.Once mastered, this pattern becomes extremely useful in solving many advanced recursion problems.Frequently Asked Questions (FAQs)1. Why can’t we add ")" anytime?Because it may create invalid sequences like ")(".2. What is the key trick?Ensure:close > open3. Is recursion the best approach?Yes, it is the most intuitive and efficient method.

MediumLeetCodeJavaRecursion
Check if All Characters Have Equal Number of Occurrences – Frequency Map Approach (LeetCode 1941)

Check if All Characters Have Equal Number of Occurrences – Frequency Map Approach (LeetCode 1941)

🔗 Problem LinkLeetCode 1941 – Check if All Characters Have Equal Number of Occurrences 👉 https://leetcode.com/problems/check-if-all-characters-have-equal-number-of-occurrences/IntroductionThis is one of those problems that looks very simple at first glance — and it actually is — but it helps strengthen your understanding of frequency counting using HashMap.The problem asks us to determine whether all characters in a string occur the same number of times.No sliding window. No binary search. Just clean frequency logic.But even simple problems help build strong foundations.📌 Problem UnderstandingA string is considered "good" if:Every character that appears in the stringAppears the same number of timesIf even one character has a different frequency → return false.Example 1Input: s = "abacbc"Output: trueCharacter counts:a → 2b → 2c → 2All equal → ✔ trueExample 2Input: s = "aaabb"Output: falseCharacter counts:a → 3b → 2Not equal → ✘ false🧠 Approach & IntuitionWhen I saw this problem, my thinking was:Count the frequency of every character.Compare all frequencies.If all are equal → return true.The important part is choosing a reference frequency and comparing everything against it.💻 Your Codeclass Solution { public boolean areOccurrencesEqual(String s) { HashMap<Character,Integer> mp = new HashMap<>(); int ref =0; char c = s.charAt(0); for(int i =0 ; i< s.length();i++){ if(c == s.charAt(i)){ ref++; } mp.put(s.charAt(i),mp.getOrDefault(s.charAt(i),0)+1); } for(int a:mp.values()){ if(ref != a){ return false; } } return true; }}🔍 Step-by-Step Explanation1️⃣ Initialize HashMapHashMap<Character,Integer> mp = new HashMap<>();This stores frequency of each character.2️⃣ Choose Reference Characterchar c = s.charAt(0);int ref = 0;You use the first character as a reference.Then count how many times it appears while also building the frequency map.3️⃣ Build Frequency Mapmp.put(s.charAt(i), mp.getOrDefault(s.charAt(i), 0) + 1);This line increases count for each character.4️⃣ Compare Frequenciesfor(int a : mp.values()){ if(ref != a){ return false; }}If any frequency differs from the reference count → return false.Otherwise → true.⏱ Time and Space ComplexityTime Complexity: O(n)One loop to count frequenciesOne loop over at most 26 charactersSpace Complexity: O(26) ≈ O(1)Only lowercase English letters are allowed.🔥 Small Optimization IdeaYour solution works perfectly.However, we can simplify it slightly:Instead of separately counting the reference frequency, we can:First build the entire frequency map.Take the frequency of the first character from the map.Compare all values with it.Cleaner Versionclass Solution { public boolean areOccurrencesEqual(String s) { HashMap<Character,Integer> mp = new HashMap<>(); for(char ch : s.toCharArray()){ mp.put(ch, mp.getOrDefault(ch, 0) + 1); } int ref = mp.get(s.charAt(0)); for(int freq : mp.values()){ if(freq != ref){ return false; } } return true; }}Same logic — slightly cleaner structure.🎯 Key Learning from This ProblemThis problem reinforces:Frequency counting using HashMapUsing a reference value for comparisonClean loop logicEarly return for optimizationEven though it is an easy problem, it builds the base for harder problems like:Valid AnagramGroup AnagramsFirst Unique CharacterRansom Note🏁 Final ThoughtsProblems like this are not about complexity.They are about:Writing clean logicHandling frequency maps properlyThinking clearly about conditionsMastering easy problems makes medium and hard problems much easier later.

HashMapStringFrequency CountLeetCodeEasy
Ransom Note – Frequency Counting Made Simple (LeetCode 383)

Ransom Note – Frequency Counting Made Simple (LeetCode 383)

🔗 Problem LinkLeetCode 383 – Ransom Note 👉 https://leetcode.com/problems/ransom-note/IntroductionThis is a classic frequency-count problem that tests your understanding of:Character countingHashMap usageGreedy validation logicAt first glance, the problem looks very simple — but it’s a very common interview question because it checks whether you can think in terms of resource usage.Here:magazine → available resourcesransomNote → required resourcesWe must check if the available letters are sufficient to construct the ransom note.📌 Problem UnderstandingYou are given:ransomNotemagazineRules:Each letter in magazine can be used only once.Return true if ransomNote can be formed.Otherwise return false.Example 1Input: ransomNote = "a", magazine = "b"Output: falseExample 2Input: ransomNote = "aa", magazine = "ab"Output: falseExample 3Input: ransomNote = "aa", magazine = "aab"Output: true🧠 IntuitionThe logic is straightforward:Count frequency of each character in magazine.For each character in ransomNote:Check if it exists in the map.Check if its frequency is greater than 0.Reduce frequency after using it.If at any point we cannot use a character → return false.This is a greedy approach.💻 Your Codeclass Solution { public boolean canConstruct(String r, String m) { HashMap<Character,Integer> mp = new HashMap<>(); for(int i =0 ; i < m.length();i++){ mp.put(m.charAt(i),mp.getOrDefault(m.charAt(i),0)+1); } for(int i = 0 ; i <r.length();i++){ if(mp.containsKey(r.charAt(i)) && mp.get(r.charAt(i)) > 0){ mp.put(r.charAt(i),mp.get(r.charAt(i)) -1); }else{ return false; } } return true; }}🔍 Step-by-Step Explanation1️⃣ Build Frequency Map from MagazineHashMap<Character,Integer> mp = new HashMap<>();for(int i =0 ; i < m.length();i++){ mp.put(m.charAt(i), mp.getOrDefault(m.charAt(i),0) + 1);}We count how many times each character appears in the magazine.2️⃣ Check Each Character in Ransom Notefor(int i = 0 ; i < r.length();i++){For every character in ransomNote:3️⃣ Validate Availabilityif(mp.containsKey(r.charAt(i)) && mp.get(r.charAt(i)) > 0)If:Character exists in mapFrequency is still availableThen reduce its count:mp.put(r.charAt(i), mp.get(r.charAt(i)) - 1);Otherwise:return false;Immediately stop if we cannot construct.🎯 Why This WorksWe treat:magazine as supplyransomNote as demandWe reduce supply every time we use a character.If supply runs out → construction fails.⏱ Complexity AnalysisTime Complexity: O(n + m)One pass to build map from magazineOne pass to check ransomNoteSpace Complexity: O(26) ≈ O(1)Only lowercase English letters.🔥 Even Better Optimization – Using Array Instead of HashMapSince we know:Only lowercase letters are allowedWe can use an integer array of size 26.This is faster and more memory-efficient.Optimized Versionclass Solution { public boolean canConstruct(String r, String m) { int[] freq = new int[26]; for(char c : m.toCharArray()){ freq[c - 'a']++; } for(char c : r.toCharArray()){ if(freq[c - 'a'] == 0){ return false; } freq[c - 'a']--; } return true; }}This avoids HashMap overhead.🏁 Final ThoughtsThis problem reinforces:Frequency counting patternGreedy character usageEarly exit for optimizationUsing arrays instead of HashMap when character set is limitedIt’s a foundational problem that appears often in interviews.If you master this pattern, you can easily solve:Valid AnagramFind the DifferenceCheck if All Characters Have Equal OccurrencesPermutation in String

HashMapStringFrequency CountGreedyLeetCodeEasy
LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium
Recursion in Java - Complete Guide With Examples and Practice Problems

Recursion in Java - Complete Guide With Examples and Practice Problems

IntroductionIf there is one topic in programming that confuses beginners more than anything else, it is recursion. Most people read the definition, nod their head, and then immediately freeze when they have to write recursive code themselves.The problem is not that recursion is genuinely hard. The problem is that most explanations start with code before building the right mental model. Once you have the right mental model, recursion clicks permanently and you start seeing it everywhere — in tree problems, graph problems, backtracking, dynamic programming, divide and conquer, and more.This guide covers everything from the ground up. What recursion is, how the call stack works, how to identify base cases and recursive cases, every type of recursion, common patterns, time and space complexity analysis, the most common mistakes, and the top LeetCode problems to practice.By the end of this article, recursion will not feel like magic anymore. It will feel like a natural tool you reach for confidently.What Is Recursion?Recursion is when a function calls itself to solve a smaller version of the same problem.That is the complete definition. But let us make it concrete.Imagine you want to count down from 5 to 1. One way is a loop. Another way is — print 5, then solve the exact same problem for counting down from 4 to 1. Then print 4, solve for 3. And so on until you reach the base — there is nothing left to count down.void countDown(int n) { if (n == 0) return; // stop here System.out.println(n); countDown(n - 1); // solve the smaller version}The function countDown calls itself with a smaller input each time. Eventually it reaches 0 and stops. That stopping condition is the most important part of any recursive function — the base case.The Two Parts Every Recursive Function Must HaveEvery correctly written recursive function has exactly two parts. Without both, the function either gives wrong answers or runs forever.Part 1: Base CaseThe base case is the condition under which the function stops calling itself and returns a direct answer. It is the smallest version of the problem that you can solve without any further recursion.Without a base case, recursion never stops and you get a StackOverflowError — Java's way of telling you the call stack ran out of memory.Part 2: Recursive CaseThe recursive case is where the function calls itself with a smaller or simpler input — moving closer to the base case with each call. If your recursive case does not make the problem smaller, you have an infinite loop.Think of it like a staircase. The base case is the ground floor. The recursive case is each step going down. Every step must genuinely bring you one level closer to the ground.How Recursion Works — The Call StackThis is the mental model that most explanations skip, and it is the reason recursion confuses people.Every time a function is called in Java, a new stack frame is created and pushed onto the call stack. This frame stores the function's local variables, parameters, and where to return to when the function finishes.When a recursive function calls itself, a new frame is pushed on top. When that call finishes, its frame is popped and execution returns to the previous frame.Let us trace countDown(3) through the call stack:countDown(3) called → frame pushed prints 3 calls countDown(2) → frame pushed prints 2 calls countDown(1) → frame pushed prints 1 calls countDown(0) → frame pushed n == 0, return → frame popped back in countDown(1), return → frame popped back in countDown(2), return → frame popped back in countDown(3), return → frame poppedOutput: 3, 2, 1The call stack grows as calls go deeper, then shrinks as calls return. This is why recursion uses O(n) space for n levels deep — each level occupies one stack frame in memory.Your First Real Recursive Function — FactorialFactorial is the classic first recursion example. n! = n × (n-1) × (n-2) × ... × 1Notice the pattern — n! = n × (n-1)!. The factorial of n is n times the factorial of n-1. That recursive structure makes it perfect for recursion.public int factorial(int n) { // base case if (n == 0 || n == 1) return 1; // recursive case return n * factorial(n - 1);}Dry Run — factorial(4)factorial(4)= 4 * factorial(3)= 4 * 3 * factorial(2)= 4 * 3 * 2 * factorial(1)= 4 * 3 * 2 * 1= 24The call stack builds up going in, then multiplications happen coming back out. This "coming back out" phase is called the return phase or unwinding of the stack.Time Complexity: O(n) — n recursive calls Space Complexity: O(n) — n frames on the call stackThe Two Phases of RecursionEvery recursive function has two phases and understanding both is critical.Phase 1: The Call Phase (Going In)This happens as the function keeps calling itself with smaller inputs. Things you do before the recursive call happen in this phase — in order from the outermost call to the innermost.Phase 2: The Return Phase (Coming Back Out)This happens as each call finishes and returns to its caller. Things you do after the recursive call happen in this phase — in reverse order, from the innermost call back to the outermost.This distinction explains why the output order can be surprising:void printBothPhases(int n) { if (n == 0) return; System.out.println("Going in: " + n); // call phase printBothPhases(n - 1); System.out.println("Coming out: " + n); // return phase}For printBothPhases(3):Going in: 3Going in: 2Going in: 1Coming out: 1Coming out: 2Coming out: 3This two-phase understanding is what makes problems like reversing a string or printing a linked list backwards via recursion feel natural.Types of RecursionRecursion is not one-size-fits-all. There are several distinct types and knowing which type applies to a problem shapes how you write the solution.1. Direct RecursionThe function calls itself directly. This is the most common type — what we have seen so far.void direct(int n) { if (n == 0) return; direct(n - 1); // calls itself}2. Indirect RecursionFunction A calls Function B which calls Function A. They form a cycle.void funcA(int n) { if (n <= 0) return; System.out.println("A: " + n); funcB(n - 1);}void funcB(int n) { if (n <= 0) return; System.out.println("B: " + n); funcA(n - 1);}Used in: state machines, mutual recursion in parsers, certain mathematical sequences.3. Tail RecursionThe recursive call is the last operation in the function. Nothing happens after the recursive call returns — no multiplication, no addition, nothing.// NOT tail recursive — multiplication happens after returnint factorial(int n) { if (n == 1) return 1; return n * factorial(n - 1); // multiply after return — not tail}// Tail recursive — recursive call is the last thingint factorialTail(int n, int accumulator) { if (n == 1) return accumulator; return factorialTail(n - 1, n * accumulator); // last operation}Why does tail recursion matter? In languages that support tail call optimization (like Scala, Kotlin, and many functional languages), tail recursive functions can be converted to iteration internally — no stack frame accumulation, O(1) space. Java does NOT perform tail call optimization, but understanding tail recursion is still important for interviews and functional programming concepts.4. Head RecursionThe recursive call happens first, before any other processing. All processing happens in the return phase.void headRecursion(int n) { if (n == 0) return; headRecursion(n - 1); // call first System.out.println(n); // process after}// Output: 1 2 3 4 5 (processes in reverse order of calls)5. Tree RecursionThe function makes more than one recursive call per invocation. This creates a tree of calls rather than a linear chain. Fibonacci is the classic example.int fibonacci(int n) { if (n <= 1) return n; return fibonacci(n - 1) + fibonacci(n - 2); // TWO recursive calls}The call tree for fibonacci(4): fib(4) / \ fib(3) fib(2) / \ / \ fib(2) fib(1) fib(1) fib(0) / \ fib(1) fib(0)Time Complexity: O(2ⁿ) — exponential! Each call spawns two more. Space Complexity: O(n) — maximum depth of the call treeThis is why memoization (caching results) is so important for tree recursion — it converts O(2ⁿ) to O(n) by never recomputing the same subproblem twice.6. Mutual RecursionA specific form of indirect recursion where two functions call each other alternately to solve a problem. Different from indirect recursion in that the mutual calls are the core mechanism of the solution.// Check if a number is even or odd using mutual recursionboolean isEven(int n) { if (n == 0) return true; return isOdd(n - 1);}boolean isOdd(int n) { if (n == 0) return false; return isEven(n - 1);}Common Recursion Patterns in DSAThese are the patterns you will see over and over in interview problems. Recognizing them is more important than memorizing solutions.Pattern 1: Linear Recursion (Do Something, Recurse on Rest)Process the current element, then recurse on the remaining problem.// Sum of arrayint arraySum(int[] arr, int index) { if (index == arr.length) return 0; // base case return arr[index] + arraySum(arr, index + 1); // current + rest}Pattern 2: Divide and Conquer (Split Into Two Halves)Split the problem into two halves, solve each recursively, combine results.// Merge Sortvoid mergeSort(int[] arr, int left, int right) { if (left >= right) return; // base case — single element int mid = (left + right) / 2; mergeSort(arr, left, mid); // sort left half mergeSort(arr, mid + 1, right); // sort right half merge(arr, left, mid, right); // combine}Pattern 3: Backtracking (Try, Recurse, Undo)Try a choice, recurse to explore it, undo the choice when backtracking.// Generate all subsetsvoid subsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { if (index == nums.length) { result.add(new ArrayList<>(current)); return; } // Choice 1: include nums[index] current.add(nums[index]); subsets(nums, index + 1, current, result); current.remove(current.size() - 1); // undo // Choice 2: exclude nums[index] subsets(nums, index + 1, current, result);}Pattern 4: Tree Recursion (Left, Right, Combine)Recurse on left subtree, recurse on right subtree, combine or process results.// Height of binary treeint height(TreeNode root) { if (root == null) return 0; // base case int leftHeight = height(root.left); // solve left int rightHeight = height(root.right); // solve right return 1 + Math.max(leftHeight, rightHeight); // combine}Pattern 5: Memoization (Cache Recursive Results)Store results of recursive calls so the same subproblem is never solved twice.Map<Integer, Integer> memo = new HashMap<>();int fibonacci(int n) { if (n <= 1) return n; if (memo.containsKey(n)) return memo.get(n); // return cached int result = fibonacci(n - 1) + fibonacci(n - 2); memo.put(n, result); // cache before returning return result;}This converts Fibonacci from O(2ⁿ) to O(n) time with O(n) space — a massive improvement.Recursion vs Iteration — When to Use WhichThis is one of the most common interview questions about recursion. Here is a clear breakdown:Use Recursion when:The problem has a naturally recursive structure (trees, graphs, divide and conquer)The solution is significantly cleaner and easier to understand recursivelyThe problem involves exploring multiple paths or choices (backtracking)The depth of recursion is manageable (not too deep to cause stack overflow)Use Iteration when:The problem is linear and a loop is equally clearMemory is a concern (iteration uses O(1) stack space vs O(n) for recursion)Performance is critical and function call overhead mattersJava's stack size limit could be hit (default around 500-1000 frames for deep recursion)The key rule: Every recursive solution can be converted to an iterative one (usually using an explicit stack). But recursive solutions for tree and graph problems are almost always cleaner to write and understand.Time and Space Complexity of Recursive FunctionsAnalyzing complexity for recursive functions requires a specific approach.The Recurrence Relation MethodExpress the time complexity as a recurrence relation and solve it.Factorial:T(n) = T(n-1) + O(1) = T(n-2) + O(1) + O(1) = T(1) + n×O(1) = O(n)Fibonacci (naive):T(n) = T(n-1) + T(n-2) + O(1) ≈ 2×T(n-1) = O(2ⁿ)Binary Search:T(n) = T(n/2) + O(1) = O(log n) [by Master Theorem]Merge Sort:T(n) = 2×T(n/2) + O(n) = O(n log n) [by Master Theorem]Space Complexity Rule for RecursionSpace complexity of a recursive function = maximum depth of the call stack × space per frameLinear recursion (factorial, sum): O(n) spaceBinary recursion (Fibonacci naive): O(n) space (maximum depth, not number of nodes)Divide and conquer (merge sort): O(log n) space (depth of recursion tree)Memoized Fibonacci: O(n) space (memo table + call stack)Classic Recursive Problems With SolutionsProblem 1: Reverse a StringString reverse(String s) { if (s.length() <= 1) return s; // base case // last char + reverse of everything before last char return s.charAt(s.length() - 1) + reverse(s.substring(0, s.length() - 1));}Dry run for "hello":reverse("hello") = 'o' + reverse("hell")reverse("hell") = 'l' + reverse("hel")reverse("hel") = 'l' + reverse("he")reverse("he") = 'e' + reverse("h")reverse("h") = "h"Unwinding: "h" → "he" → "leh" → "lleh" → "olleh" ✅Problem 2: Power Function (x^n)double power(double x, int n) { if (n == 0) return 1; // base case if (n < 0) return 1.0 / power(x, -n); // handle negative if (n % 2 == 0) { double half = power(x, n / 2); return half * half; // x^n = (x^(n/2))^2 } else { return x * power(x, n - 1); }}This is the fast power algorithm — O(log n) time instead of O(n).Problem 3: Fibonacci With Memoizationint[] memo = new int[100];Arrays.fill(memo, -1);int fib(int n) { if (n <= 1) return n; if (memo[n] != -1) return memo[n]; memo[n] = fib(n - 1) + fib(n - 2); return memo[n];}Time: O(n) — each value computed once Space: O(n) — memo array + call stackProblem 4: Tower of HanoiThe classic recursion teaching problem. Move n disks from source to destination using a helper rod.void hanoi(int n, char source, char destination, char helper) { if (n == 1) { System.out.println("Move disk 1 from " + source + " to " + destination); return; } // Move n-1 disks from source to helper hanoi(n - 1, source, helper, destination); // Move the largest disk from source to destination System.out.println("Move disk " + n + " from " + source + " to " + destination); // Move n-1 disks from helper to destination hanoi(n - 1, helper, destination, source);}Time Complexity: O(2ⁿ) — minimum moves required is 2ⁿ - 1 Space Complexity: O(n) — call stack depthProblem 5: Generate All Subsets (Power Set)void generateSubsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { result.add(new ArrayList<>(current)); // add current subset for (int i = index; i < nums.length; i++) { current.add(nums[i]); // include generateSubsets(nums, i + 1, current, result); // recurse current.remove(current.size() - 1); // exclude (backtrack) }}For [1, 2, 3] — generates all 8 subsets: [], [1], [1,2], [1,2,3], [1,3], [2], [2,3], [3]Time: O(2ⁿ) — 2ⁿ subsets Space: O(n) — recursion depthProblem 6: Binary Search Recursivelyint binarySearch(int[] arr, int target, int left, int right) { if (left > right) return -1; // base case — not found int mid = left + (right - left) / 2; if (arr[mid] == target) return mid; else if (arr[mid] < target) return binarySearch(arr, target, mid + 1, right); else return binarySearch(arr, target, left, mid - 1);}Time: O(log n) — halving the search space each time Space: O(log n) — log n frames on the call stackRecursion on Trees — The Natural HabitatTrees are where recursion truly shines. Every tree problem becomes elegant with recursion because a tree is itself a recursive structure — each node's left and right children are trees themselves.// Maximum depth of binary treeint maxDepth(TreeNode root) { if (root == null) return 0; return 1 + Math.max(maxDepth(root.left), maxDepth(root.right));}// Check if tree is symmetricboolean isSymmetric(TreeNode left, TreeNode right) { if (left == null && right == null) return true; if (left == null || right == null) return false; return left.val == right.val && isSymmetric(left.left, right.right) && isSymmetric(left.right, right.left);}// Path sum — does any root-to-leaf path sum to target?boolean hasPathSum(TreeNode root, int target) { if (root == null) return false; if (root.left == null && root.right == null) return root.val == target; return hasPathSum(root.left, target - root.val) || hasPathSum(root.right, target - root.val);}Notice the pattern in all three — base case handles null, recursive case handles left and right subtrees, result combines both.How to Think About Any Recursive Problem — Step by StepThis is the framework you should apply to every new recursive problem you encounter:Step 1 — Identify the base case What is the smallest input where you know the answer directly without any recursion? For arrays it is usually empty array or single element. For trees it is null node. For numbers it is 0 or 1.Step 2 — Trust the recursive call Assume your function already works correctly for smaller inputs. Do not trace through the entire recursion mentally — just trust it. This is the Leap of Faith and it is what makes recursion feel natural.Step 3 — Express the current problem in terms of smaller problems How does the answer for size n relate to the answer for size n-1 (or n/2, or subtrees)? This relationship is your recursive case.Step 4 — Make sure each call moves toward the base case The input must become strictly smaller with each call. If it does not, you have infinite recursion.Step 5 — Write the base case first, then the recursive case Always. Writing the recursive case first leads to bugs because you have not defined when to stop.Common Mistakes and How to Avoid ThemMistake 1: Missing or wrong base case The most common mistake. Missing the base case causes StackOverflowError. Wrong base case causes wrong answers.Always ask — what is the simplest possible input, and what should the function return for it? Write that case first.Mistake 2: Not moving toward the base case If you call factorial(n) inside factorial(n) without reducing n, you loop forever. Every recursive call must make the problem strictly smaller.Mistake 3: Trusting your brain to trace deep recursion Do not try to trace 10 levels of recursion in your head. Trust the recursive call, verify the base case, and check that each call reduces the problem. That is all you need.Mistake 4: Forgetting to return the recursive result// WRONG — result is computed but not returnedint sum(int n) { if (n == 0) return 0; sum(n - 1) + n; // computed but discarded!}// CORRECTint sum(int n) { if (n == 0) return 0; return sum(n - 1) + n;}Mistake 5: Modifying shared state without backtracking In backtracking problems, if you add something to a list before a recursive call, you must remove it after the call returns. Forgetting to backtrack leads to incorrect results and is one of the trickiest bugs to find.Mistake 6: Recomputing the same subproblems Naive Fibonacci computes fib(3) multiple times when computing fib(5). Use memoization whenever you notice overlapping subproblems in your recursion tree.Top LeetCode Problems on RecursionThese are organized by pattern — work through them in this order for maximum learning:Pure Recursion Basics:509. Fibonacci Number — Easy — start here, implement with and without memoization344. Reverse String — Easy — recursion on arrays206. Reverse Linked List — Easy — recursion on linked list50. Pow(x, n) — Medium — fast power with recursionTree Recursion (Most Important):104. Maximum Depth of Binary Tree — Easy — simplest tree recursion112. Path Sum — Easy — decision recursion on tree101. Symmetric Tree — Easy — mutual recursion on tree110. Balanced Binary Tree — Easy — bottom-up recursion236. Lowest Common Ancestor of a Binary Tree — Medium — classic tree recursion124. Binary Tree Maximum Path Sum — Hard — advanced tree recursionDivide and Conquer:148. Sort List — Medium — merge sort on linked list240. Search a 2D Matrix II — Medium — divide and conquerBacktracking:78. Subsets — Medium — generate all subsets46. Permutations — Medium — generate all permutations77. Combinations — Medium — generate combinations79. Word Search — Medium — backtracking on grid51. N-Queens — Hard — classic backtrackingMemoization / Dynamic Programming:70. Climbing Stairs — Easy — Fibonacci variant with memoization322. Coin Change — Medium — recursion with memoization to DP139. Word Break — Medium — memoized recursionRecursion Cheat Sheet// Linear recursion templatereturnType solve(input) { if (baseCase) return directAnswer; // process current return solve(smallerInput);}// Tree recursion templatereturnType solve(TreeNode root) { if (root == null) return baseValue; returnType left = solve(root.left); returnType right = solve(root.right); return combine(left, right, root.val);}// Backtracking templatevoid backtrack(choices, current, result) { if (goalReached) { result.add(copy of current); return; } for (choice : choices) { make(choice); // add to current backtrack(...); // recurse undo(choice); // remove from current }}// Memoization templateMap<Input, Output> memo = new HashMap<>();returnType solve(input) { if (baseCase) return directAnswer; if (memo.containsKey(input)) return memo.get(input); returnType result = solve(smallerInput); memo.put(input, result); return result;}FAQs — People Also AskQ1. What is recursion in Java with a simple example? Recursion is when a function calls itself to solve a smaller version of the same problem. A simple example is factorial — factorial(5) = 5 × factorial(4) = 5 × 4 × factorial(3) and so on until factorial(1) returns 1 directly.Q2. What is the difference between recursion and iteration? Iteration uses loops (for, while) and runs in O(1) space. Recursion uses function calls and uses O(n) stack space for n levels deep. Recursion is often cleaner for tree and graph problems. Iteration is better when memory is a concern or the problem is inherently linear.Q3. What causes StackOverflowError in Java recursion? StackOverflowError happens when recursion goes too deep — too many frames accumulate on the call stack before any of them return. This is caused by missing base case, wrong base case, or input too large for Java's default stack size limit.Q4. What is the difference between recursion and dynamic programming? Recursion solves a problem by breaking it into subproblems. Dynamic programming is recursion plus memoization — storing results of subproblems so they are never computed twice. DP converts exponential recursive solutions into polynomial ones by eliminating redundant computation.Q5. What is tail recursion and does Java support tail call optimization? Tail recursion is when the recursive call is the absolute last operation in the function. Java does NOT support tail call optimization — Java always creates a new stack frame for each call even if it is tail recursive. Languages like Scala and Kotlin (on the JVM) do support it with the tailrec keyword.Q6. How do you convert recursion to iteration? Every recursive solution can be converted to iterative using an explicit stack data structure. The call stack's behavior is replicated manually — push the initial call, loop while stack is not empty, pop, process, and push sub-calls. Tree traversals are a common example of this conversion.ConclusionRecursion is not magic. It is a systematic way of solving problems by expressing them in terms of smaller versions of themselves. Once you internalize the two parts (base case and recursive case), understand the call stack mentally, and learn to trust the recursive call rather than trace it completely, everything clicks.The learning path from here is clear — start with simple problems like Fibonacci and array sum. Move to tree problems where recursion is most natural. Then tackle backtracking. Finally add memoization to bridge into dynamic programming.Every hour you spend understanding recursion deeply pays dividends across the entire rest of your DSA journey. Trees, graphs, divide and conquer, backtracking, dynamic programming — all of them build on this foundation.

RecursionJavaBase CaseCall StackBacktrackingDynamic Programming
Longest Palindrome – Building the Maximum Length from Given Letters (LeetCode 409)

Longest Palindrome – Building the Maximum Length from Given Letters (LeetCode 409)

🔗 Problem LinkLeetCode 409 – Longest Palindrome 👉 https://leetcode.com/problems/longest-palindrome/IntroductionThis is one of those problems where you don’t actually need to build the palindrome.You just need to calculate the maximum possible length of a palindrome that can be formed using the given characters.The key idea here is understanding:How palindromes are structured.Once you understand that, the solution becomes straightforward and elegant.📌 Problem UnderstandingYou are given a string s containing:Lowercase lettersUppercase lettersCase-sensitive (meaning 'A' and 'a' are different)You must return:The length of the longest palindrome that can be built using those characters.You can rearrange characters in any order.Example 1Input: s = "abccccdd"Output: 7One possible palindrome:dccaccdLength = 7Example 2Input: s = "a"Output: 1🧠 Key Observation About PalindromesA palindrome:Reads the same forward and backward.Has mirror symmetry.This means:Characters must appear in pairs.At most one character can appear an odd number of times (middle character).🧠 Intuition Behind the ApproachLet’s think step by step:Count frequency of each character.For every character:If frequency is even → use all of them.If frequency is odd → use (frequency - 1).If at least one odd frequency exists → we can place one odd character in the center.That’s it.This is a greedy approach.💻 Your Codeclass Solution { public int longestPalindrome(String s) { if(s.length() == 1) return 1; HashMap<Character,Integer> mp = new HashMap<>(); for(int i =0; i < s.length();i++){ mp.put(s.charAt(i),mp.getOrDefault(s.charAt(i),0)+1); } int len =0; boolean odd = false; for(int a : mp.values()){ if(a%2 == 0){ len+=a; }else{ len+=a-1; odd= true; } } if(odd){ return len+1; } return len; }}🔍 Step-by-Step Explanation1️⃣ Edge Caseif(s.length() == 1) return 1;If there is only one character, the answer is 1.2️⃣ Frequency CountingHashMap<Character,Integer> mp = new HashMap<>();for(int i =0; i < s.length();i++){ mp.put(s.charAt(i),mp.getOrDefault(s.charAt(i),0)+1);}We count how many times each character appears.3️⃣ Build the Palindrome Lengthint len = 0;boolean odd = false;len → stores palindrome lengthodd → tracks whether any odd frequency exists4️⃣ Process Each Frequencyfor(int a : mp.values()){ if(a % 2 == 0){ len += a; }else{ len += a - 1; odd = true; }}If frequency is even → use all characters.If odd:Use a - 1 (which is even)Keep track that we saw an odd number5️⃣ Add Middle Character If Neededif(odd){ return len + 1;}If at least one odd frequency exists → we can place one character in the center.Otherwise → return len.🎯 Why This WorksIn a palindrome:All characters must appear in pairs (mirrored sides).Only one character can be unpaired (center).So we:Use all even counts.Use even portion of odd counts.Add one center character if possible.⏱ Complexity AnalysisTime Complexity: O(n)One pass to count frequenciesOne pass over map (max 52 characters: A–Z, a–z)Space Complexity: O(52) ≈ O(1)At most 52 distinct characters.🔥 Cleaner Optimization IdeaWe don’t even need a boolean variable.We can simply:Add a / 2 * 2 for every frequencyIf total length < original string length → add 1Example optimized version:class Solution { public int longestPalindrome(String s) { HashMap<Character,Integer> mp = new HashMap<>(); for(char ch : s.toCharArray()){ mp.put(ch, mp.getOrDefault(ch, 0) + 1); } int len = 0; for(int count : mp.values()){ len += (count / 2) * 2; } if(len < s.length()){ len += 1; } return len; }}🏁 Final ThoughtsThis problem teaches:Understanding palindrome structureFrequency countingGreedy logicHandling odd and even countsIt’s a simple but powerful pattern question.If you truly understand this, you can easily solve problems like:Palindrome PermutationLongest Palindrome by Concatenating Two Letter WordsCount Palindromic Subsequences

HashMapStringGreedyFrequency CountLeetCodeEasy
LeetCode 3751: Total Waviness of Numbers in Range I – Java Solution with Dry Run and Explanation

LeetCode 3751: Total Waviness of Numbers in Range I – Java Solution with Dry Run and Explanation

IntroductionLeetCode 3751 introduces an interesting digit-based pattern problem where we calculate the total waviness of numbers inside a given range.This problem combines:Digit traversalPattern recognitionPeaks and valleys logicString manipulationBrute force iterationThe problem is straightforward once we clearly understand how peaks and valleys work.Problem StatementYou are given two integers:num1 and num2representing the inclusive range:[num1, num2]For every number:A digit is called a peak if it is strictly greater than both neighbors.A digit is called a valley if it is strictly smaller than both neighbors.The first and last digits can never be peaks or valleys.Return the total waviness across all numbers in the range.ExampleInputnum1 = 120num2 = 130Output3ExplanationNumbers contributing to waviness:120 → 2 is a peak → waviness = 1121 → 2 is a peak → waviness = 1130 → 3 is a peak → waviness = 1Total:1 + 1 + 1 = 3Understanding Peaks and ValleysPeak ConditionA digit is a peak if:digit > left neighborANDdigit > right neighborExample:484Here:8 > 48 > 4So 8 is a peak.Valley ConditionA digit is a valley if:digit < left neighborANDdigit < right neighborExample:202Here:0 < 20 < 2So 0 is a valley.Key ObservationWe only need to check:index 1 to length-2because:First digit has no left neighborLast digit has no right neighborIntuitionThe simplest way:Iterate through every number in the rangeConvert number into charactersCheck each middle digitCount peaks and valleysAdd to final answerSince constraints are small:num2 <= 10^5a brute force approach works efficiently.Java Solutionclass Solution { public int totalWaviness(int num1, int num2) { int ans = 0; if(num1 == num2) { int temp = num1; String c = Integer.toString(temp); char[] arr = c.toCharArray(); for(int i = 1; i < arr.length - 1; i++) { if((arr[i] < arr[i - 1] && arr[i] < arr[i + 1]) || (arr[i] > arr[i - 1] && arr[i] > arr[i + 1])) { ans++; } } return ans; } for(int i = num1; i <= num2; i++) { String c = Integer.toString(i); char[] carr = c.toCharArray(); for(int j = 1; j < carr.length - 1; j++) { if((carr[j] < carr[j - 1] && carr[j] < carr[j + 1]) || (carr[j] > carr[j - 1] && carr[j] > carr[j + 1])) { ans++; } } } return ans; }}Step-by-Step ExplanationStep 1: Iterate Through Rangefor(int i = num1; i <= num2; i++)Process every number.Step 2: Convert Number to Character ArrayString c = Integer.toString(i);char[] carr = c.toCharArray();This makes digit comparison easier.Step 3: Check Middle Digitsfor(int j = 1; j < carr.length - 1; j++)Skip first and last digits.Step 4: Check Peak or Valley(carr[j] < carr[j-1] && carr[j] < carr[j+1])OR(carr[j] > carr[j-1] && carr[j] > carr[j+1])If true:ans++;Dry RunInputnum1 = 198num2 = 202Number 198Digits:1 9 8Check 9:9 > 19 > 8Peak found.Waviness:1Number 1991 9 99 is not strictly greater than right neighbor.No waviness.Number 2012 0 10 is smaller than both neighbors.Valley found.Number 2022 0 2Again:0 < 20 < 2Valley found.Final Answer198 → 1201 → 1202 → 1Total = 3Time Complexity AnalysisLet:N = num2 - num1 + 1D = number of digitsTime ComplexityO(N × D)At most:D = 6which is very small.Efficient for constraints.Space ComplexityO(D)due to character array conversion.Why Brute Force Works HereConstraints are small:num2 <= 100000So checking every number directly is acceptable.For larger constraints:Digit DP would be needed.But here:Simplicity is better.Common Mistakes1. Including First or Last DigitThese digits cannot be peaks or valleys.2. Using Non-Strict ComparisonWrong:>=<=Correct:><because definition says:strictly greaterstrictly smaller3. Forgetting Both ConditionsNeed to check:PeakValleyEdge CasesSingle Digit NumbersWaviness:0because fewer than 3 digits.Repeated DigitsExample:111No peak or valley.Alternating DigitsExample:4848Produces multiple waviness counts.Interview ExplanationIn interviews explain:Since the constraints are small, we can directly iterate through every number, convert it into digits, and count peaks and valleys by checking neighboring digits.This demonstrates:Observation skillsConstraint analysisClean implementationConclusionLeetCode 3751 is a clean implementation problem focused on:Digit traversalPattern recognitionPeaks and valleysBrute force optimizationThe key insight is:A digit contributes to waviness only if it is strictly greater or strictly smaller than both immediate neighbors.Once this condition is understood, the implementation becomes very straightforward.

LeetCodeJavaStringPeaks and ValleysBrute Force SolutionDigit ProblemsMediumArray
🚀 My First Spring Boot Backend

🚀 My First Spring Boot Backend

Why Spring Boot? 🔥✅ MongoRepository = FREE CRUD (no Mongoose models!)✅ Docker 1-file deploy (Render/Vercel style)✅ TypeScript-level safety (Java types)✅ Enterprise-grade (Netflix/Amazon use)✅ 120MB Docker image (super fast deploy)My Stack: Spring Boot + MongoDB Atlas + Render DockerProject Setup ⚙️pom.xml:<dependencies><groupId>org.springframework.boot</groupId><artifactId>spring-boot-starter-web</artifactId><groupId>org.springframework.boot</groupId><artifactId>spring-boot-starter-data-mongodb</artifactId><groupId>org.springframework.boot</groupId><artifactId>spring-boot-devtools</artifactId></dependencies>Core Files 💻Todo.java:@Document(collection = "todo")@Datapublic class Todo {@Id @JsonProperty("_id") private String id;private String title;private Boolean status;}TodoRepository.java (EMPTY!):public interface TodoRepository extends MongoRepository<Todo, String> {// FREE: findAll(), save(), findById(), deleteById()}TodoController.java:@RestController @RequestMapping("/api") @CrossOrigin("*")public class TodoController {@Autowired private TodoRepository todoRepository;@GetMapping("/todos")public ResponseEntity<Map<String, Object>> getAll() {List<Todo> todos = todoRepository.findAll();return ResponseEntity.ok(Map.of("success", true,"message", "Todos fetched!","data", todos,"count", todos.size()));}}Docker Magic 🐳# STAGE 1: BUILD (Temporary - Heavy)FROM maven:3.9.6-eclipse-temurin-17-alpine AS buildWORKDIR /appCOPY . . # Copy ALL filesRUN mvn clean package -DskipTests # Build JAR# STAGE 2: RUNTIME (Lightweight - Production)FROM eclipse-temurin:17-jdk-alpineWORKDIR /appCOPY --from=build /app/target/*.jar app.jar # JAR ONLY!EXPOSE $PORTENTRYPOINT ["java", "-jar", "app.jar"]Render Deployment (EXACT Steps) 🌐Step 1: Create DockerfileProject root (same level as pom.xml):└── Dockerfile ← EXACT name, NO extension!Step 2: GitHub Pushgit add Dockerfilegit commit -m "Add multi-stage Docker"git push origin mainStep 3: Render.com (5 Clicks)1. render.com → Sign up (GitHub)2. "New +" → "Web Service"3. Connect GitHub repo → Select branch "main"4. ⚙️ Settings:├── Name: firstcrud-spring├── Runtime: **Docker** ✅├── Build Command: (EMPTY)├── Start Command: (EMPTY)5. Environment → Add Variable:├── Key: SPRING_DATA_MONGODB_URI├── Value: mongodb+srv://user:pass@cluster0...6. "Create Web Service" → Deploy!Step 4: Watch Magic (3-5 mins)Render Logs:✅ Cloning GitHub repo✅ Building Docker image✅ Maven: BUILD SUCCESS✅ JAR created: 25MB✅ Deploying → LIVE!Step 5: Test Live APIGET: https://firstcrud-spring.onrender.com/api/todosPOST: https://firstcrud-spring.onrender.com/api/todosAuto-deploy: git push → Render LIVE in 2 mins! 🚀Configuration (Secure!) 🔒application.yml (GitHub - Safe):spring:data:mongodb:uri: ${SPRING_DATA_MONGODB_URI:mongodb://localhost:27017/todos}server:port: ${PORT:8080}Local: mvn spring-boot:run -Dspring.profiles.active=localSecurity Checklist ✅1. Atlas: New user (delete leaked db_user)2. Network Access: 0.0.0.0/03. GitHub: NO secrets (use ${ENV_VAR})4. Render: Environment Variables5. CORS: @CrossOrigin("*")Live Demo 🌟API: https://firstcrud-spring.onrender.com/api/todosPOST Body: {"title": "Buy Milk", "status": false}Response:{"success": true,"message": "Created!","data": {"_id": "abc123", "title": "Buy Milk"}}Frontend (Vite):VITE_API_URL=https://firstcrud-spring.onrender.com/apifetch(`${import.meta.env.VITE_API_URL}/todos`)Stack Cost: $0 💰✅ MongoDB Atlas: 512MB free✅ Render: 750 hours free✅ GitHub: Free✅ Docker Hub: FreeYou can see the live demo project here -: https://springboottodo.vercel.app/Github Link -: Link(Note : Render free tier is slow due to cold start of server so if the application is not active then it takes more time to respond in that case wait for 2 to 3 minutes.)

SpringBoot
LeetCode 735: Asteroid Collision — Java Solution Explained

LeetCode 735: Asteroid Collision — Java Solution Explained

IntroductionIf you have been building your stack skills through problems like Valid Parentheses, Next Greater Element, and Backspace String Compare, then LeetCode 735 Asteroid Collision is the problem where everything comes together. It is one of the most satisfying Medium problems on LeetCode because it feels like a real simulation — you are literally modelling asteroids flying through space and crashing into each other.You can find the problem here — LeetCode 735 Asteroid Collision.This article breaks everything down in plain English so that anyone — beginner or experienced — can understand exactly what is happening and why the stack is the perfect tool for this problem.What Is the Problem Really Asking?You have a row of asteroids moving through space. Each asteroid has a size and a direction:Positive number → asteroid moving to the rightNegative number → asteroid moving to the leftAll asteroids move at the same speed. When a right-moving asteroid and a left-moving asteroid meet head-on, they collide:The smaller one explodesIf they are the same size, both explodeThe bigger one survives and keeps movingTwo asteroids moving in the same direction never meet, so they never collide.Return the final state of all surviving asteroids after every possible collision has happened.Real Life Analogy — Cars on a HighwayImagine a highway with cars driving in both directions. Cars going right are in one lane, cars going left are in another lane. Now imagine the lanes overlap at some point.A small car going right crashes into a big truck going left — the car gets destroyed, the truck keeps going. Two equally sized cars crash — both are destroyed. A massive truck going right demolishes everything coming from the left until it meets something bigger or nothing at all.That is exactly the asteroid problem. The stack helps us track which asteroids are still "alive" and moving right, waiting to potentially collide with the next left-moving asteroid that comes along.Why Stack Is the Perfect Data Structure HereThe key observation is this — only a right-moving asteroid followed by a left-moving asteroid can collide. A left-moving asteroid might destroy several right-moving ones in a chain before it either survives or gets destroyed itself.This chain reaction behavior — where the outcome of one collision immediately triggers the possibility of another — is exactly what a stack handles naturally. The stack holds right-moving asteroids that are still alive and waiting. When a left-moving asteroid arrives, it battles the top of the stack repeatedly until either it is destroyed or no more collisions are possible.All Possible Collision ScenariosBefore looking at code it is important to understand every case that can happen:Case 1 — Right-moving asteroid (ast[i] > 0) No collision possible immediately. Push it onto the stack and move on.Case 2 — Left-moving asteroid, stack is empty Nothing to collide with. Push it onto the stack.Case 3 — Left-moving asteroid, top of stack is also left-moving (negative) Two asteroids going the same direction never meet. Push it onto the stack.Case 4 — Left-moving asteroid meets right-moving asteroid (collision!) Three sub-cases:Stack top is bigger → left-moving asteroid explodes, stack top survivesStack top is smaller → stack top explodes, left-moving asteroid continues (loop again)Same size → both explodeThe Solution — Stack Simulationpublic int[] asteroidCollision(int[] ast) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < ast.length; i++) { boolean survived = true; // assume current asteroid survives // collision only happens when stack top is positive // and current asteroid is negative while (!st.empty() && st.peek() > 0 && ast[i] < 0) { if (st.peek() > Math.abs(ast[i])) { // stack top is bigger — current asteroid explodes survived = false; break; } else if (st.peek() < Math.abs(ast[i])) { // current asteroid is bigger — stack top explodes // current asteroid keeps going, check next stack element st.pop(); } else { // equal size — both explode st.pop(); survived = false; break; } } if (survived) { st.push(ast[i]); } } // build result array from stack (stack gives reverse order) int[] ans = new int[st.size()]; for (int i = ans.length - 1; i >= 0; i--) { ans[i] = st.pop(); } return ans;}Step-by-Step Dry Run — asteroids = [10, 2, -5]Let us trace exactly what happens:Processing 10:Stack is empty, no collision possiblesurvived = true → push 10Stack: [10]Processing 2:Stack top is 10 (positive), current is 2 (positive) — same direction, no collisionsurvived = true → push 2Stack: [10, 2]Processing -5:Stack top is 2 (positive), current is -5 (negative) — collision!2 < 5 → stack top smaller, pop 2. survived stays trueStack: [10]Stack top is 10 (positive), current is -5 (negative) — collision again!10 > 5 → stack top bigger, current asteroid destroyed. survived = false, breakStack: [10]survived = false → do not push -5Final stack: [10] → output: [10] ✅Step-by-Step Dry Run — asteroids = [3, 5, -6, 2, -1, 4]Processing 3: stack empty → push. Stack: [3]Processing 5: both positive, same direction → push. Stack: [3, 5]Processing -6:Collision with 5: 5 < 6 → pop 5. Stack: [3]Collision with 3: 3 < 6 → pop 3. Stack: []Stack empty → survived = true → push -6Stack: [-6]Processing 2: stack top is -6 (negative), current is 2 (positive) — same direction check fails, no collision → push. Stack: [-6, 2]Processing -1:Collision with 2: 2 > 1 → stack top bigger, -1 explodes. survived = falseStack: [-6, 2]Processing 4: stack top is 2 (positive), current is 4 (positive) — same direction → push. Stack: [-6, 2, 4]Final stack: [-6, 2, 4] → output: [-6, 2, 4] ✅Understanding the survived FlagThe survived boolean flag is the most important design decision in this solution. It tracks whether the current asteroid makes it through all collisions.It starts as true — we assume the asteroid survives until proven otherwise. It only becomes false in two situations — when the stack top is bigger (current asteroid destroyed) or when both are equal size (mutual destruction). If survived is still true after the while loop, the asteroid either won all its battles or never had any — either way it gets pushed onto the stack.This flag eliminates the need for complicated nested conditions and makes the logic clean and readable.Building the Result ArrayOne important detail — when you pop everything from a stack to build an array, the order is reversed. The stack gives you elements from top to bottom (last to first). So we fill the result array from the end to the beginning using i = ans.length - 1 going down to 0. This preserves the original left-to-right order of surviving asteroids.Time and Space ComplexityTime Complexity: O(n) — each asteroid is pushed onto the stack at most once and popped at most once. Even though there is a while loop inside the for loop, each element participates in at most one push and one pop across the entire run. Total operations stay linear.Space Complexity: O(n) — in the worst case (all asteroids moving right, no collisions) all n asteroids sit on the stack simultaneously.Common Mistakes to AvoidForgetting that same-direction asteroids never collide The collision condition is specifically st.peek() > 0 && ast[i] < 0. Two positive asteroids, two negative asteroids, or a negative followed by a positive — none of these collide. Only right then left.Not using a loop for chain collisions A single left-moving asteroid can destroy multiple right-moving ones in sequence. If you only check the stack top once instead of looping, you will miss chain destructions like in the [3, 5, -6] example.Forgetting the survived flag and always pushing Without the flag, a destroyed asteroid still gets pushed onto the stack, giving wrong results.Wrong array reconstruction from stack Forgetting that stack order is reversed and filling the array from left to right gives a backwards answer. Always fill from the last index downward.How This Problem Differs From Previous Stack ProblemsEvery previous stack problem in this series had a simple push-or-pop decision per character. Asteroid Collision introduces something new — a while loop inside the for loop. This is because one incoming asteroid can trigger multiple consecutive pops (chain collisions). The stack is no longer just storing history — it is actively participating in a simulation where multiple stored elements can be affected by a single incoming element.This is the defining characteristic of harder stack problems and is exactly what appears in problems like Largest Rectangle in Histogram and Trapping Rain Water.FAQs — People Also AskQ1. Why is a Stack used to solve LeetCode 735 Asteroid Collision? Because right-moving asteroids wait on the stack until a left-moving asteroid arrives. The left-moving asteroid battles the top of the stack repeatedly — this LIFO chain reaction behavior is exactly what a stack handles naturally and efficiently.Q2. What is the time complexity of LeetCode 735? O(n) time because each asteroid is pushed and popped at most once regardless of how many chain collisions happen. Space complexity is O(n) for the stack in the worst case.Q3. When do two asteroids NOT collide in LeetCode 735? Two asteroids never collide when both move right (both positive), both move left (both negative), or when a left-moving asteroid comes before a right-moving one — they move away from each other in that case.Q4. Is LeetCode 735 asked in coding interviews? Yes, it is commonly asked at companies like Amazon, Google, and Microsoft as a Medium stack problem. It tests whether you can handle simulation problems with multiple conditional branches and chain reactions — skills that translate directly to real world system design thinking.Q5. What is the difference between LeetCode 735 and LeetCode 496 Next Greater Element? Both use a stack and involve comparing elements. In Next Greater Element, you search forward for something bigger. In Asteroid Collision, collisions happen between the current element and stack contents, and the current element might destroy multiple previous elements in a chain before settling. The collision logic in 735 is more complex.Similar LeetCode Problems to Practice Next496. Next Greater Element I — Easy — monotonic stack pattern739. Daily Temperatures — Medium — next greater with index distance1047. Remove All Adjacent Duplicates In String — Easy — chain removal with stack84. Largest Rectangle in Histogram — Hard — advanced stack simulation503. Next Greater Element II — Medium — circular array with monotonic stackConclusionLeetCode 735 Asteroid Collision is a wonderful problem that takes the stack simulation pattern to the next level. The key insight is recognizing that only right-then-left asteroid pairs can collide, that chain collisions require a while loop not just an if statement, and that the survived flag keeps the logic clean across all cases.Work through every dry run in this article carefully — especially the [3, 5, -6, 2, -1, 4] example — because seeing chain collisions play out step by step is what makes this pattern click permanently.Once this problem makes sense, you are genuinely ready for the harder stack problems that follow. Keep going!

LeetCodeJavaStackArrayMedium
Count Subarrays of Size K with Average ≥ Threshold — Sliding Window Solution (LeetCode 1343)

Count Subarrays of Size K with Average ≥ Threshold — Sliding Window Solution (LeetCode 1343)

IntroductionLeetCode 1343: Number of Sub-arrays of Size K and Average Greater than or Equal to Threshold is another excellent problem to practice the sliding window technique.The goal is not just to compute values but to count how many subarrays satisfy a given condition efficiently.You are given:An integer array arrAn integer k representing subarray sizeA threshold valueYou must return the number of subarrays of size k whose average is greater than or equal to the threshold.If you'd like to try solving the problem first, you can attempt it here:👉 Try the problem on LeetCode:https://leetcode.com/problems/number-of-sub-arrays-of-size-k-and-average-greater-than-or-equal-to-threshold/Problem UnderstandingA direct approach would calculate the average for every subarray of size k. However, recomputing sums repeatedly leads to unnecessary work.To optimize, we use a sliding window, allowing us to reuse previous computations and move efficiently across the array.Key Idea: Sliding Window OptimizationInstead of calculating sums repeatedly:Maintain the sum of the current window.Slide the window by:Adding the next elementRemoving the element leaving the windowCheck if the average satisfies the threshold.Count valid windows.This ensures each element is processed only once.ApproachMaintain two pointers to represent the window.Add elements until window size reaches k.Check if average meets the threshold.Move the window forward.Count valid subarrays.An important optimization: instead of computing average each time, we can compare the sum with threshold * k. However, your current implementation using division also works correctly.Implementation (Java)class Solution { public int numOfSubarrays(int[] arr, int k, int t) { int curr = 0; int i = 0; int j = 0; int co = 0; while (j < arr.length) { curr += arr[j]; if (j - i + 1 < k) { j++; } else { if (j - i + 1 == k) { if (curr / k >= t) { co++; } curr -= arr[i]; i++; j++; } } } return co; }}Dry Run ExampleInput:arr = [2,2,2,2,5,5,5,8], k = 3, threshold = 4Valid subarrays:[2,5,5] → avg = 4[5,5,5] → avg = 5[5,5,8] → avg = 6Total valid subarrays = 3Complexity AnalysisTime Complexity: O(n)Each element enters and leaves the window once.Space Complexity: O(1)Only constant extra variables are used.Edge Cases ConsideredThreshold equals zeroMinimum array lengthLarge array sizesNon-integer averagesAll elements smaller than thresholdSliding Window Pattern ImportanceThis problem reinforces the sliding window pattern, which appears frequently in:Fixed-size window problemsMaximum or minimum subarray problemsCounting valid segmentsString window problemsMastering this pattern helps solve many interview questions efficiently.ConclusionThis problem is a strong example of turning a potentially expensive brute-force approach into an efficient linear solution using sliding window.Once you recognize this pattern, many array and string problems become significantly easier to solve.

LeetCodeSliding WindowMedium
LeetCode 496: Next Greater Element I — Java Solution With All Approaches Explained

LeetCode 496: Next Greater Element I — Java Solution With All Approaches Explained

IntroductionLeetCode 496 Next Greater Element I is your gateway into one of the most important and frequently tested patterns in coding interviews — the Monotonic Stack. Once you understand this problem deeply, problems like Next Greater Element II, Daily Temperatures, and Largest Rectangle in Histogram all start to make sense.Here is the Link of Question -: LeetCode 496This article covers plain English explanation, real life analogy, brute force and optimal approaches in Java, detailed dry runs, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You have two arrays. nums2 is the main array. nums1 is a smaller subset of nums2. For every element in nums1, find its position in nums2 and look to the right — what is the first element that is strictly greater? If none exists, return -1.Example:nums1 = [4,1,2], nums2 = [1,3,4,2]For 4 in nums2: elements to its right are [2], none greater → -1For 1 in nums2: elements to its right are [3,4,2], first greater is 3For 2 in nums2: no elements to its right → -1Output: [-1, 3, -1]Real Life Analogy — The Taller Person in a QueueImagine you are standing in a queue and you want to know — who is the first person taller than you standing somewhere behind you in the line?You look to your right one by one until you find someone taller. That person is your "next greater element." If everyone behind you is shorter, your answer is -1.Now imagine doing this for every person in the queue efficiently — instead of each person looking one by one, you use a smart system that processes everyone in a single pass. That smart system is the Monotonic Stack.Approach 1: Brute Force (Beginner Friendly)The IdeaFor each element in nums1, find its position in nums2, then scan everything to its right to find the first greater element.javapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { int found = -1; boolean seen = false; for (int j = 0; j < nums2.length; j++) { if (seen && nums2[j] > nums1[i]) { found = nums2[j]; break; } if (nums2[j] == nums1[i]) { seen = true; } } ans[i] = found; } return ans;}Simple to understand but inefficient. For each element in nums1 you scan the entire nums2.Time Complexity: O(m × n) — where m = nums1.length, n = nums2.length Space Complexity: O(1) — ignoring output arrayThis works for the given constraints (n ≤ 1000) but will not scale for larger inputs. The follow-up specifically asks for better.Approach 2: Monotonic Stack + HashMap (Optimal Solution) ✅The IdeaThis is your solution and the best one. The key insight is — instead of answering queries for nums1 elements one by one, precompute the next greater element for every element in nums2 and store results in a HashMap. Then answering nums1 queries becomes just a HashMap lookup.To precompute efficiently, we use a Monotonic Stack — a stack that always stays in decreasing order from bottom to top.Why traverse from right to left? Because we are looking for the next greater element to the right. Starting from the right end, by the time we process any element, we have already seen everything to its right.Algorithm:Traverse nums2 from right to leftMaintain a stack of "candidate" next greater elementsFor current element, pop all stack elements that are smaller or equal — they can never be the next greater for anything to the leftIf stack is empty → next greater is -1, else → top of stack is the answerPush current element onto stackStore result in HashMapLook up each nums1 element in the HashMapjavapublic int[] nextGreaterElement(int[] nums1, int[] nums2) { Stack<Integer> st = new Stack<>(); HashMap<Integer, Integer> mp = new HashMap<>(); // Precompute next greater for every element in nums2 for (int i = nums2.length - 1; i >= 0; i--) { // Pop elements smaller than current — they are useless while (!st.empty() && nums2[i] >= st.peek()) { st.pop(); } // Top of stack is the next greater, or -1 if empty mp.put(nums2[i], st.empty() ? -1 : st.peek()); // Push current element as a candidate for elements to its left st.push(nums2[i]); } // Answer queries for nums1 int[] ans = new int[nums1.length]; for (int i = 0; i < nums1.length; i++) { ans[i] = mp.get(nums1[i]); } return ans;}Why Is the Stack Monotonic?After popping smaller elements, the stack always maintains a decreasing order from bottom to top. This means the top of the stack at any point is always the smallest element seen so far to the right — making it the best candidate for "next greater."This is called a Monotonic Decreasing Stack and it is the heart of this entire pattern.Detailed Dry Run — nums2 = [1,3,4,2]We traverse from right to left:i = 3, nums2[3] = 2Stack is emptyNo elements to popStack empty → mp.put(2, -1)Push 2 → stack: [2]i = 2, nums2[2] = 4Stack top is 2, and 4 >= 2 → pop 2 → stack: []Stack empty → mp.put(4, -1)Push 4 → stack: [4]i = 1, nums2[1] = 3Stack top is 4, and 3 < 4 → stop poppingStack not empty → mp.put(3, 4)Push 3 → stack: [4, 3]i = 0, nums2[0] = 1Stack top is 3, and 1 < 3 → stop poppingStack not empty → mp.put(1, 3)Push 1 → stack: [4, 3, 1]HashMap after processing nums2:1 → 3, 2 → -1, 3 → 4, 4 → -1Now answer nums1 = [4, 1, 2]:nums1[0] = 4 → mp.get(4) = -1nums1[1] = 1 → mp.get(1) = 3nums1[2] = 2 → mp.get(2) = -1✅ Output: [-1, 3, -1]Time Complexity: O(n + m) — n for processing nums2, m for answering nums1 queries Space Complexity: O(n) — HashMap and Stack both store at most n elementsWhy Pop Elements Smaller Than Current?This is the most important thing to understand in this problem. When we are at element x and we see a stack element y where y < x, we pop y. Why?Because x is to the right of everything we will process next (we go right to left), and x is already greater than y. So for any element to the left of x, if they are greater than y, they are definitely also greater than y — meaning y would never be the "next greater" for anything. It becomes useless and gets discarded.This is why the stack stays decreasing — every element we keep is a legitimate candidate for being someone's next greater element.How This Differs From Previous Stack ProblemsYou have been solving stack problems with strings — backspace, stars, adjacent duplicates. This problem introduces the stack for arrays and searching, which is a step up in complexity.The pattern shift is: instead of using the stack to build or reduce a string, we use it to maintain a window of candidates while scanning. This monotonic stack idea is what powers many hard problems like Largest Rectangle in Histogram, Trapping Rain Water, and Daily Temperatures.Common Mistakes to AvoidUsing >= instead of > in the pop condition We pop when nums2[i] >= st.peek(). If you use only >, equal elements stay on the stack and give wrong answers since we need strictly greater.Traversing left to right instead of right to left Going left to right makes it hard to know what is to the right of the current element. Always go right to left for "next greater to the right" problems.Forgetting HashMap lookup handles the nums1 query efficiently Some people recompute inside the nums1 loop. Always precompute in a HashMap — that is the whole point of the optimization.FAQs — People Also AskQ1. What is a Monotonic Stack and why is it used in LeetCode 496? A Monotonic Stack is a stack that maintains its elements in either increasing or decreasing order. In LeetCode 496, a Monotonic Decreasing Stack is used to efficiently find the next greater element for every number in nums2 in a single pass, reducing time complexity from O(n²) to O(n).Q2. What is the time complexity of LeetCode 496 optimal solution? The optimal solution runs in O(n + m) time where n is the length of nums2 and m is the length of nums1. Processing nums2 takes O(n) and answering all nums1 queries via HashMap takes O(m).Q3. Why do we traverse nums2 from right to left? Because we are looking for the next greater element to the right. Starting from the right end means by the time we process any element, we have already seen all elements to its right and stored them in the stack as candidates.Q4. Is LeetCode 496 asked in coding interviews? Yes, it is commonly used as an introduction to the Monotonic Stack pattern at companies like Amazon, Google, and Microsoft. It often appears as a warmup before harder follow-ups like Next Greater Element II (circular array) or Daily Temperatures.Q5. What is the difference between LeetCode 496 and LeetCode 739 Daily Temperatures? Both use the same Monotonic Stack pattern. In 496 you return the actual next greater value. In 739 you return the number of days (index difference) until a warmer temperature. The core stack logic is identical.Similar LeetCode Problems to Practice Next739. Daily Temperatures — Medium — days until warmer temperature, same pattern503. Next Greater Element II — Medium — circular array version901. Online Stock Span — Medium — monotonic stack with span counting84. Largest Rectangle in Histogram — Hard — classic monotonic stack42. Trapping Rain Water — Hard — monotonic stack or two pointerConclusionLeetCode 496 Next Greater Element I is the perfect entry point into the Monotonic Stack pattern. The brute force is easy to understand, but the real learning happens when you see why the stack stays decreasing and how that single insight collapses an O(n²) problem into O(n).Once you truly understand why we pop smaller elements and how the HashMap bridges the gap between precomputation and query answering, the entire family of Next Greater Element problems becomes approachable — including the harder circular and histogram variants.

ArrayStackMonotonic StackHashMapEasyLeetCode
Longest Repeating Character Replacement – Sliding Window Explained (LeetCode 424)

Longest Repeating Character Replacement – Sliding Window Explained (LeetCode 424)

🔗 Problem LinkLeetCode 424 – Longest Repeating Character Replacement👉 https://leetcode.com/problems/longest-repeating-character-replacement/IntroductionWhen I first looked at this problem, it didn’t immediately feel like a typical sliding window question. It talks about replacing characters, not finding substrings directly.But the moment you carefully read:"Return the length of the longest substring containing the same letter after at most k replacements."That’s when the pattern becomes clear.This is a variable-size sliding window problem where we try to maintain a valid window under a certain condition.In this blog, I’ll explain:The intuition behind the problemWhy sliding window worksThe key tricky conditionStep-by-step explanation of the codeTime and space complexity📌 Problem UnderstandingWe are allowed to:Pick any character in the stringReplace it with any uppercase letterPerform at most k replacementsWe need to find the maximum length substring that can become all the same character after at most k changes.🧠 Key ObservationIn any window (substring):To make all characters the same, we need to:Keep the most frequent characterReplace all other charactersSo the number of replacements required is:Window Size - Maximum Frequency Character in that WindowIf that value is ≤ k, then the window is valid.This is the most important insight in the entire problem.🚀 Why Sliding Window?We are asked for:Longest substringUnder a constraintWith dynamic window expansionThat is a clear sign of the sliding window pattern.We use:i → left pointerj → right pointerHashMap → to track character frequencies💻 Your Codeclass Solution {public int characterReplacement(String s, int k) {HashMap<Character,Integer> mp = new HashMap<>();int i= 0;int j =0;int co =0;while(j < s.length()){mp.put(s.charAt(j),mp.getOrDefault(s.charAt(j),0)+1);int maxfreq = 0;for(int a : mp.values()){maxfreq = Math.max(maxfreq,a);}while((j - i +1)-maxfreq > k){ // Tricky partmp.put(s.charAt(i),mp.get(s.charAt(i))-1);if(mp.get(s.charAt(i)) == 0){mp.remove(s.charAt(i));}i++;}co = Math.max(co,j-i+1);j++;}return co;}}🔍 Step-by-Step Explanation1️⃣ Expanding the Windowmp.put(s.charAt(j), mp.getOrDefault(s.charAt(j), 0) + 1);We add the current character into the frequency map.2️⃣ Finding Maximum Frequencyint maxfreq = 0;for(int a : mp.values()){maxfreq = Math.max(maxfreq,a);}We calculate the highest frequency character inside the window.Why?Because that is the character we will keep.All others will be replaced.3️⃣ The Most Important Condition (Tricky Part)while((j - i +1)-maxfreq > k)Let’s break this:j - i + 1 → Window sizemaxfreq → Count of most frequent characterwindowSize - maxfreq → Replacements neededIf replacements needed > k → window is invalidSo we shrink from left.4️⃣ Shrinking the Windowmp.put(s.charAt(i), mp.get(s.charAt(i)) - 1);if(mp.get(s.charAt(i)) == 0){mp.remove(s.charAt(i));}i++;We remove left character and move i forward.5️⃣ Updating Maximum Lengthco = Math.max(co, j - i + 1);We update our answer whenever the window is valid.🎯 Why This WorksWe always maintain:(window size - most frequent character count) <= kThat guarantees:We can convert the entire window into one repeating character using at most k replacements.⏱ Time and Space ComplexityTime Complexity: O(26 * n) ≈ O(n)For each character, we scan at most 26 letters.Since there are only uppercase letters, this is effectively linear.Space Complexity: O(26)At most 26 uppercase characters stored.🔥 Important Optimization InsightYour solution recalculates maxfreq every time using a loop.A common optimization is:Maintain a global maxfreqUpdate only when expanding windowDo not recalculate during shrinkingThat reduces unnecessary scanning.But your solution is completely correct and efficient.🏁 Final ThoughtsThis problem teaches:Sliding Window with conditionFrequency trackingWindow validation logicThinking in terms of "how many changes needed"The key formula to remember:window size - max frequency <= kIf you truly understand this condition, you unlock many similar problems like:Longest Substring with K ReplacementsMax Consecutive Ones IIIFruit Into Baskets

Sliding WindowLeetCodeTwo PointersHashMapMedium
Max Consecutive Ones III – Sliding Window with Limited Flips

Max Consecutive Ones III – Sliding Window with Limited Flips

IntroductionLeetCode 1004: Max Consecutive Ones III is a classic sliding window problem that challenges your understanding of arrays, window manipulation, and frequency counting.The goal is to find the longest subarray of consecutive 1's in a binary array if you are allowed to flip at most K zeros to 1’s.This problem is an excellent example of transforming a brute-force solution into a linear-time efficient approach using the sliding window pattern.If you’d like to try solving the problem first, you can attempt it here: Try the problem on LeetCode: https://leetcode.com/problems/max-consecutive-ones-iii/Problem UnderstandingYou are given:A binary array nums containing only 0's and 1'sAn integer k representing the maximum number of zeros you can flipYou need to return the length of the longest contiguous subarray of 1's after flipping at most k zeros.Examples:Input: nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Output: 6Explanation: Flip two zeros to get [1,1,1,0,0,1,1,1,1,1,1].Longest consecutive ones = 6.Input: nums = [0,0,1,1,0,0,1,1,1,0,1,1,0,0,0,1,1,1,1], k = 3Output: 10Explanation: Flip three zeros to get longest consecutive ones of length 10.A naive approach would check every possible subarray, flip zeros, and count consecutive ones:Time Complexity: O(n²) → too slow for large arraysInefficient for constraints up to 10⁵ elementsKey Idea: Sliding Window with Zero CountInstead of brute-force, notice that:We only care about how many zeros are in the current windowWe can maintain a sliding window [i, j]Keep a counter z for zeros in the windowExpand the window by moving jIf z exceeds k, shrink the window from the left by moving i and decrementing z for each zero removedIntuition:The window always contains at most k zerosThe length of the window gives the maximum consecutive ones achievable with flipsThis allows linear traversal of the array with O(1) space, making it optimal.Approach (Step-by-Step)Initialize pointers: i = 0, j = 0Initialize z = 0 (zeros count in current window) and co = 0 (max length)Iterate j from 0 to nums.length - 1:If nums[j] == 0, increment zCheck z:If z <= k: window is valid → update co = max(co, j - i + 1)Else: shrink window by moving i until z <= k, decrement z for zeros leaving windowContinue expanding window with jReturn co as the maximum consecutive onesOptimization:Only need one variable for zeros countAvoids recomputing sums or scanning subarrays repeatedlyImplementation (Java)class Solution { public int longestOnes(int[] nums, int k) { int co = 0; // maximum length of valid window int i = 0, j = 0; // window pointers int z = 0; // count of zeros in current window while (j < nums.length) { if (nums[j] == 0) { z++; // increment zeros count } if (z <= k) { co = Math.max(co, j - i + 1); // valid window j++; } else { // shrink window until zeros <= k while (z > k) { if (nums[i] == 0) { z--; } i++; } co = Math.max(co, j - i + 1); j++; } } return co; }}Dry Run ExampleInput:nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Execution:Window [i, j]Zeros zValid?Max length co[0,0] → [1]0Yes1[0,2] → [1,1,1]0Yes3[0,3] → [1,1,1,0]1Yes4[0,4] → [1,1,1,0,0]2Yes5[0,5] → [1,1,1,0,0,0]3No → shrink i5[3,8] → [0,0,1,1,1,1]2Yes6Output:6Complexity AnalysisTime Complexity: O(n) → Each element is visited at most twice (once when j moves, once when i moves)Space Complexity: O(1) → Only counters and pointers usedEdge Cases Consideredk = 0 → cannot flip any zeros, just count consecutive onesArray with all 1’s → return full lengthArray with all 0’s → return min(k, length)Single element arrays → works correctlySliding Window Pattern ImportanceThis problem is a perfect example of the sliding window pattern:Use a window to track a condition (max zeros allowed)Expand and shrink dynamically based on constraintsEfficiently computes maximum/minimum contiguous subarray lengthsIt also demonstrates counting with limited violations – a key interview concept.ConclusionBy tracking zeros with a sliding window, we convert a naive O(n²) problem into O(n) linear time.Understanding this pattern allows you to solve:Max consecutive ones/zeros problemsLongest substring/subarray with constraintsSubarray problems with limited replacements or violationsOnce mastered, this approach applies to many binary array and string problems efficiently.

SlidingWindowBinaryArrayLeetCodeMedium
LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

IntroductionSome problems test complex algorithms, while others focus on fundamental concepts done right.LeetCode 3783 – Mirror Distance of an Integer falls into the second category.This problem is simple yet important because it builds understanding of:Digit manipulationReversing numbersMathematical operationsIn this article, we’ll break down the problem in a clean and intuitive way, along with an optimized Java solution.🔗 Problem LinkLeetCode: Mirror Distance of an IntegerProblem StatementYou are given an integer n.The mirror distance is defined as:| n - reverse(n) |Where:reverse(n) = number formed by reversing digits of n|x| = absolute value👉 Return the mirror distance.ExamplesExample 1Input:n = 25Output:27Explanation:reverse(25) = 52|25 - 52| = 27Example 2Input:n = 10Output:9Explanation:reverse(10) = 1|10 - 1| = 9Example 3Input:n = 7Output:0Key InsightThe problem consists of two simple steps:1. Reverse the number2. Take absolute differenceIntuitionLet’s take an example:n = 120Step 1: Reverse digits120 → 021 → 21👉 Leading zeros are ignored automatically.Step 2: Compute difference|120 - 21| = 99ApproachStep-by-StepExtract digits using % 10Build reversed numberUse Math.abs() for final resultJava Codeclass Solution { // Function to reverse a number public int reverse(int k) { int rev = 0; while (k != 0) { int dig = k % 10; // get last digit k = k / 10; // remove last digit rev = rev * 10 + dig; // build reversed number } return rev; } public int mirrorDistance(int n) { // Calculate mirror distance return Math.abs(n - reverse(n)); }}Dry RunInput:n = 25Execution:Reverse → 52Difference → |25 - 52| = 27Complexity AnalysisTime ComplexityReversing number → O(d)(d = number of digits)👉 Overall: O(log n)Space Complexity👉 O(1) (no extra space used)Why This WorksDigit extraction ensures correct reversalLeading zeros automatically removedAbsolute difference ensures positive resultEdge Cases to ConsiderSingle digit → result = 0Numbers ending with zero (e.g., 10 → 1)Large numbers (up to 10⁹)Key TakeawaysSimple math problems can test core logicDigit manipulation is a must-know skillAlways handle leading zeros carefullyUse built-in functions like Math.abs() effectivelyReal-World RelevanceConcepts used here are helpful in:Number transformationsPalindrome problemsReverse integer problemsMathematical algorithmsConclusionThe Mirror Distance of an Integer problem is a great example of combining basic operations to form a meaningful solution.While simple, it reinforces important programming fundamentals that are widely used in more complex problems.Frequently Asked Questions (FAQs)1. What happens to leading zeros in reverse?They are automatically removed when stored as an integer.2. Can this be solved using strings?Yes, but integer-based approach is more efficient.3. What is the best approach?Using arithmetic operations (% and /) is optimal.

EasyArrayReverse NumberLeetCodeJava
Fruit Into Baskets – Sliding Window with Two Types

Fruit Into Baskets – Sliding Window with Two Types

IntroductionLeetCode 904: Fruit Into Baskets is a classic sliding window problem that tests your ability to track a limited number of distinct elements in a subarray.The problem can be rephrased as:Find the longest subarray containing at most 2 distinct types of elements.This is a great example of using HashMap + sliding window to efficiently track counts of elements while expanding and shrinking the window.If you’d like to try solving the problem first, you can attempt it here:Try the problem on LeetCode:https://leetcode.com/problems/fruit-into-baskets/Problem UnderstandingYou are given:An array fruits where fruits[i] represents the type of fruit from tree iTwo baskets, each can hold only one type of fruitRules:Start at any tree and move only to the rightPick exactly one fruit from each tree while movingStop when a tree’s fruit cannot fit in your basketsGoal: Return the maximum number of fruits you can pick.Examples:Input: fruits = [1,2,1]Output: 3Explanation: Pick all fruits [1,2,1].Input: fruits = [0,1,2,2]Output: 3Explanation: Best subarray [1,2,2].Input: fruits = [1,2,3,2,2]Output: 4Explanation: Best subarray [2,3,2,2].A naive approach would check all subarrays, count distinct fruits, and pick the max →Time Complexity: O(n²) → too slow for fruits.length up to 10⁵Key Idea: Sliding Window with At Most Two TypesInstead of brute-force:Track the number of each fruit type in the current window using a HashMapUse two pointers i and j for the windowExpand j by adding fruits[j] to the mapIf the number of distinct types mp.size() exceeds 2:Shrink the window from the left (i) until mp.size() <= 2The window length j - i + 1 gives the max fruits collected so farIntuition:Only two baskets → window can contain at most 2 distinct fruitsThe sliding window efficiently finds the longest subarray with ≤ 2 distinct elementsApproach (Step-by-Step)Initialize i = 0, j = 0 for window pointersInitialize HashMap mp to store fruit countsInitialize co = 0 → maximum fruits collectedIterate j over fruits:Add fruits[j] to the mapCheck mp.size():If ≤ 2 → update co = max(co, j - i + 1)If > 2 → shrink window from i until mp.size() <= 2Continue expanding the windowReturn co as the maximum fruits collectedOptimization:HashMap keeps track of counts → no need to scan subarray repeatedlySliding window ensures linear traversalImplementation (Java)class Solution {public int totalFruit(int[] nums) {HashMap<Integer,Integer> mp = new HashMap<>();int i = 0, j = 0; // window pointersint co = 0; // max fruits collectedwhile (j < nums.length) {// Add current fruit to mapmp.put(nums[j], mp.getOrDefault(nums[j], 0) + 1);if (mp.size() <= 2) {co = Math.max(co, j - i + 1); // valid windowj++;} else {// Shrink window until at most 2 types of fruitswhile (mp.size() > 2) {mp.put(nums[i], mp.get(nums[i]) - 1);if (mp.get(nums[i]) == 0) {mp.remove(nums[i]);}i++;}co = Math.max(co, j - i + 1);j++;}}return co;}}Dry Run ExampleInput:fruits = [1,2,3,2,2]Execution:Window [i, j]Fruit counts mpDistinct TypesValid?Max co[0,0] → [1]{1:1}1Yes1[0,1] → [1,2]{1:1,2:1}2Yes2[0,2] → [1,2,3]{1:1,2:1,3:1}3No → shrink2[1,2] → [2,3]{2:1,3:1}2Yes2[1,3] → [2,3,2]{2:2,3:1}2Yes3[1,4] → [2,3,2,2]{2:3,3:1}2Yes4Output:4Complexity AnalysisTime Complexity: O(n) → Each element is added and removed at most onceSpace Complexity: O(1) → HashMap stores at most 2 types of fruitsEdge Cases ConsideredArray with ≤ 2 types → entire array can be pickedArray with all same type → window length = array lengthZeros or non-continuous fruit types → handled by sliding windowLarge arrays up to 10⁵ elements → O(n) solution works efficientlySliding Window Pattern ImportanceThis problem demonstrates the sliding window + frequency map pattern:Track limited number of distinct elementsExpand/shrink window dynamicallyEfficiently compute max subarray length with constraintsIt’s directly related to problems like:Max consecutive ones with flipsLongest substring with k distinct charactersFruit collection / subarray problems with type limitsConclusionBy tracking fruit counts with a HashMap in a sliding window, we efficiently find the maximum fruits collectible in O(n) time.Mastering this pattern allows solving many array and string problems with constraints on distinct elements in a linear and elegant way.

SlidingWindowHashMapLeetCodeMedium
I Published My First npm Package: Karos

I Published My First npm Package: Karos

IntroductionPublishing your first npm package is not about building something revolutionary.If you think it is, you’ll either overbuild it or never ship it.Karos exists because I kept running into the same boring, frustrating problem across backend projects — inconsistent API responses and messy error handling.The Problem I Kept SeeingIn most Express or Node.js backends:Every route formats responses differentlySome errors are strings, some are objects, some leak stack tracesStatus codes are inconsistent or guessedFrontend logic becomes defensive and conditional-heavyTeams rewrite the same response boilerplate in every projectThere is no enforced backend–frontend contract.Just “best practices” that slowly decay over time.Why I Didn’t Use Existing SolutionsThere are libraries that help with errors.There are frameworks that encourage conventions.But most of them:Add heavy abstractionsRequire configuration filesLock you into a framework styleMix business logic with infrastructureI didn’t want help.I wanted enforcement — and nothing more.What Karos Does (And Only This)Karos enforces one predictable JSON response contract across your API.That’s it.Success Response{"success": true,"data": {}}Error Response{"success": false,"error": {"code": "NOT_FOUND","message": "User not found"}}No special cases.No custom shapes per route.If a response doesn’t match this structure, it’s wrong.Stop Returning Errors. Start Throwing Them.Instead of this pattern everywhere:if (!user) {return res.status(404).json({ error: 'User not found' });}Karos forces a different mindset:if (!user) {notFoundError('User not found');}The error is thrown, not returned.A single global handler catches it, formats it, and sends the response.No repeated try/catchNo duplicated error formattingNo forgotten status codesKarosError: One Error Model to Rule Them AllAt the core of Karos is a single class: KarosError.Every error has:A strict error code (TypeScript-safe)An explicit HTTP statusOptional structured detailsA guaranteed JSON shapeThis makes backend behavior predictable and frontend handling trivial.Database Errors Are Normalized AutomaticallyRaw database errors should never reach the client.Karos automatically detects and normalizes common DB errors:Prisma unique constraint → CONFLICT (409)Prisma record not found → NOT_FOUND (404)MongoDB duplicate key → CONFLICT (409)Mongoose validation errors → VALIDATION_FAILED (400)The frontend never needs to know which database you’re using.It only cares about the contract.Express and Next.js Share the Same ContractKaros supports:Express via middlewareNext.js (App Router) via Web-standard helpersBoth produce the exact same response format.That means you can switch frameworks or mix them — and your frontend logic stays unchanged.Karos API – All Methods in One PlaceCore API ReferenceCategoryFunction / ClassDescriptionSuccessok(res, data, message?, meta?)Sends a standardized success response (Express)Error BaseKarosErrorBase error class with code, status, detailsError HelpersnotFoundError()Throws 404 NOT_FOUNDvalidationError()Throws 400 VALIDATION_FAILEDunauthorizedError()Throws 401 UNAUTHORIZEDforbiddenError()Throws 403 FORBIDDENconflictError()Throws 409 CONFLICTinternalError()Throws 500 INTERNAL_ERRORhttpError()Custom error with any statusMiddlewareerrorHandlerGlobal Express error handlerDB HandlingresolveDbError()Normalizes Prisma/Mongo errorsNext.jsnextOk()Success response for App RouternextFail()Error response for App RouterhandleNextError()Global Next.js error handlerTypesErrorCodeEnum-style error codesTypesApiSuccessResponseSuccess response typeTypesApiErrorResponseError response typeWhat Karos Is NotThis matters more than features.Karos is not:A validation libraryA logging frameworkA request lifecycle managerA replacement for good architectureA silver bulletIt solves one problem and refuses to grow beyond that.How You Can Publish Your First npm Package TooIf you’re thinking “this looks doable” — it is.Here are the actual steps, no fluff.1. Create an npm AccountGo to https://www.npmjs.comSign up and verify your email2. Prepare Your Packagenpm initMake sure:name is uniquemain points to your build outputtypes points to .d.ts if using TypeScript3. Build Your Packagenpm run build(Usually outputs to dist/)4. Login to npmnpm loginEnter:UsernamePasswordEmailOTP (if 2FA enabled)5. Publishnpm publishThat’s it.No approval process. No gatekeepers.You are officially an npm package author.LinksGitHub Repository: https://github.com/Krishna-Shrivastava-1/Karosnpm Package: https://www.npmjs.com/package/karosWhy Shipping This Mattered to MeKaros won’t make headlines.It won’t go viral.But it forced me to:Design a real API contractThink about DX instead of just codeHandle edge cases like DB errors properlyShip something other people can actually useFor a first npm package, that’s a win.Final ThoughtMost backend bugs don’t come from complex logic.They come from inconsistency.Karos doesn’t make your API smarter.It makes it disciplined.And sometimes, that’s exactly what you need.

npmexpressnextjserror-handlingtypescriptopen-sourcefirst-npm-package
Longest Subarray of 1's After Deleting One Element – Sliding Window Approach

Longest Subarray of 1's After Deleting One Element – Sliding Window Approach

IntroductionLeetCode 1493: Longest Subarray of 1's After Deleting One Element is a neat sliding window problem that tests your ability to dynamically adjust a window while handling a constraint: deleting exactly one element.The task is to find the longest subarray of 1's you can get after deleting one element from the array.This problem is an excellent example of how sliding window with zero counting can convert a potentially brute-force solution into an O(n) linear solution.If you’d like to try solving the problem first, you can attempt it here:Try the problem on LeetCode:https://leetcode.com/problems/longest-subarray-of-1s-after-deleting-one-element/Problem UnderstandingYou are given:A binary array nums containing only 0’s and 1’sYou must delete exactly one elementYour task: Return the length of the longest non-empty subarray of 1’s after deleting one element.Examples:Input: nums = [1,1,0,1]Output: 3Explanation: Delete element at index 2 → [1,1,1]. Longest subarray of 1's = 3.Input: nums = [0,1,1,1,0,1,1,0,1]Output: 5Explanation: Delete element at index 4 → [0,1,1,1,1,1,0,1]. Longest subarray of 1's = 5.Input: nums = [1,1,1]Output: 2Explanation: Must delete one element → longest subarray = 2.A naive approach would try removing each element and scanning for the longest subarray →Time Complexity: O(n²) → too slow for nums.length up to 10⁵Inefficient for large arraysKey Idea: Sliding Window with At Most One ZeroNotice the following:Deleting one element is equivalent to allowing at most one zero in the subarrayWe can use a sliding window [i, j] and a counter z for zeros in the windowExpand j while z <= 1If z > 1, shrink the window from the left until z <= 1The length of the window (j - i) gives the maximum length of consecutive 1’s after deleting one elementIntuition:Only one zero is allowed in the window because deleting that zero would turn the window into all 1'sThis converts the problem into a linear sliding window problem with zero countingApproach (Step-by-Step)Initialize i = 0, j = 0 for window pointersInitialize z = 0 → number of zeros in current windowInitialize co = 0 → maximum length of valid subarrayIterate j over nums:If nums[j] == 0, increment zCheck z:If z <= 1: window is valid → update co = max(co, j - i)If z > 1: shrink window from i until z <= 1Continue expanding the windowReturn co as the maximum length after deleting one elementOptimization:Only need one zero counter and window pointersAvoid recomputing subarray lengths repeatedlyImplementation (Java)class Solution {public int longestSubarray(int[] nums) {int i = 0, j = 0; // window pointersint co = 0; // max lengthint z = 0; // count of zeros in windowwhile (j < nums.length) {if (nums[j] == 0) {z++; // increment zero count}if (z <= 1) {co = Math.max(co, j - i); // valid windowj++;} else {// shrink window until at most one zerowhile (z > 1) {if (nums[i] == 0) {z--;}i++;}co = Math.max(co, j - i);j++;}}return co;}}Dry Run ExampleInput:nums = [1,1,0,1]Execution:Window [i, j]Zeros zValid?Max length co[0,0] → [1]0Yes0[0,1] → [1,1]0Yes1[0,2] → [1,1,0]1Yes2[0,3] → [1,1,0,1]1Yes3Output:3Complexity AnalysisTime Complexity: O(n) → Each element is visited at most twice (i and j)Space Complexity: O(1) → Only counters and pointers usedEdge Cases ConsideredArray of all 1’s → must delete one → max length = n - 1Array of all 0’s → return 0Single element arrays → return 0 (because deletion required)Zeros at the start/end of array → handled by sliding windowSliding Window Pattern ImportanceThis problem is a great example of sliding window with limited violations:Maintain a window satisfying a constraint (at most one zero)Expand/shrink dynamicallyCompute max length without scanning all subarraysIt’s directly related to problems like:Max consecutive ones with k flipsLongest substring with at most k distinct charactersSubarray problems with limited replacementsConclusionBy tracking zeros with a sliding window, we efficiently find the longest subarray of 1’s after deleting one element in O(n) time.This pattern is reusable in many binary array and string problems, making it a must-know technique for coding interviews.

SlidingWindowBinaryArrayLeetCodeMedium
Understanding HashMap and Hashing Techniques: A Complete Guide

Understanding HashMap and Hashing Techniques: A Complete Guide

What is HashMap?HashMap is a non-linear data structure that lives inside Java's collection framework, alongside other structures like Trees and Graphs (see the generated image above). What makes it special? It uses a clever technique called hashing to store and retrieve data at blazing speeds.Think of hashing as a smart address system. It converts large keys (like long strings or big numbers) into smaller values that work as array indices. This simple trick transforms your data lookup from slow O(n)O(n) or O(log⁡n)O(logn) operations into lightning-fast O(1)O(1) access times!Understanding Hashing MappingsBefore diving deeper, let's understand the four types of hashing mappings:One-to-one mapping — Each key maps to exactly one indexMany-to-one mapping — Multiple keys can map to the same indexOne-to-many mapping — One key maps to multiple indicesMany-to-many mapping — Multiple keys map to multiple indicesHashMap primarily uses one-to-one and many-to-one mapping strategies to achieve its performance goals.The Problem: Why Not Just Use Arrays?Let's say you want to store 7 elements with keys: 1, 5, 23, 57, 234, 678, and 1000.Using direct indexing (where key = array index), you'd need an array of size 1000 just to store 7 items! That leaves 993 empty slots wasting precious memory. Imagine having a parking lot with 1000 spaces for just 7 cars — totally inefficient!This is the exact problem hash functions solve.Hash Functions: The SolutionA hash function takes your key and calculates which array index to use. The beauty? You can now store those same 7 elements in an array of just size 10!The most common hash function uses the modulus operator:hash(key)=keymod array sizehash(key)=keymodarray sizeExample: With array size = 10:Key 57 → Index: 57mod 10=757mod10=7Key 234 → Index: 234mod 10=4234mod10=4Key 1000 → Index: 1000mod 10=01000mod10=0Now you only need an array of size 10 instead of 1000. Problem solved!Three Popular Hash Function TypesModulus MethodThe most widely used technique. Divide the key by array size (or a prime number) and use the remainder as the index.index=keymod sizeindex=keymodsizeMid Square MethodSquare the key value, then extract the middle digits to form your hash value.Example: Key = 57 → 572=3249572=3249 → Extract middle digits "24"Folding HashingDivide the key into equal parts, add them together, then apply modulus.Example: Key = 123456Split into: 12, 34, 56Sum: 12+34+56=10212+34+56=102Apply modulus: 102mod 10=2102mod10=2The Collision ProblemHere's the catch: sometimes two different keys produce the same index. This is called a collision.Example:Key 27 → 27mod 10=727mod10=7Key 57 → 57mod 10=757mod10=7Both keys want index 7! We need smart strategies to handle this.Collision Resolution: Two Main TechniquesTechnique 1: Open Chaining (Separate Chaining)Mapping Type: Many-to-oneWhen a collision happens, create a linked list at that index and store all colliding values in sorted order.Example: Keys 22 and 32 both map to index 2:Index 2: [22] → [32] → nullAdvantage: Simple and works well in practiceDrawback: If too many collisions occur, the linked list becomes long and searching degrades to O(n)O(n). However, Java's collection framework uses highly optimized hash functions that achieve amortized O(1)O(1) time complexity.Technique 2: Closed Addressing (Open Addressing)Mapping Type: One-to-manyInstead of creating a list, find another empty slot in the array. There are three approaches:Linear ProbingWhen collision occurs, check the next index. If it's occupied, keep checking the next one until you find an empty slot.Hash Function:h(x)=xmod sizeh(x)=xmodsizeOn Collision:h(x)=(h(x)+i)mod sizeh(x)=(h(x)+i)modsizewhere i=0,1,2,3,…i=0,1,2,3,…Example: Keys 22 and 32 both map to index 2:Store 22 at index 2Try 32 at index 2 → occupiedCheck index 3 → empty, store 32 thereProblems:Clustering: Keys bunch together in adjacent indices, slowing down searchesDeleted Slot Problem: When you delete a key, it creates an empty slot that breaks the search chainThe Deleted Slot Problem Explained:Keys 22 and 32 are at indices 2 and 3Delete key 22 from index 2Now when searching for key 32, the algorithm reaches index 2 (empty), thinks key 32 doesn't exist, and stops searching!Solution: Mark deleted slots with a special marker (like -1) or perform rehashing after deletions.Quadratic ProbingSame concept as linear probing, but instead of checking consecutive slots, jump in quadratic increments: 1, 4, 9, 16, 25...Hash Function:h(x)=xmod sizeh(x)=xmodsizeOn Collision:h(x)=(h(x)+i2)mod sizeh(x)=(h(x)+i2)modsizewhere i=0,1,2,3,…i=0,1,2,3,…Advantage: Significantly reduces clusteringDrawback: Still suffers from the deleted slot problemDouble HashingThe most sophisticated approach! Uses two different hash functions to create unique probe sequences for each key.First Hash Function:h1(x)=xmod sizeh1(x)=xmodsizeSecond Hash Function:h2(x)=prime−(xmod prime)h2(x)=prime−(xmodprime)On Collision:h(x)=(h1(x)+i×h2(x))mod sizeh(x)=(h1(x)+i×h2(x))modsizewhere i=0,1,2,3,…i=0,1,2,3,…Advantage: Effectively avoids clustering and provides the best performance among probing techniquesLoad Factor: The Performance IndicatorThe load factor tells you how full your hash table is:Load Factor=Number of elementsArray sizeLoad Factor=Array sizeNumber of elementsPerformance GuidelinesLoad Factor ≤ 0.5 → Good performance, fast operations Load Factor > 0.7 → Poor performance, time to rehash ExamplesBad Load Factor:Array size = 10, Elements = 8Load Factor = 8/10=0.88/10=0.8Action: Rehash the array (typically double the size)Good Load Factor:Array size = 200, Elements = 100Load Factor = 100/200=0.5100/200=0.5Action: No changes needed, performing optimallyWhat is Rehashing?When the load factor exceeds the threshold (usually 0.7), the hash table is resized — typically doubled in size. All existing elements are then rehashed and redistributed into the new larger array. This maintains optimal performance as your data grows.Performance SummaryHashMap delivers exceptional average-case performance:Insertion: O(1)O(1)Deletion: O(1)O(1)Search: O(1)O(1)However, in the worst case (many collisions with poor hash functions), operations can degrade to O(n)O(n).The key to maintaining O(1)O(1) performance:Use a good hash functionChoose an appropriate collision resolution strategyMonitor and maintain a healthy load factorRehash when necessaryConclusionHashMap is one of the most powerful and frequently used data structures in programming. By understanding hashing techniques, collision resolution strategies, and load factors, you can write more efficient code and make better design decisions.Whether you're building a cache, implementing a frequency counter, or solving complex algorithm problems, HashMap is your go-to tool for fast data access!

hashmapdata-structureshashingjavaalgorithmscollision-resolutiontime-complexity
Ai Assistant Kas