Search Blogs

Showing results for "Base Case"

Found 47 results

Recursion in Java - Complete Guide With Examples and Practice Problems

Recursion in Java - Complete Guide With Examples and Practice Problems

IntroductionIf there is one topic in programming that confuses beginners more than anything else, it is recursion. Most people read the definition, nod their head, and then immediately freeze when they have to write recursive code themselves.The problem is not that recursion is genuinely hard. The problem is that most explanations start with code before building the right mental model. Once you have the right mental model, recursion clicks permanently and you start seeing it everywhere — in tree problems, graph problems, backtracking, dynamic programming, divide and conquer, and more.This guide covers everything from the ground up. What recursion is, how the call stack works, how to identify base cases and recursive cases, every type of recursion, common patterns, time and space complexity analysis, the most common mistakes, and the top LeetCode problems to practice.By the end of this article, recursion will not feel like magic anymore. It will feel like a natural tool you reach for confidently.What Is Recursion?Recursion is when a function calls itself to solve a smaller version of the same problem.That is the complete definition. But let us make it concrete.Imagine you want to count down from 5 to 1. One way is a loop. Another way is — print 5, then solve the exact same problem for counting down from 4 to 1. Then print 4, solve for 3. And so on until you reach the base — there is nothing left to count down.void countDown(int n) { if (n == 0) return; // stop here System.out.println(n); countDown(n - 1); // solve the smaller version}The function countDown calls itself with a smaller input each time. Eventually it reaches 0 and stops. That stopping condition is the most important part of any recursive function — the base case.The Two Parts Every Recursive Function Must HaveEvery correctly written recursive function has exactly two parts. Without both, the function either gives wrong answers or runs forever.Part 1: Base CaseThe base case is the condition under which the function stops calling itself and returns a direct answer. It is the smallest version of the problem that you can solve without any further recursion.Without a base case, recursion never stops and you get a StackOverflowError — Java's way of telling you the call stack ran out of memory.Part 2: Recursive CaseThe recursive case is where the function calls itself with a smaller or simpler input — moving closer to the base case with each call. If your recursive case does not make the problem smaller, you have an infinite loop.Think of it like a staircase. The base case is the ground floor. The recursive case is each step going down. Every step must genuinely bring you one level closer to the ground.How Recursion Works — The Call StackThis is the mental model that most explanations skip, and it is the reason recursion confuses people.Every time a function is called in Java, a new stack frame is created and pushed onto the call stack. This frame stores the function's local variables, parameters, and where to return to when the function finishes.When a recursive function calls itself, a new frame is pushed on top. When that call finishes, its frame is popped and execution returns to the previous frame.Let us trace countDown(3) through the call stack:countDown(3) called → frame pushed prints 3 calls countDown(2) → frame pushed prints 2 calls countDown(1) → frame pushed prints 1 calls countDown(0) → frame pushed n == 0, return → frame popped back in countDown(1), return → frame popped back in countDown(2), return → frame popped back in countDown(3), return → frame poppedOutput: 3, 2, 1The call stack grows as calls go deeper, then shrinks as calls return. This is why recursion uses O(n) space for n levels deep — each level occupies one stack frame in memory.Your First Real Recursive Function — FactorialFactorial is the classic first recursion example. n! = n × (n-1) × (n-2) × ... × 1Notice the pattern — n! = n × (n-1)!. The factorial of n is n times the factorial of n-1. That recursive structure makes it perfect for recursion.public int factorial(int n) { // base case if (n == 0 || n == 1) return 1; // recursive case return n * factorial(n - 1);}Dry Run — factorial(4)factorial(4)= 4 * factorial(3)= 4 * 3 * factorial(2)= 4 * 3 * 2 * factorial(1)= 4 * 3 * 2 * 1= 24The call stack builds up going in, then multiplications happen coming back out. This "coming back out" phase is called the return phase or unwinding of the stack.Time Complexity: O(n) — n recursive calls Space Complexity: O(n) — n frames on the call stackThe Two Phases of RecursionEvery recursive function has two phases and understanding both is critical.Phase 1: The Call Phase (Going In)This happens as the function keeps calling itself with smaller inputs. Things you do before the recursive call happen in this phase — in order from the outermost call to the innermost.Phase 2: The Return Phase (Coming Back Out)This happens as each call finishes and returns to its caller. Things you do after the recursive call happen in this phase — in reverse order, from the innermost call back to the outermost.This distinction explains why the output order can be surprising:void printBothPhases(int n) { if (n == 0) return; System.out.println("Going in: " + n); // call phase printBothPhases(n - 1); System.out.println("Coming out: " + n); // return phase}For printBothPhases(3):Going in: 3Going in: 2Going in: 1Coming out: 1Coming out: 2Coming out: 3This two-phase understanding is what makes problems like reversing a string or printing a linked list backwards via recursion feel natural.Types of RecursionRecursion is not one-size-fits-all. There are several distinct types and knowing which type applies to a problem shapes how you write the solution.1. Direct RecursionThe function calls itself directly. This is the most common type — what we have seen so far.void direct(int n) { if (n == 0) return; direct(n - 1); // calls itself}2. Indirect RecursionFunction A calls Function B which calls Function A. They form a cycle.void funcA(int n) { if (n <= 0) return; System.out.println("A: " + n); funcB(n - 1);}void funcB(int n) { if (n <= 0) return; System.out.println("B: " + n); funcA(n - 1);}Used in: state machines, mutual recursion in parsers, certain mathematical sequences.3. Tail RecursionThe recursive call is the last operation in the function. Nothing happens after the recursive call returns — no multiplication, no addition, nothing.// NOT tail recursive — multiplication happens after returnint factorial(int n) { if (n == 1) return 1; return n * factorial(n - 1); // multiply after return — not tail}// Tail recursive — recursive call is the last thingint factorialTail(int n, int accumulator) { if (n == 1) return accumulator; return factorialTail(n - 1, n * accumulator); // last operation}Why does tail recursion matter? In languages that support tail call optimization (like Scala, Kotlin, and many functional languages), tail recursive functions can be converted to iteration internally — no stack frame accumulation, O(1) space. Java does NOT perform tail call optimization, but understanding tail recursion is still important for interviews and functional programming concepts.4. Head RecursionThe recursive call happens first, before any other processing. All processing happens in the return phase.void headRecursion(int n) { if (n == 0) return; headRecursion(n - 1); // call first System.out.println(n); // process after}// Output: 1 2 3 4 5 (processes in reverse order of calls)5. Tree RecursionThe function makes more than one recursive call per invocation. This creates a tree of calls rather than a linear chain. Fibonacci is the classic example.int fibonacci(int n) { if (n <= 1) return n; return fibonacci(n - 1) + fibonacci(n - 2); // TWO recursive calls}The call tree for fibonacci(4): fib(4) / \ fib(3) fib(2) / \ / \ fib(2) fib(1) fib(1) fib(0) / \ fib(1) fib(0)Time Complexity: O(2ⁿ) — exponential! Each call spawns two more. Space Complexity: O(n) — maximum depth of the call treeThis is why memoization (caching results) is so important for tree recursion — it converts O(2ⁿ) to O(n) by never recomputing the same subproblem twice.6. Mutual RecursionA specific form of indirect recursion where two functions call each other alternately to solve a problem. Different from indirect recursion in that the mutual calls are the core mechanism of the solution.// Check if a number is even or odd using mutual recursionboolean isEven(int n) { if (n == 0) return true; return isOdd(n - 1);}boolean isOdd(int n) { if (n == 0) return false; return isEven(n - 1);}Common Recursion Patterns in DSAThese are the patterns you will see over and over in interview problems. Recognizing them is more important than memorizing solutions.Pattern 1: Linear Recursion (Do Something, Recurse on Rest)Process the current element, then recurse on the remaining problem.// Sum of arrayint arraySum(int[] arr, int index) { if (index == arr.length) return 0; // base case return arr[index] + arraySum(arr, index + 1); // current + rest}Pattern 2: Divide and Conquer (Split Into Two Halves)Split the problem into two halves, solve each recursively, combine results.// Merge Sortvoid mergeSort(int[] arr, int left, int right) { if (left >= right) return; // base case — single element int mid = (left + right) / 2; mergeSort(arr, left, mid); // sort left half mergeSort(arr, mid + 1, right); // sort right half merge(arr, left, mid, right); // combine}Pattern 3: Backtracking (Try, Recurse, Undo)Try a choice, recurse to explore it, undo the choice when backtracking.// Generate all subsetsvoid subsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { if (index == nums.length) { result.add(new ArrayList<>(current)); return; } // Choice 1: include nums[index] current.add(nums[index]); subsets(nums, index + 1, current, result); current.remove(current.size() - 1); // undo // Choice 2: exclude nums[index] subsets(nums, index + 1, current, result);}Pattern 4: Tree Recursion (Left, Right, Combine)Recurse on left subtree, recurse on right subtree, combine or process results.// Height of binary treeint height(TreeNode root) { if (root == null) return 0; // base case int leftHeight = height(root.left); // solve left int rightHeight = height(root.right); // solve right return 1 + Math.max(leftHeight, rightHeight); // combine}Pattern 5: Memoization (Cache Recursive Results)Store results of recursive calls so the same subproblem is never solved twice.Map<Integer, Integer> memo = new HashMap<>();int fibonacci(int n) { if (n <= 1) return n; if (memo.containsKey(n)) return memo.get(n); // return cached int result = fibonacci(n - 1) + fibonacci(n - 2); memo.put(n, result); // cache before returning return result;}This converts Fibonacci from O(2ⁿ) to O(n) time with O(n) space — a massive improvement.Recursion vs Iteration — When to Use WhichThis is one of the most common interview questions about recursion. Here is a clear breakdown:Use Recursion when:The problem has a naturally recursive structure (trees, graphs, divide and conquer)The solution is significantly cleaner and easier to understand recursivelyThe problem involves exploring multiple paths or choices (backtracking)The depth of recursion is manageable (not too deep to cause stack overflow)Use Iteration when:The problem is linear and a loop is equally clearMemory is a concern (iteration uses O(1) stack space vs O(n) for recursion)Performance is critical and function call overhead mattersJava's stack size limit could be hit (default around 500-1000 frames for deep recursion)The key rule: Every recursive solution can be converted to an iterative one (usually using an explicit stack). But recursive solutions for tree and graph problems are almost always cleaner to write and understand.Time and Space Complexity of Recursive FunctionsAnalyzing complexity for recursive functions requires a specific approach.The Recurrence Relation MethodExpress the time complexity as a recurrence relation and solve it.Factorial:T(n) = T(n-1) + O(1) = T(n-2) + O(1) + O(1) = T(1) + n×O(1) = O(n)Fibonacci (naive):T(n) = T(n-1) + T(n-2) + O(1) ≈ 2×T(n-1) = O(2ⁿ)Binary Search:T(n) = T(n/2) + O(1) = O(log n) [by Master Theorem]Merge Sort:T(n) = 2×T(n/2) + O(n) = O(n log n) [by Master Theorem]Space Complexity Rule for RecursionSpace complexity of a recursive function = maximum depth of the call stack × space per frameLinear recursion (factorial, sum): O(n) spaceBinary recursion (Fibonacci naive): O(n) space (maximum depth, not number of nodes)Divide and conquer (merge sort): O(log n) space (depth of recursion tree)Memoized Fibonacci: O(n) space (memo table + call stack)Classic Recursive Problems With SolutionsProblem 1: Reverse a StringString reverse(String s) { if (s.length() <= 1) return s; // base case // last char + reverse of everything before last char return s.charAt(s.length() - 1) + reverse(s.substring(0, s.length() - 1));}Dry run for "hello":reverse("hello") = 'o' + reverse("hell")reverse("hell") = 'l' + reverse("hel")reverse("hel") = 'l' + reverse("he")reverse("he") = 'e' + reverse("h")reverse("h") = "h"Unwinding: "h" → "he" → "leh" → "lleh" → "olleh" ✅Problem 2: Power Function (x^n)double power(double x, int n) { if (n == 0) return 1; // base case if (n < 0) return 1.0 / power(x, -n); // handle negative if (n % 2 == 0) { double half = power(x, n / 2); return half * half; // x^n = (x^(n/2))^2 } else { return x * power(x, n - 1); }}This is the fast power algorithm — O(log n) time instead of O(n).Problem 3: Fibonacci With Memoizationint[] memo = new int[100];Arrays.fill(memo, -1);int fib(int n) { if (n <= 1) return n; if (memo[n] != -1) return memo[n]; memo[n] = fib(n - 1) + fib(n - 2); return memo[n];}Time: O(n) — each value computed once Space: O(n) — memo array + call stackProblem 4: Tower of HanoiThe classic recursion teaching problem. Move n disks from source to destination using a helper rod.void hanoi(int n, char source, char destination, char helper) { if (n == 1) { System.out.println("Move disk 1 from " + source + " to " + destination); return; } // Move n-1 disks from source to helper hanoi(n - 1, source, helper, destination); // Move the largest disk from source to destination System.out.println("Move disk " + n + " from " + source + " to " + destination); // Move n-1 disks from helper to destination hanoi(n - 1, helper, destination, source);}Time Complexity: O(2ⁿ) — minimum moves required is 2ⁿ - 1 Space Complexity: O(n) — call stack depthProblem 5: Generate All Subsets (Power Set)void generateSubsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { result.add(new ArrayList<>(current)); // add current subset for (int i = index; i < nums.length; i++) { current.add(nums[i]); // include generateSubsets(nums, i + 1, current, result); // recurse current.remove(current.size() - 1); // exclude (backtrack) }}For [1, 2, 3] — generates all 8 subsets: [], [1], [1,2], [1,2,3], [1,3], [2], [2,3], [3]Time: O(2ⁿ) — 2ⁿ subsets Space: O(n) — recursion depthProblem 6: Binary Search Recursivelyint binarySearch(int[] arr, int target, int left, int right) { if (left > right) return -1; // base case — not found int mid = left + (right - left) / 2; if (arr[mid] == target) return mid; else if (arr[mid] < target) return binarySearch(arr, target, mid + 1, right); else return binarySearch(arr, target, left, mid - 1);}Time: O(log n) — halving the search space each time Space: O(log n) — log n frames on the call stackRecursion on Trees — The Natural HabitatTrees are where recursion truly shines. Every tree problem becomes elegant with recursion because a tree is itself a recursive structure — each node's left and right children are trees themselves.// Maximum depth of binary treeint maxDepth(TreeNode root) { if (root == null) return 0; return 1 + Math.max(maxDepth(root.left), maxDepth(root.right));}// Check if tree is symmetricboolean isSymmetric(TreeNode left, TreeNode right) { if (left == null && right == null) return true; if (left == null || right == null) return false; return left.val == right.val && isSymmetric(left.left, right.right) && isSymmetric(left.right, right.left);}// Path sum — does any root-to-leaf path sum to target?boolean hasPathSum(TreeNode root, int target) { if (root == null) return false; if (root.left == null && root.right == null) return root.val == target; return hasPathSum(root.left, target - root.val) || hasPathSum(root.right, target - root.val);}Notice the pattern in all three — base case handles null, recursive case handles left and right subtrees, result combines both.How to Think About Any Recursive Problem — Step by StepThis is the framework you should apply to every new recursive problem you encounter:Step 1 — Identify the base case What is the smallest input where you know the answer directly without any recursion? For arrays it is usually empty array or single element. For trees it is null node. For numbers it is 0 or 1.Step 2 — Trust the recursive call Assume your function already works correctly for smaller inputs. Do not trace through the entire recursion mentally — just trust it. This is the Leap of Faith and it is what makes recursion feel natural.Step 3 — Express the current problem in terms of smaller problems How does the answer for size n relate to the answer for size n-1 (or n/2, or subtrees)? This relationship is your recursive case.Step 4 — Make sure each call moves toward the base case The input must become strictly smaller with each call. If it does not, you have infinite recursion.Step 5 — Write the base case first, then the recursive case Always. Writing the recursive case first leads to bugs because you have not defined when to stop.Common Mistakes and How to Avoid ThemMistake 1: Missing or wrong base case The most common mistake. Missing the base case causes StackOverflowError. Wrong base case causes wrong answers.Always ask — what is the simplest possible input, and what should the function return for it? Write that case first.Mistake 2: Not moving toward the base case If you call factorial(n) inside factorial(n) without reducing n, you loop forever. Every recursive call must make the problem strictly smaller.Mistake 3: Trusting your brain to trace deep recursion Do not try to trace 10 levels of recursion in your head. Trust the recursive call, verify the base case, and check that each call reduces the problem. That is all you need.Mistake 4: Forgetting to return the recursive result// WRONG — result is computed but not returnedint sum(int n) { if (n == 0) return 0; sum(n - 1) + n; // computed but discarded!}// CORRECTint sum(int n) { if (n == 0) return 0; return sum(n - 1) + n;}Mistake 5: Modifying shared state without backtracking In backtracking problems, if you add something to a list before a recursive call, you must remove it after the call returns. Forgetting to backtrack leads to incorrect results and is one of the trickiest bugs to find.Mistake 6: Recomputing the same subproblems Naive Fibonacci computes fib(3) multiple times when computing fib(5). Use memoization whenever you notice overlapping subproblems in your recursion tree.Top LeetCode Problems on RecursionThese are organized by pattern — work through them in this order for maximum learning:Pure Recursion Basics:509. Fibonacci Number — Easy — start here, implement with and without memoization344. Reverse String — Easy — recursion on arrays206. Reverse Linked List — Easy — recursion on linked list50. Pow(x, n) — Medium — fast power with recursionTree Recursion (Most Important):104. Maximum Depth of Binary Tree — Easy — simplest tree recursion112. Path Sum — Easy — decision recursion on tree101. Symmetric Tree — Easy — mutual recursion on tree110. Balanced Binary Tree — Easy — bottom-up recursion236. Lowest Common Ancestor of a Binary Tree — Medium — classic tree recursion124. Binary Tree Maximum Path Sum — Hard — advanced tree recursionDivide and Conquer:148. Sort List — Medium — merge sort on linked list240. Search a 2D Matrix II — Medium — divide and conquerBacktracking:78. Subsets — Medium — generate all subsets46. Permutations — Medium — generate all permutations77. Combinations — Medium — generate combinations79. Word Search — Medium — backtracking on grid51. N-Queens — Hard — classic backtrackingMemoization / Dynamic Programming:70. Climbing Stairs — Easy — Fibonacci variant with memoization322. Coin Change — Medium — recursion with memoization to DP139. Word Break — Medium — memoized recursionRecursion Cheat Sheet// Linear recursion templatereturnType solve(input) { if (baseCase) return directAnswer; // process current return solve(smallerInput);}// Tree recursion templatereturnType solve(TreeNode root) { if (root == null) return baseValue; returnType left = solve(root.left); returnType right = solve(root.right); return combine(left, right, root.val);}// Backtracking templatevoid backtrack(choices, current, result) { if (goalReached) { result.add(copy of current); return; } for (choice : choices) { make(choice); // add to current backtrack(...); // recurse undo(choice); // remove from current }}// Memoization templateMap<Input, Output> memo = new HashMap<>();returnType solve(input) { if (baseCase) return directAnswer; if (memo.containsKey(input)) return memo.get(input); returnType result = solve(smallerInput); memo.put(input, result); return result;}FAQs — People Also AskQ1. What is recursion in Java with a simple example? Recursion is when a function calls itself to solve a smaller version of the same problem. A simple example is factorial — factorial(5) = 5 × factorial(4) = 5 × 4 × factorial(3) and so on until factorial(1) returns 1 directly.Q2. What is the difference between recursion and iteration? Iteration uses loops (for, while) and runs in O(1) space. Recursion uses function calls and uses O(n) stack space for n levels deep. Recursion is often cleaner for tree and graph problems. Iteration is better when memory is a concern or the problem is inherently linear.Q3. What causes StackOverflowError in Java recursion? StackOverflowError happens when recursion goes too deep — too many frames accumulate on the call stack before any of them return. This is caused by missing base case, wrong base case, or input too large for Java's default stack size limit.Q4. What is the difference between recursion and dynamic programming? Recursion solves a problem by breaking it into subproblems. Dynamic programming is recursion plus memoization — storing results of subproblems so they are never computed twice. DP converts exponential recursive solutions into polynomial ones by eliminating redundant computation.Q5. What is tail recursion and does Java support tail call optimization? Tail recursion is when the recursive call is the absolute last operation in the function. Java does NOT support tail call optimization — Java always creates a new stack frame for each call even if it is tail recursive. Languages like Scala and Kotlin (on the JVM) do support it with the tailrec keyword.Q6. How do you convert recursion to iteration? Every recursive solution can be converted to iterative using an explicit stack data structure. The call stack's behavior is replicated manually — push the initial call, loop while stack is not empty, pop, process, and push sub-calls. Tree traversals are a common example of this conversion.ConclusionRecursion is not magic. It is a systematic way of solving problems by expressing them in terms of smaller versions of themselves. Once you internalize the two parts (base case and recursive case), understand the call stack mentally, and learn to trust the recursive call rather than trace it completely, everything clicks.The learning path from here is clear — start with simple problems like Fibonacci and array sum. Move to tree problems where recursion is most natural. Then tackle backtracking. Finally add memoization to bridge into dynamic programming.Every hour you spend understanding recursion deeply pays dividends across the entire rest of your DSA journey. Trees, graphs, divide and conquer, backtracking, dynamic programming — all of them build on this foundation.

RecursionJavaBase CaseCall StackBacktrackingDynamic Programming
Sort a Stack Using Recursion - Java Solution Explained

Sort a Stack Using Recursion - Java Solution Explained

IntroductionSort a Stack is one of those problems that feels impossible at first — you only have access to the top of a stack, you cannot index into it, and the only tools you have are push, pop, and peek. How do you sort something with such limited access?The answer is recursion. And this problem is a perfect example of how recursion can do something elegant that feels like it should require much more complex logic.You can find this problem here — Sort a Stack — GeeksForGeeksThis article explains the complete intuition, both recursive functions in detail, a thorough dry run, all approaches, and complexity analysis.What Is the Problem Really Asking?You have a stack of integers. Sort it so that the smallest element is at the bottom and the largest element is at the top.Input: [41, 3, 32, 2, 11] (11 is at top)Output: [41, 32, 11, 3, 2] (2 is at top, 41 at bottom)Wait — if smallest is at bottom and largest at top, then popping gives you the smallest first. So the stack is sorted in ascending order from top to bottom when you pop.The constraints make this interesting — you can only use stack operations (push, pop, peek, isEmpty). No arrays, no sorting algorithms directly on the data, no random access.Real Life Analogy — Sorting a Stack of BooksImagine a stack of books of different thicknesses on your desk. You want the thinnest book on top and thickest at the bottom. But you can only take from the top.Here is what you do — pick up books one by one from the top and set them aside. Once you have removed enough, place each book back in its correct position. If the book you are placing is thicker than what is currently on top, slide the top books aside temporarily, place the thick book down, then put the others back.That is exactly what the recursive sort does — take elements out one by one, and insert each back into the correct position.The Core Idea — Two Recursive Functions Working TogetherThe solution uses two recursive functions that work hand in hand:sortStack(st) — removes elements one by one until the stack is empty, then inserts each back using insertinsert(st, temp) — inserts a single element into its correct sorted position in an already-sorted stackThink of it like this — sortStack is the manager that empties the stack recursively, and insert is the worker that places each element in the right position on the way back.Function 1: sortStack — The Main Recursive Driverpublic void sortStack(Stack<Integer> st) { // base case — empty or single element is already sorted if (st.empty() || st.size() == 1) return; // Step 1: remove the top element int temp = st.pop(); // Step 2: recursively sort the remaining stack sortStack(st); // Step 3: insert the removed element in correct position insert(st, temp);}How to Think About ThisThe leap of faith here — trust that sortStack correctly sorts whatever is below. After the recursive call, the remaining stack is perfectly sorted. Now your only job is to insert temp (the element you removed) into its correct position in that sorted stack.This is the classic "solve smaller, fix current" recursion pattern. Reduce the problem by one element, trust recursion for the rest, then fix the current element's position.Function 2: insert — Placing an Element in Sorted Positionvoid insert(Stack<Integer> st, int temp) { // base case 1: stack is empty — just push // base case 2: top element is smaller or equal — push on top if (st.empty() || st.peek() <= temp) { st.push(temp); return; } // top element is greater than temp // temp needs to go below the top element int val = st.pop(); // temporarily remove the top insert(st, temp); // try inserting temp deeper st.push(val); // restore the removed element on top}How to Think About ThisYou want to insert temp in sorted order. The stack is already sorted (largest on top). So:If the top is smaller than or equal to temp → temp belongs on top. Push it.If the top is greater than temp → temp needs to go below the top. So pop the top temporarily, try inserting temp deeper, then push the top back.This is the same "pop, recurse deeper, push back" pattern you saw in the Baseball Game problem — when you need to access elements below the top without permanent removal.Complete Solutionclass Solution { // insert temp into its correct position in sorted stack void insert(Stack<Integer> st, int temp) { if (st.empty() || st.peek() <= temp) { st.push(temp); return; } int val = st.pop(); insert(st, temp); st.push(val); } // sort the stack using recursion public void sortStack(Stack<Integer> st) { if (st.empty() || st.size() == 1) return; int temp = st.pop(); // remove top sortStack(st); // sort remaining insert(st, temp); // insert top in correct position }}Detailed Dry Run — st = [3, 2, 1] (1 at top)Let us trace every single call carefully.sortStack calls (going in):sortStack([3, 2, 1]) temp = 1, remaining = [3, 2] call sortStack([3, 2]) temp = 2, remaining = [3] call sortStack([3]) size == 1, return ← base case now insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 ← base case push val=3 back stack is now [2, 3] (3 on top) sortStack([3,2]) done → stack = [2, 3] now insert(st=[2,3], temp=1) peek=3 > 1, pop val=3 insert(st=[2], temp=1) peek=2 > 1, pop val=2 insert(st=[], temp=1) st empty, push 1 ← base case push val=2 back stack = [1, 2] push val=3 back stack = [1, 2, 3] (3 on top)sortStack done → stack = [1, 2, 3]✅ Final stack (3 on top, 1 at bottom): largest at top, smallest at bottom — correctly sorted!Detailed Dry Run — st = [41, 3, 32, 2, 11] (11 at top)Let us trace at a higher level to see the pattern:sortStack calls unwinding (popping phase):sortStack([41, 3, 32, 2, 11]) pop 11, sortStack([41, 3, 32, 2]) pop 2, sortStack([41, 3, 32]) pop 32, sortStack([41, 3]) pop 3, sortStack([41]) base case — return insert([41], 3) → [3, 41] (41 on top) insert([3, 41], 32) → [3, 32, 41] (41 on top) insert([3, 32, 41], 2) → [2, 3, 32, 41] (41 on top) insert([2, 3, 32, 41], 11) → [2, 3, 11, 32, 41] (41 on top)✅ Final: [2, 3, 11, 32, 41] with 41 at top, 2 at bottom — correct!Let us verify the insert([3, 32, 41], 2) step in detail since it involves multiple pops:insert(st=[3, 32, 41], temp=2) peek=41 > 2, pop val=41 insert(st=[3, 32], temp=2) peek=32 > 2, pop val=32 insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 push val=3 back → [2, 3] push val=32 back → [2, 3, 32] push val=41 back → [2, 3, 32, 41]Beautiful chain of pops followed by a chain of pushes — recursion handling what would be very messy iterative logic.Approach 2: Using an Additional Stack (Iterative)If recursion is not allowed or you want an iterative solution, you can use a second stack.public void sortStack(Stack<Integer> st) { Stack<Integer> tempStack = new Stack<>(); while (!st.empty()) { int curr = st.pop(); // move elements from tempStack back to st // until we find the right position for curr while (!tempStack.empty() && tempStack.peek() > curr) { st.push(tempStack.pop()); } tempStack.push(curr); } // move everything back to original stack while (!tempStack.empty()) { st.push(tempStack.pop()); }}How This WorkstempStack is maintained in sorted order (smallest on top). For each element popped from st, we move elements from tempStack back to st until we find the right position, then push. At the end, transfer everything back.Time Complexity: O(n²) — same as recursive approach Space Complexity: O(n) — explicit extra stackApproach 3: Using Collections.sort (Cheat — Not Recommended)public void sortStack(Stack<Integer> st) { List<Integer> list = new ArrayList<>(st); Collections.sort(list); // ascending st.clear(); for (int num : list) { st.push(num); // smallest pushed first = smallest at bottom }}This gives the right answer but completely defeats the purpose of the problem. Never use this in an interview — it shows you do not understand the problem's intent.Time Complexity: O(n log n) Space Complexity: O(n)Approach ComparisonApproachTimeSpaceAllowed in InterviewCode ComplexityRecursive (Two Functions)O(n²)O(n)✅ Best answerMediumIterative (Two Stacks)O(n²)O(n)✅ Good alternativeMediumCollections.sortO(n log n)O(n)❌ Defeats purposeEasyTime and Space Complexity AnalysisRecursive ApproachTime Complexity: O(n²)For each of the n elements popped by sortStack, the insert function may traverse the entire stack to find the correct position — O(n) per insert. Total: O(n) × O(n) = O(n²).This is similar to insertion sort — and in fact, this recursive approach IS essentially insertion sort implemented on a stack using recursion.Space Complexity: O(n)No extra data structure is used. But the call stack holds up to n frames for sortStack and up to n additional frames for insert. In the worst case, total recursion depth is O(n) + O(n) = O(n) space.The Connection to Insertion SortIf you have studied sorting algorithms, this solution will look very familiar. It is Insertion Sort implemented recursively on a stack:sortStack is like the outer loop — take one element at a timeinsert is like the inner loop — find the correct position by comparing and shiftingThe key difference from array-based insertion sort is that "shifting" in an array is done by moving elements right. Here, "shifting" is done by temporarily popping elements off the stack, inserting at the right depth, then pushing back. Recursion handles the "shift" naturally.Common Mistakes to AvoidWrong base case in insert The base case is st.empty() || st.peek() <= temp. Both conditions are needed. Without st.empty(), you call peek() on an empty stack and get an exception. Without st.peek() <= temp, you never stop even when you find the right position.Using < instead of <= in insert Using strictly less than means equal elements get treated as "wrong position" and cause unnecessary recursion. Using <= correctly handles duplicates — equal elements stay in their current relative order.Calling sortStack instead of insert inside insert insert should only call itself recursively. Calling sortStack inside insert re-sorts an already-sorted stack — completely wrong and causes incorrect results.Not pushing val back after the recursive insert call This is the most common bug. After insert(st, temp) places temp in the correct position, you must push val back on top. Forgetting this loses elements from the stack permanently.FAQs — People Also AskQ1. How do you sort a stack without using extra space in Java? Using recursion — the call stack itself serves as temporary storage. sortStack removes elements one by one and insert places each back in its correct sorted position. No explicit extra data structure is needed, but O(n) implicit call stack space is used.Q2. What is the time complexity of sorting a stack using recursion? O(n²) in all cases — for each of the n elements, the insert function traverses up to n elements to find the correct position. This is equivalent to insertion sort applied to a stack.Q3. Can you sort a stack without recursion? Yes — using a second auxiliary stack. Pop elements from the original stack one by one and insert each into the correct position in the second stack by temporarily moving elements back. Transfer everything back to the original stack at the end.Q4. Why does the insert function need to push val back after the recursive call? Because the goal of insert is to place temp in the correct position WITHOUT losing any existing elements. When we pop val temporarily to go deeper, we must restore it after temp has been placed. Not restoring it means permanently losing that element from the stack.Q5. Is sorting a stack asked in coding interviews? Yes, it appears frequently at companies like Amazon, Adobe, and in platforms like GeeksForGeeks and InterviewBit. It tests whether you understand recursion deeply enough to use it as a mechanism for reordering — not just for computation.Similar Problems to Practice NextDelete Middle Element of a Stack — use same recursive pop-recurse-push patternReverse a Stack — very similar recursive approach, great warmup84. Largest Rectangle in Histogram — advanced stack problem946. Validate Stack Sequences — stack simulation150. Evaluate Reverse Polish Notation — stack with operationsConclusionSort a Stack Using Recursion is a beautiful problem that demonstrates the true power of recursion — using the call stack itself as temporary storage to perform operations that would otherwise require extra data structures.The key insight is splitting the problem into two clean responsibilities. sortStack handles one job — peel elements off one by one until the base case, then trigger insert on the way back up. insert handles one job — place a single element into its correct position in an already-sorted stack by temporarily moving larger elements aside.Once you see those two responsibilities clearly, the code almost writes itself. And once this pattern clicks, it directly prepares you for more advanced recursive problems like reversing a stack, deleting the middle element, and even understanding how recursive backtracking works at a deeper level.

StackRecursionJavaGeeksForGeeksMedium
What Is Dynamic Programming? Origin Story, Real-Life Uses, LeetCode Problems & Complete Beginner Guide

What Is Dynamic Programming? Origin Story, Real-Life Uses, LeetCode Problems & Complete Beginner Guide

Introduction — Why Dynamic Programming Feels Hard (And Why It Isn't)If you've ever stared at a LeetCode problem, read the solution, understood every single line, and still had absolutely no idea how someone arrived at it — welcome. You've just experienced the classic Dynamic Programming (DP) confusion.DP has a reputation. People treat it like some dark art reserved for competitive programmers or Google engineers. The truth? Dynamic Programming is one of the most logical, learnable, and satisfying techniques in all of computer science. Once it clicks, it really clicks.This guide will take you from zero to genuinely confident. We'll cover where DP came from, how it works, what patterns to learn, how to recognize DP problems, real-world places it shows up, LeetCode problems to practice, time complexity analysis, and the mistakes that trip up even experienced developers.Let's go.The Origin Story — Who Invented Dynamic Programming and Why?The term "Dynamic Programming" was coined by Richard Bellman in the early 1950s while working at RAND Corporation. Here's the funny part: the name was deliberately chosen to sound impressive and vague.Bellman was doing mathematical research that his employer — the US Secretary of Defense, Charles Wilson — would have found difficult to fund if described accurately. Wilson had a well-known distaste for the word "research." So Bellman invented a name that sounded suitably grand and mathematical: Dynamic Programming.In his autobiography, Bellman wrote that he picked the word "dynamic" because it had a precise technical meaning and was also impossible to use negatively. "Programming" referred to the mathematical sense — planning and decision-making — not computer programming.The underlying idea? Break a complex problem into overlapping subproblems, solve each subproblem once, and store the result so you never solve it twice.Bellman's foundational contribution was the Bellman Equation, which underpins not just algorithms but also economics, operations research, and modern reinforcement learning.So the next time DP feels frustrating, remember — even its inventor named it specifically to confuse people. You're in good company.What Is Dynamic Programming? (Simple Definition)Dynamic Programming is an algorithmic technique used to solve problems by:Breaking them down into smaller overlapping subproblemsSolving each subproblem only onceStoring the result (memoization or tabulation)Building up the final solution from those stored resultsThe key insight is overlapping subproblems + optimal substructure.Overlapping subproblems means the same smaller problems come up again and again. Instead of solving them every time (like plain recursion does), DP solves them once and caches the answer.Optimal substructure means the optimal solution to the whole problem can be built from optimal solutions to its subproblems.If a problem has both these properties — it's a DP problem.The Two Approaches to Dynamic Programming1. Top-Down with Memoization (Recursive + Cache)You write a recursive solution exactly as you would naturally, but add a cache (usually a dictionary or array) to store results you've already computed.fib(n):if n in cache: return cache[n]if n <= 1: return ncache[n] = fib(n-1) + fib(n-2)return cache[n]This is called memoization — remember what you computed so you don't repeat yourself.Pros: Natural to write, mirrors the recursive thinking, easy to reason about. Cons: Stack overhead from recursion, risk of stack overflow on large inputs.2. Bottom-Up with Tabulation (Iterative)You figure out the order in which subproblems need to be solved, then solve them iteratively from the smallest up, filling a table.fib(n):dp = [0, 1]for i from 2 to n:dp[i] = dp[i-1] + dp[i-2]return dp[n]This is called tabulation — fill a table, cell by cell, bottom to top.Pros: No recursion overhead, usually faster in practice, easier to optimize space. Cons: Requires thinking about the order of computation upfront.🧩 Dynamic Programming Template CodeBefore diving into how to recognize DP problems, here are ready-to-use Java templates for every major DP pattern. Think of these as your reusable blueprints — every DP problem you ever solve will fit into one of these structures. Just define your state, plug in your recurrence relation, and you are good to go.Template 1 — Top-Down (Memoization)import java.util.HashMap;import java.util.Map;public class TopDownDP {Map<Integer, Integer> memo = new HashMap<>();public int solve(int n) {// Base caseif (n <= 1) return n;// Check cacheif (memo.containsKey(n)) return memo.get(n);// Recurrence relation — change this part for your problemint result = solve(n - 1) + solve(n - 2);// Store in cachememo.put(n, result);return result;}}Template 2 — Bottom-Up (Tabulation)public class BottomUpDP {public int solve(int n) {// Create DP tableint[] dp = new int[n + 1];// Base casesdp[0] = 0;dp[1] = 1;// Fill the table bottom-upfor (int i = 2; i <= n; i++) {// Recurrence relation — change this part for your problemdp[i] = dp[i - 1] + dp[i - 2];}return dp[n];}}Template 3 — Bottom-Up with Space Optimizationpublic class SpaceOptimizedDP {public int solve(int n) {// Only keep last two values instead of full tableint prev2 = 0;int prev1 = 1;for (int i = 2; i <= n; i++) {// Recurrence relation — change this part for your problemint curr = prev1 + prev2;prev2 = prev1;prev1 = curr;}return prev1;}}Template 4 — 2D DP (Two Sequences or Grid)public class TwoDimensionalDP {public int solve(String s1, String s2) {int m = s1.length();int n = s2.length();// Create 2D DP tableint[][] dp = new int[m + 1][n + 1];// Base cases — first row and columnfor (int i = 0; i <= m; i++) dp[i][0] = i;for (int j = 0; j <= n; j++) dp[0][j] = j;// Fill table cell by cellfor (int i = 1; i <= m; i++) {for (int j = 1; j <= n; j++) {// Recurrence relation — change this part for your problemif (s1.charAt(i - 1) == s2.charAt(j - 1)) {dp[i][j] = dp[i - 1][j - 1];} else {dp[i][j] = 1 + Math.min(dp[i - 1][j],Math.min(dp[i][j - 1], dp[i - 1][j - 1]));}}}return dp[m][n];}}Template 5 — Knapsack Patternpublic class KnapsackDP {public int solve(int[] weights, int[] values, int capacity) {int n = weights.length;// dp[i][w] = max value using first i items with capacity wint[][] dp = new int[n + 1][capacity + 1];for (int i = 1; i <= n; i++) {for (int w = 0; w <= capacity; w++) {// Don't take item idp[i][w] = dp[i - 1][w];// Take item i if it fitsif (weights[i - 1] <= w) {dp[i][w] = Math.max(dp[i][w],values[i - 1] + dp[i - 1][w - weights[i - 1]]);}}}return dp[n][capacity];}}💡 How to use these templates:Step 1 — Identify which pattern your problem fits into. Step 2 — Define what dp[i] or dp[i][j] means in plain English before writing any code. Step 3 — Write your recurrence relation on paper first. Step 4 — Plug it into the matching template above. Step 5 — Handle your specific base cases carefully.🎥 Visual Learning Resource — Watch This Before Moving ForwardIf you prefer learning by watching before reading, this free full-length course by freeCodeCamp is one of the best Dynamic Programming resources on the internet. Watch it alongside this guide for maximum understanding.Credit: freeCodeCamp — a free, nonprofit coding education platform.How to Recognize a Dynamic Programming ProblemAsk yourself these four questions:1. Can I define the problem in terms of smaller versions of itself? If you can write a recursive formula (recurrence relation), DP might apply.2. Do the subproblems overlap? If a naive recursive solution would recompute the same thing many times, DP is the right tool.3. Is there an optimal substructure? Is the best answer to the big problem made up of best answers to smaller problems?4. Are you looking for a count, minimum, maximum, or yes/no answer? DP problems often ask: "What is the minimum cost?", "How many ways?", "Can we achieve X?"Red flag words in problem statements: minimum, maximum, shortest, longest, count the number of ways, can we reach, is it possible, fewest steps.The Core DP Patterns You Must LearnMastering DP is really about recognizing patterns. Here are the most important ones:Pattern 1 — 1D DP (Linear) Problems where the state depends on previous elements in a single sequence. Examples: Fibonacci, Climbing Stairs, House Robber.Pattern 2 — 2D DP (Grid / Two-sequence) Problems with two dimensions of state, often grids or two strings. Examples: Longest Common Subsequence, Edit Distance, Unique Paths.Pattern 3 — Interval DP You consider all possible intervals or subarrays and build solutions from them. Examples: Matrix Chain Multiplication, Burst Balloons, Palindrome Partitioning.Pattern 4 — Knapsack DP (0/1 and Unbounded) You decide whether to include or exclude items under a capacity constraint. Examples: 0/1 Knapsack, Coin Change, Partition Equal Subset Sum.Pattern 5 — DP on Trees State is defined per node; you combine results from children. Examples: Diameter of Binary Tree, House Robber III, Maximum Path Sum.Pattern 6 — DP on Subsets / Bitmask DP State includes a bitmask representing which elements have been chosen. Examples: Travelling Salesman Problem, Shortest Superstring.Pattern 7 — DP on Strings Matching, editing, or counting arrangements within strings. Examples: Longest Palindromic Subsequence, Regular Expression Matching, Wildcard Matching.Top LeetCode Problems to Practice Dynamic Programming (With Links)Here are the essential problems, organized by difficulty and pattern. Solve them in this order.Beginner — Warm UpProblemPatternLinkClimbing Stairs1D DPhttps://leetcode.com/problems/climbing-stairs/Fibonacci Number1D DPhttps://leetcode.com/problems/fibonacci-number/House Robber1D DPhttps://leetcode.com/problems/house-robber/Min Cost Climbing Stairs1D DPhttps://leetcode.com/problems/min-cost-climbing-stairs/Best Time to Buy and Sell Stock1D DPhttps://leetcode.com/problems/best-time-to-buy-and-sell-stock/Intermediate — Core PatternsProblemPatternLinkCoin ChangeKnapsackhttps://leetcode.com/problems/coin-change/Longest Increasing Subsequence1D DPhttps://leetcode.com/problems/longest-increasing-subsequence/Longest Common Subsequence2D DPhttps://leetcode.com/problems/longest-common-subsequence/0/1 Knapsack (via Subset Sum)Knapsackhttps://leetcode.com/problems/partition-equal-subset-sum/Unique Paths2D Grid DPhttps://leetcode.com/problems/unique-paths/Jump Game1D DP / Greedyhttps://leetcode.com/problems/jump-game/Word BreakString DPhttps://leetcode.com/problems/word-break/Decode Ways1D DPhttps://leetcode.com/problems/decode-ways/Edit Distance2D String DPhttps://leetcode.com/problems/edit-distance/Triangle2D DPhttps://leetcode.com/problems/triangle/Advanced — Interview LevelProblemPatternLinkBurst BalloonsInterval DPhttps://leetcode.com/problems/burst-balloons/Regular Expression MatchingString DPhttps://leetcode.com/problems/regular-expression-matching/Wildcard MatchingString DPhttps://leetcode.com/problems/wildcard-matching/Palindrome Partitioning IIInterval DPhttps://leetcode.com/problems/palindrome-partitioning-ii/Maximum Profit in Job SchedulingDP + Binary Searchhttps://leetcode.com/problems/maximum-profit-in-job-scheduling/Distinct Subsequences2D DPhttps://leetcode.com/problems/distinct-subsequences/Cherry Pickup3D DPhttps://leetcode.com/problems/cherry-pickup/Real-World Use Cases of Dynamic ProgrammingDP is not just for coding interviews. It is deeply embedded in the technology you use every day.1. Google Maps & Navigation (Shortest Path) The routing engines behind GPS apps use DP-based algorithms like Dijkstra and Bellman-Ford to find the shortest or fastest path between two points across millions of nodes.2. Spell Checkers & Autocorrect (Edit Distance) When your phone corrects "teh" to "the," it is computing Edit Distance — a classic DP problem — between what you typed and every word in the dictionary.3. DNA Sequence Alignment (Bioinformatics) Researchers use the Needleman-Wunsch and Smith-Waterman algorithms — both DP — to align DNA and protein sequences and find similarities between species or identify mutations.4. Video Compression (MPEG, H.264) Modern video codecs use DP to determine the most efficient way to encode video frames, deciding which frames to store as full images and which to store as differences from the previous frame.5. Financial Portfolio Optimization Investment algorithms use DP to find the optimal allocation of assets under risk constraints — essentially a variant of the knapsack problem.6. Natural Language Processing (NLP) The Viterbi algorithm — used in speech recognition, part-of-speech tagging, and machine translation — is a DP algorithm. Every time Siri or Google Assistant understands your sentence, DP played a role.7. Game AI (Chess, Checkers) Game trees and minimax algorithms with memoization use DP to evaluate board positions and find the best move without recomputing already-seen positions.8. Compiler Optimization Compilers use DP to decide the optimal order of operations and instruction scheduling to generate the most efficient machine code.9. Text Justification (Word Processors) Microsoft Word and LaTeX use DP to optimally break paragraphs into lines — minimizing raggedness and maximizing visual appeal.10. Resource Scheduling in Cloud Computing AWS, Google Cloud, and Azure use DP-based scheduling to assign computational tasks to servers in the most cost-efficient way possible.Time Complexity Analysis of Common DP ProblemsUnderstanding the time complexity of DP is critical for interviews and for building scalable systems.ProblemTime ComplexitySpace ComplexityNotesFibonacci (naive recursion)O(2ⁿ)O(n)Exponential — terribleFibonacci (DP)O(n)O(1) with optimizationLinear — excellentLongest Common SubsequenceO(m × n)O(m × n)m, n = lengths of two stringsEdit DistanceO(m × n)O(m × n)Can optimize space to O(n)0/1 KnapsackO(n × W)O(n × W)n = items, W = capacityCoin ChangeO(n × amount)O(amount)Classic tabulationLongest Increasing SubsequenceO(n²) or O(n log n)O(n)Binary search version is fasterMatrix Chain MultiplicationO(n³)O(n²)Interval DPTravelling Salesman (bitmask)O(2ⁿ × n²)O(2ⁿ × n)Still exponential but manageable for small nThe general rule: DP trades time for space. You use memory to avoid recomputation. The time complexity equals the number of unique states multiplied by the work done per state.How to Learn and Master Dynamic Programming — Step by StepHere is an honest, structured path to mastery:Step 1 — Get recursion absolutely solid first. DP is memoized recursion at its core. If you cannot write clean recursive solutions confidently, DP will remain confusing. Practice at least 20 pure recursion problems first.Step 2 — Start with the classics. Fibonacci → Climbing Stairs → House Robber → Coin Change. These teach you the core pattern of defining state and transition without overwhelming you.Step 3 — Learn to define state explicitly. Before writing any code, ask: "What does dp[i] represent?" Write it in plain English. "dp[i] = the minimum cost to reach step i." This single habit separates good DP thinkers from struggling ones.Step 4 — Write the recurrence relation before coding. On paper or in a comment. Example: dp[i] = min(dp[i-1] + cost[i-1], dp[i-2] + cost[i-2]). If you can write the recurrence, the code writes itself.Step 5 — Master one pattern at a time. Don't jump between knapsack and interval DP in the same week. Spend a few days on each pattern until it feels intuitive.Step 6 — Solve the same problem both ways. Top-down and bottom-up. This builds deep understanding of what DP is actually doing.Step 7 — Optimize space after getting correctness. Many 2D DP solutions can use a single row instead of a full matrix. Learn this optimization after you understand the full solution.Step 8 — Do timed practice under interview conditions. Give yourself 35 minutes per problem. Review what you got wrong. DP is a muscle — it builds with reps.Common Mistakes in Dynamic Programming (And How to Avoid Them)Mistake 1 — Jumping to code before defining state. The most common DP error. Always define what dp[i] or dp[i][j] means before writing a single line of code.Mistake 2 — Wrong base cases. A single wrong base case corrupts every answer built on top of it. Trace through your base cases manually on a tiny example before running code.Mistake 3 — Off-by-one errors in indexing. Whether your dp array is 0-indexed or 1-indexed must be 100% consistent throughout. This causes more bugs in DP than almost anything else.Mistake 4 — Confusing top-down with bottom-up state order. In bottom-up DP, you must ensure that when you compute dp[i], all values it depends on are already filled. If you compute in the wrong order, you get garbage answers.Mistake 5 — Memoizing in the wrong dimension. In 2D problems, some people cache only one dimension when the state actually requires two. Always identify all variables that affect the outcome.Mistake 6 — Using global mutable state in recursion. If you use a shared array and don't clear it between test cases, you'll get wrong answers on subsequent inputs. Always scope your cache correctly.Mistake 7 — Not considering the full state space. In problems like Knapsack, forgetting that the state is (item index, remaining capacity) — not just item index — leads to fundamentally wrong solutions.Mistake 8 — Giving up after not recognizing the pattern immediately. DP problems don't announce themselves. The skill is learning to ask "is there overlapping subproblems here?" on every problem. This takes time. Don't mistake unfamiliarity for inability.Frequently Asked Questions About Dynamic ProgrammingQ: Is Dynamic Programming the same as recursion? Not exactly. Recursion is a technique for breaking problems into smaller pieces. DP is recursion plus memoization — or iterative tabulation. All DP can be written recursively, but not all recursion is DP.Q: What is the difference between DP and Divide and Conquer? Divide and Conquer (like Merge Sort) breaks problems into non-overlapping subproblems. DP is used when subproblems overlap — meaning the same subproblem is solved multiple times in a naive approach.Q: How do I know when NOT to use DP? If the subproblems don't overlap (no repeated computation), greedy or divide-and-conquer may be better. If the problem has no optimal substructure, DP won't give a correct answer.Q: Do I need to memorize DP solutions for interviews? No. You need to recognize patterns and be able to derive the recurrence relation. Memorizing solutions without understanding them will fail you in interviews. Focus on the thinking process.Q: How long does it take to get good at DP? Most people start to feel genuinely comfortable after solving 40–60 varied DP problems with deliberate practice. The first 10 feel impossible. The next 20 feel hard. After 50, patterns start feeling obvious.Q: What programming language is best for DP? Any language works. Python is often used for learning because its dictionaries make memoization trivial. C++ is preferred in competitive programming for its speed. For interviews, use whatever language you're most comfortable in.Q: What is space optimization in DP? Many DP problems only look back one or two rows to compute the current row. In those cases, you can replace an n×m table with just two arrays (or even one), reducing space complexity from O(n×m) to O(m). This is called space optimization or rolling array technique.Q: Can DP be applied to graph problems? Absolutely. Shortest path algorithms like Bellman-Ford are DP. Longest path in a DAG is DP. DP on trees is a rich subfield. Anywhere you have states and transitions, DP can potentially apply.Q: Is Greedy a type of Dynamic Programming? Greedy is related but distinct. Greedy makes locally optimal choices without reconsidering. DP considers all choices and picks the globally optimal one. Some DP solutions reduce to greedy when the structure allows, but they are different techniques.Q: What resources should I use to learn DP? For structured learning: Neetcode.io (organized problem list), Striver's DP Series on YouTube, and the book "Introduction to Algorithms" (CLRS) for theoretical depth. For practice: LeetCode's Dynamic Programming study plan and Codeforces for competitive DP.Final Thoughts — Dynamic Programming Is a SuperpowerDynamic Programming is genuinely one of the most powerful ideas in computer science. It shows up in your GPS, your autocorrect, your streaming video, your bank's risk models, and the AI assistants you talk to daily.The path to mastering it is not memorization. It is developing the habit of asking: can I break this into smaller problems that overlap? And then learning to define state clearly, write the recurrence, and trust the process.Start with Climbing Stairs. Write dp[i] in plain English before every problem. Solve everything twice — top-down and bottom-up. Do 50 problems with genuine reflection, not just accepted solutions.The click moment will come. And when it does, you'll wonder why it ever felt hard.

Dynamic ProgrammingMemoizationTabulationJavaOrigin StoryRichard Bellman
LeetCode 2784: Check if Array is Good – Java HashMap Solution Explained

LeetCode 2784: Check if Array is Good – Java HashMap Solution Explained

IntroductionLeetCode 2784 – Check if Array is Good is a beginner-friendly array and hashing problem that tests your understanding of:Frequency countingHashMap usageArray validationPermutation logicEdge case handlingAlthough the problem looks simple initially, many candidates fail because they misunderstand the exact structure of the required array.This problem is commonly asked to test:Attention to detailLogical validationCounting techniquesHashing fundamentalsProblem Link🔗 https://leetcode.com/problems/check-if-array-is-good/Problem StatementAn array is considered good if it is a permutation of:base[n] = [1, 2, 3, ..., n-1, n, n]Meaning:Numbers from:1 to n-1appear exactly once.Number:nappears exactly twice.You need to return:trueif the given array is good, otherwise:falseUnderstanding the PatternA valid good array must follow:[1, 2, 3, ..., n-1, n, n]Examples:[1,1][1,2,3,3][1,2,3,4,4]Invalid examples:[1,2,2][1,2,4,4][1,1,2,2]Key ObservationsObservation 1The maximum element determines:nObservation 2Array size must be:n + 1because:1 to n-1 => n-1 elementsn appears twice => 2 elementsTotal = n + 1Observation 3Frequency conditions:NumberFrequency1 to n-1Exactly 1nExactly 2Brute Force ApproachIdeaSort arrayCompare with expected arrayReturn resultBrute Force AlgorithmStep 1Find maximum element:nStep 2Create expected array:[1,2,3,...,n,n]Step 3Sort both arrays and compare.Brute Force ComplexityTime ComplexityO(N log N)due to sorting.Space ComplexityO(N)Optimized HashMap ApproachInstead of sorting:Count frequencies directlyValidate conditionsThis makes the solution faster and cleaner.Intuition Behind HashMap SolutionWe store frequency of every number.Then verify:Maximum element appears twiceEvery other number appears onceArray length equals:max + 1Java HashMap Solutionclass Solution { public boolean isGood(int[] nums) { if(nums.length == 1) return false; int maxElement = Integer.MIN_VALUE; HashMap<Integer, Integer> map = new HashMap<>(); for(int i = 0; i < nums.length; i++) { map.put(nums[i], map.getOrDefault(nums[i], 0) + 1); maxElement = Math.max(maxElement, nums[i]); } int n = maxElement; if(nums.length != n + 1) { return false; } for(int i = 1; i <= n; i++) { if(!map.containsKey(i)) { return false; } if(i == n) { if(map.get(i) != 2) return false; } else { if(map.get(i) != 1) return false; } } return true; }}Dry RunInputnums = [1,3,3,2]Step 1 – Find MaximumMaximum element:3So:n = 3Step 2 – Length CheckExpected length:n + 1 = 4Actual length:4Valid.Step 3 – Frequency CountFrequency map:NumberCount112132Step 4 – Validate ConditionsNumbers 1 and 2 appear once ✅Number 3 appears twice ✅Return:trueEdge CasesCase 1[1]Invalid because:base[1] = [1,1]Case 2[1,1]Valid.Case 3[1,2,2]Invalid because:n = 2Expected:[1,2,2]Actually valid.Case 4[3,4,4,1,2,1]Invalid because:length != max + 1Optimized Alternative Using SortingAnother clean solution:Sort arrayVerify:nums[i] == i + 1for all except last.Last two elements should be equal.Java Sorting Solutionclass Solution { public boolean isGood(int[] nums) { Arrays.sort(nums); int n = nums.length - 1; for(int i = 0; i < n; i++) { if(nums[i] != i + 1) return false; } return nums[n] == n; }}Time Complexity AnalysisHashMap SolutionTime ComplexityO(N)Space ComplexityO(N)Sorting SolutionTime ComplexityO(N log N)Space ComplexityO(1)excluding sorting overhead.HashMap vs SortingApproachTime ComplexitySpace ComplexityHashMapO(N)O(N)SortingO(N log N)O(1)Interview ExplanationIn interviews, explain:A good array must follow the exact pattern [1,2,3,...,n,n]. The maximum element determines n, and frequency counting helps verify whether all required numbers appear correctly.This demonstrates strong understanding of:Frequency countingValidation logicEdge case handlingCommon Mistakes1. Forgetting Length CheckAlways verify:length == max + 12. Ignoring Missing NumbersArray must contain:1 to ncompletely.3. Wrong Frequency ValidationOnly maximum element should appear twice.All others must appear once.FAQsQ1. Why does maximum element determine n?Because:base[n]always ends with:n,nQ2. Why should array size be n + 1?Because:1 to n-1 => n-1 elementsn repeated twice => 2 elementsTotal = n+1Q3. Which approach is better?HashMap solution is faster.Sorting solution is simpler.Q4. Is this problem important for interviews?Yes.It tests:HashingValidation logicEdge case thinkingRelated ProblemsAfter mastering this problem, practice:Contains DuplicateFind All Duplicates in an ArrayValid AnagramConclusionLeetCode 2784 is a great beginner-friendly hashing problem.It teaches:Frequency countingValidation logicHashMap usageEdge case handlingThe key insight is:A good array must exactly match the structure [1,2,3,...,n,n].Once you understand this pattern, the problem becomes straightforward and easy to implement.

LeetCodeJavaHashMapArrayFrequency CountEasy
LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 94 – Binary Tree Inorder Traversal is one of the most important beginner-friendly tree problems in Data Structures and Algorithms.This problem helps you understand:Binary tree traversalDepth First Search (DFS)RecursionStack-based traversalTree interview fundamentalsIt is commonly asked in coding interviews because tree traversal forms the foundation of many advanced tree problems.Problem Link🔗 ProblemLeetCode 94: Binary Tree Inorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the inorder traversal of its nodes' values.What is Inorder Traversal?In inorder traversal, we visit nodes in this order:Left → Root → RightExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Inorder TraversalStep-by-step:1 → 3 → 2Output:[1,3,2]Recursive Approach (Most Common)IntuitionIn inorder traversal:Traverse left subtreeVisit current nodeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal order:Left → Node → RightRecursive function:inorder(node.left)visit(node)inorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);list.add(root.val);solve(list, root.right);}public List<Integer> inorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Add:1Step 2Move right to:2Move left to:3Add:3Return back.Add:2Final Answer[1,3,2]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Inorder IntuitionThe recursive order is:Left → Node → RightSo iteratively:Keep pushing left nodes into stackProcess current nodeMove to right subtreeStack-Based Traversal LogicAlgorithmWhile current node exists OR stack is not empty:Push all left nodesPop top nodeAdd node valueMove to right subtreeJava Iterative Solutionclass Solution {public List<Integer> inorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();Stack<TreeNode> stack = new Stack<>();TreeNode curr = root;while(curr != null || !stack.isEmpty()) {while(curr != null) {stack.push(curr);curr = curr.left;}curr = stack.pop();ans.add(curr.val);curr = curr.right;}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Stack:[1]Step 2Pop:1Add:1Move right to:2Step 3Push:23Stack:[2,3]Step 4Pop:3Add:3Step 5Pop:2Add:2Final Answer[1,3,2]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to write and understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:In inorder traversal, we process nodes in Left → Root → Right order. Recursion naturally fits this traversal. For iterative traversal, we use a stack to simulate recursive calls.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct inorder:Left → Root → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Stack Handling ErrorsIn iterative traversal:Push all left nodes firstThen process nodeThen move rightFAQsQ1. Why is inorder traversal important?It is heavily used in:Binary Search TreesExpression treesTree reconstruction problemsQ2. What is the inorder traversal of a BST?It produces values in sorted order.Q3. Which approach is better for interviews?Recursive is easier.Iterative is preferred for deeper interview rounds.Q4. Can inorder traversal be done without stack or recursion?Yes.Using Morris Traversal with:O(1)space.Bonus: Morris Traversal (Advanced)Morris Traversal performs inorder traversal without recursion or stack.ComplexityTime ComplexityO(N)Space ComplexityO(1)This is an advanced interview optimization.ConclusionLeetCode 94 is one of the most fundamental tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key inorder pattern is:Left → Root → RightMastering this problem builds a strong foundation for advanced tree interview questions like:BST validationTree iteratorsTree reconstructionMorris traversalKth smallest in BST

LeetCodeBinary Tree Inorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 145 – Binary Tree Postorder Traversal is one of the most important tree traversal problems for beginners learning Data Structures and Algorithms.This problem teaches:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPostorder traversal is extremely useful in advanced tree problems such as:Tree deletionExpression tree evaluationBottom-up computationsDynamic programming on treesProblem Link🔗 https://leetcode.com/problems/binary-tree-postorder-traversal/Problem StatementGiven the root of a binary tree, return the postorder traversal of its nodes' values.What is Postorder Traversal?In postorder traversal, nodes are visited in this order:Left → Right → RootUnlike preorder or inorder traversal, the root node is processed at the end.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Postorder TraversalTraversal order:3 → 2 → 1Output:[3,2,1]Recursive Approach (Most Common)IntuitionIn postorder traversal:Traverse left subtreeTraverse right subtreeVisit current nodeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Left → Right → RootRecursive function:postorder(node.left)postorder(node.right)visit(node)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);solve(list, root.right);list.add(root.val);}public List<Integer> postorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Step 2Move right to:2Move left to:3Left and right of 3 are null.Add:3Step 3Return to:2Add:2Step 4Return to:1Add:1Final Answer[3,2,1]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of the treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use stacks to simulate recursion.Iterative Postorder IntuitionPostorder traversal order is:Left → Right → RootOne common trick is:Traverse in modified preorder:Root → Right → LeftReverse the result.After reversing, we get:Left → Right → Rootwhich is postorder traversal.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value to answer.Push left child.Push right child.Reverse final answer.Java Iterative Solutionclass Solution {public List<Integer> postorderTraversal(TreeNode root) {LinkedList<Integer> ans = new LinkedList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.addFirst(node.val);if(node.left != null) {stack.push(node.left);}if(node.right != null) {stack.push(node.right);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add at front:[1]Push right child:2Step 3Pop:2Add at front:[2,1]Push left child:3Step 4Pop:3Add at front:[3,2,1]Final Answer[3,2,1]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Postorder traversal processes nodes in Left → Right → Root order. Recursion naturally handles this traversal. Iteratively, we simulate recursion using a stack and reverse traversal order.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct postorder:Left → Right → Root2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Incorrect Stack Push OrderFor iterative solution:Push left firstPush right secondbecause we reverse the result later.FAQsQ1. Why is postorder traversal useful?It is used in:Tree deletionExpression tree evaluationBottom-up dynamic programmingCalculating subtree informationQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can postorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Postorder TraversalMorris traversal performs tree traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 145 is an excellent beginner-friendly tree traversal problem.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key postorder pattern is:Left → Right → RootMastering this traversal helps in solving many advanced tree problems such as:Tree DPTree deletionExpression evaluationSubtree calculationsAdvanced DFS problems

LeetCodeBinary Tree Postorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

IntroductionThe Letter Case Permutation problem is a classic example of recursion and backtracking, often asked in coding interviews and frequently searched by learners preparing for platforms like LeetCode.This problem helps in understanding:Decision-making at each stepRecursive branchingString manipulationIn this article, we’ll break down the intuition, visualize the decision process using your decision tree, and implement an efficient Java solution.🔗 Problem LinkLeetCode: Letter Case PermutationProblem StatementGiven a string s, you can transform each alphabet character into:LowercaseUppercaseDigits remain unchanged.👉 Return all possible strings formed by these transformations.ExamplesExample 1Input:s = "a1b2"Output:["a1b2","a1B2","A1b2","A1B2"]Example 2Input:s = "3z4"Output:["3z4","3Z4"]Key InsightAt each character:If it's a digit → only one choiceIf it's a letter → two choices:lowercase OR uppercaseSo total combinations:2^(number of letters)Intuition (Using Your Decision Tree)For input: "a1b2"Start from index 0: "" / \ "a" "A" | | "a1" "A1" / \ / \ "a1b" "a1B" "A1b" "A1B" | | | | "a1b2" "a1B2" "A1b2" "A1B2"Understanding the TreeAt 'a' → branch into 'a' and 'A''1' → no branching (digit)'b' → again branching'2' → no branching📌 Leaf nodes = final answersApproach: Recursion + BacktrackingIdeaTraverse the string character by characterIf digit → move forwardIf letter → branch into:lowercaseuppercaseJava Codeimport java.util.*;class Solution { // List to store all results List<String> lis = new ArrayList<>(); public void solve(String s, int ind, String ans) { // Base case: reached end of string if (ind == s.length()) { lis.add(ans); // store generated string return; } char ch = s.charAt(ind); // If character is a digit → only one option if (ch >= '0' && ch <= '9') { solve(s, ind + 1, ans + ch); } else { // Choice 1: convert to lowercase solve(s, ind + 1, ans + Character.toLowerCase(ch)); // Choice 2: convert to uppercase solve(s, ind + 1, ans + Character.toUpperCase(ch)); } } public List<String> letterCasePermutation(String s) { solve(s, 0, ""); // start recursion return lis; }}Step-by-Step ExecutionFor "a1b2":Start → ""'a' → "a", "A"'1' → "a1", "A1"'b' → "a1b", "a1B", "A1b", "A1B"'2' → final stringsComplexity AnalysisTime Complexity: O(2^n)(n = number of letters)Space Complexity: O(2^n)(for storing results)Why This Approach WorksRecursion explores all possibilitiesEach letter creates a branching pointDigits pass through unchangedBacktracking ensures all combinations are generatedKey TakeawaysThis is a binary decision recursion problemLetters → 2 choicesDigits → 1 choiceDecision tree directly maps to recursionPattern similar to:SubsetsPermutations with conditionsWhen This Problem Is AskedCommon in:Coding interviewsRecursion/backtracking roundsString manipulation problemsConclusionThe Letter Case Permutation problem is a perfect example of how recursion can be used to explore all possible combinations efficiently.Once the decision tree is clear, the implementation becomes straightforward. This pattern is widely used in many advanced problems, making it essential to master.Frequently Asked Questions (FAQs)1. Why don’t digits create branches?Because they have only one valid form.2. What is the main concept used?Recursion with decision-making (backtracking).3. Can this be solved iteratively?Yes, using BFS or iterative expansion, but recursion is more intuitive.

LeetCodeMediumJavaRecursion
Subsets Problem (LeetCode 78) Explained | Recursion, Iterative & Bit Manipulation

Subsets Problem (LeetCode 78) Explained | Recursion, Iterative & Bit Manipulation

IntroductionThe Subsets problem (LeetCode 78) is one of the most fundamental and frequently asked questions in coding interviews. It introduces the concept of generating a power set, which is a core idea in recursion, backtracking, and combinatorics.Mastering this problem helps in solving a wide range of advanced problems like combinations, permutations, and decision-based recursion.In this article, we will explore:Intuition behind subsetsRecursive (backtracking) approachIterative (loop-based) approachBit manipulation approachTime and space complexity analysisProblem StatementGiven an integer array nums of unique elements, return all possible subsets (the power set).Key PointsEach element can either be included or excludedNo duplicate subsetsReturn subsets in any orderExamplesExample 1Input:nums = [1, 2, 3]Output:[[], [1], [2], [1,2], [3], [1,3], [2,3], [1,2,3]]Example 2Input:nums = [0]Output:[[], [0]]Key InsightFor each element, there are two choices:Include it OR Exclude itSo total subsets:2^nThis makes it a binary decision tree problem, very similar to:Permutation with SpacesBinary choices recursionBacktracking problemsApproach 1: Recursion + Backtracking (Most Important)IntuitionAt each index:Skip the elementInclude the elementBuild subsets step by step and backtrack.Java Code (With Explanation)import java.util.*;class Solution { List<List<Integer>> liss = new ArrayList<>(); void solve(int[] an, int ind, List<Integer> lis) { // Base case: reached end → one subset formed if (ind == an.length) { liss.add(new ArrayList<>(lis)); // store copy return; } // Choice 1: Do NOT include current element solve(an, ind + 1, lis); // Choice 2: Include current element lis.add(an[ind]); solve(an, ind + 1, lis); // Backtrack: remove last added element lis.remove(lis.size() - 1); } public List<List<Integer>> subsets(int[] nums) { List<Integer> lis = new ArrayList<>(); solve(nums, 0, lis); return liss; }}Dry Run (nums = [1,2])Start: [] → skip 1 → [] → skip 2 → [] → take 2 → [2] → take 1 → [1] → skip 2 → [1] → take 2 → [1,2]Final Output:[], [2], [1], [1,2]Approach 2: Iterative (Loop-Based)IntuitionStart with an empty subset:[ [] ]For each element:Add it to all existing subsetsCodeimport java.util.*;class Solution { public List<List<Integer>> subsets(int[] nums) { List<List<Integer>> result = new ArrayList<>(); result.add(new ArrayList<>()); for (int num : nums) { int size = result.size(); for (int i = 0; i < size; i++) { List<Integer> temp = new ArrayList<>(result.get(i)); temp.add(num); result.add(temp); } } return result; }}How It WorksFor [1,2,3]:Start: [[]]Add 1 → [[], [1]]Add 2 → [[], [1], [2], [1,2]]Add 3 → [[], [1], [2], [1,2], [3], [1,3], [2,3], [1,2,3]]Approach 3: Bit ManipulationIntuitionEach subset can be represented using a binary number:For n = 3:000 → []001 → [1]010 → [2]011 → [1,2]...Codeimport java.util.*;class Solution { public List<List<Integer>> subsets(int[] nums) { List<List<Integer>> result = new ArrayList<>(); int n = nums.length; int total = 1 << n; // 2^n for (int i = 0; i < total; i++) { List<Integer> subset = new ArrayList<>(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { subset.add(nums[j]); } } result.add(subset); } return result; }}Complexity AnalysisApproachTime ComplexitySpace ComplexityRecursionO(2^n)O(n) stackIterativeO(2^n)O(2^n)Bit ManipulationO(2^n)O(2^n)Why All Approaches Are O(2ⁿ)Because:Total subsets = 2ⁿEach subset takes up to O(n) to constructWhen to Use Which ApproachRecursion / Backtracking → Best for interviews (easy to explain)Iterative → Clean and beginner-friendlyBit Manipulation → Best for optimization & advanced understandingKey TakeawaysSubsets = power set problemEvery element → 2 choicesThink in terms of decision treesBacktracking = build + undo (add/remove)Common Interview VariationsSubsets with duplicatesCombination sumPermutationsK-sized subsetsConclusionThe Subsets problem is a foundational DSA concept that appears across many interview questions. Understanding all approaches—especially recursion and iterative expansion—gives a strong base for solving complex backtracking problems.If you master this pattern, you unlock a whole category of problems in recursion and combinatorics.Frequently Asked Questions (FAQs)1. Why are there 2ⁿ subsets?Because each element has 2 choices: include or exclude.2. Which approach is best for interviews?Recursion + backtracking is the most preferred.3. Is bit manipulation important?Yes, it helps in optimizing and understanding binary patterns.

LeetCodeMediumJavaRecursionBacktracking
Reverse LinkedList (LeetCode 206) – The One Trick That Changes Everything

Reverse LinkedList (LeetCode 206) – The One Trick That Changes Everything

🚀 Try the ProblemPractice here:https://leetcode.com/problems/reverse-linked-list/🤔 Let’s Start With a Simple Question…What happens if you take this:1 → 2 → 3 → 4 → 5…and try to reverse it?You want:5 → 4 → 3 → 2 → 1Sounds easy, right?But here’s the catch:👉 You can only move forward in a linked list👉 There is no backward pointerSo how do we reverse something that only goes one way?🧠 The Core Problem (In Simple Words)You are given the head of a linked list.👉 Reverse the list👉 Return the new head📦 Constraints0 <= number of nodes <= 5000-5000 <= Node.val <= 5000🔍 Before Jumping to Code — Think Like ThisWhen solving this, your brain might go:Can I store values somewhere and reverse? ❌ (extra space)Can I rebuild the list? ❌ (unnecessary)Can I just change links? ✅ (YES, THIS IS THE KEY)⚡ The Breakthrough Idea👉 Instead of moving nodes👉 We reverse the direction of pointers🎯 Visual Intuition (Very Important)Let’s take:1 → 2 → 3 → 4 → nullWe want:null ← 1 ← 2 ← 3 ← 4But how?🧩 The 3-Pointer Magic TrickWe use 3 pointers:prev → stores previous nodecurr → current nodenext → stores next node🔄 Step-by-Step TransformationInitial State:prev = nullcurr = 1 → 2 → 3 → 4Step 1:Save next nodeReverse linkf = 21 → nullMove pointers:prev = 1curr = 2Step 2:f = 32 → 1Move:prev = 2curr = 3Continue…Eventually:4 → 3 → 2 → 1 → null💡 Final Insight👉 Each step reverses one link👉 At the end, prev becomes the new head✅ Clean Java Code (Iterative Approach)class Solution {public ListNode reverseList(ListNode head) {// Previous pointer starts as nullListNode prev = null;// Current pointer starts from headListNode curr = head;while (curr != null) {// Store next nodeListNode f = curr.next;// Reverse the linkcurr.next = prev;// Move prev forwardprev = curr;// Move curr forwardcurr = f;}// New head is prevreturn prev;}}⏱️ ComplexityTime ComplexityO(n)We traverse the list once.Space ComplexityO(1)No extra space used.🔁 Another Way: Recursive ApproachNow let’s think differently…👉 What if we reverse the rest of the list first, then fix the current node?🧠 Recursive IdeaFor:1 → 2 → 3 → 4We:Reverse from 2 → 3 → 4Then fix 1💻 Recursive Codeclass Solution {public ListNode reverseList(ListNode head) {// Base caseif(head == null || head.next == null)return head;// Reverse restListNode newHead = reverseList(head.next);// Fix current nodehead.next.next = head;head.next = null;return newHead;}}⚖️ Iterative vs RecursiveApproachProsConsIterativeFast, O(1) spaceSlightly tricky to understandRecursiveElegant, clean logicUses stack (O(n) space)❌ Common MistakesForgetting to store next nodeLosing reference to rest of listNot updating pointers correctlyReturning wrong node🔥 Real Interview InsightThis problem is not just about reversing a list.It teaches:👉 Pointer manipulation👉 In-place updates👉 Thinking in steps👉 Breaking problems into small operations🧠 Final ThoughtAt first, this problem feels tricky…But once you understand this line:curr.next = prev👉 Everything clicks.🚀 ConclusionThe Reverse Linked List problem is one of the most important foundational problems in DSA.Mastering it will:Boost your confidenceStrengthen pointer logicHelp in many advanced problems👉 Tip: Practice this until you can visualize pointer movement in your head — that’s when you truly master linked lists.

Linked ListPointer ManipulationIterative ApproachRecursionLeetCodeEasy
All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

IntroductionThe Power Set problem for strings is a classic question in recursion and backtracking, frequently asked in coding interviews and platforms like GeeksforGeeks.In this problem, instead of numbers, we deal with strings and generate all possible subsequences (not substrings). This makes it slightly more interesting and practical for real-world applications like pattern matching, text processing, and combinatorics.In this article, we will cover:Intuition behind subsequencesRecursive (backtracking) approachSorting for lexicographical orderAlternative approachesComplexity analysisProblem StatementGiven a string s of length n, generate all non-empty subsequences of the string.RequirementsReturn only non-empty subsequencesOutput must be in lexicographically sorted orderExamplesExample 1Input:s = "abc"Output:a ab abc ac b bc cExample 2Input:s = "aa"Output:a a aaSubsequence vs Substring (Important)Substring: Continuous charactersSubsequence: Characters can be skippedExample for "abc":Subsequences → a, b, c, ab, ac, bc, abcKey InsightFor every character, we have two choices:Include it OR Exclude itSo total subsequences:2^nWe generate all and then remove the empty string.Approach 1: Recursion (Backtracking)IntuitionAt each index:Skip the characterInclude the characterBuild all combinations recursivelyJava Code (With Explanation)import java.util.*;class Solution { // List to store all subsequences List<String> a = new ArrayList<>(); void sub(String s, int ind, String curr) { // Base case: reached end of string if (ind == s.length()) { a.add(curr); // add current subsequence return; } // Choice 1: Exclude current character sub(s, ind + 1, curr); // Choice 2: Include current character sub(s, ind + 1, curr + s.charAt(ind)); } public List<String> AllPossibleStrings(String s) { // Start recursion sub(s, 0, ""); // Remove empty string (not allowed) a.remove(""); // Sort lexicographically Collections.sort(a); return a; }}Step-by-Step Dry Run (s = "abc")Start: ""→ Exclude 'a' → "" → Exclude 'b' → "" → Exclude 'c' → "" → Include 'c' → "c" → Include 'b' → "b" → Exclude 'c' → "b" → Include 'c' → "bc"→ Include 'a' → "a" → Exclude 'b' → "a" → Exclude 'c' → "a" → Include 'c' → "ac" → Include 'b' → "ab" → Exclude 'c' → "ab" → Include 'c' → "abc"Final Output (After Sorting)a ab abc ac b bc cApproach 2: Bit ManipulationIntuitionEach subsequence can be represented using binary numbers:0 → exclude1 → includeCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); int n = s.length(); int total = 1 << n; // 2^n for (int i = 1; i < total; i++) { // start from 1 to avoid empty StringBuilder sb = new StringBuilder(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { sb.append(s.charAt(j)); } } result.add(sb.toString()); } Collections.sort(result); return result; }}Approach 3: Iterative (Expanding List)IdeaStart with empty listFor each character:Add it to all existing subsequencesCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); result.add(""); for (char ch : s.toCharArray()) { int size = result.size(); for (int i = 0; i < size; i++) { result.add(result.get(i) + ch); } } result.remove(""); Collections.sort(result); return result; }}Complexity AnalysisTime Complexity: O(n × 2ⁿ)Space Complexity: O(n × 2ⁿ)Why?Total subsequences = 2ⁿEach subsequence takes O(n) to buildWhy Sorting is RequiredThe recursion generates subsequences in random order, so we sort them:Collections.sort(result);This ensures lexicographical order as required.Key TakeawaysThis is a power set problem for stringsEach character → 2 choicesRecursion = most intuitive approachBit manipulation = most optimized thinkingAlways remove empty string if requiredCommon Interview VariationsSubsets of arrayPermutations of stringCombination sumSubsequence with conditionsConclusionThe Power Set problem is a fundamental building block in recursion and combinatorics. Once you understand the include/exclude pattern, you can solve a wide range of problems efficiently.Mastering this will significantly improve your ability to tackle backtracking and decision tree problems.Frequently Asked Questions (FAQs)1. Why is the empty string removed?Because the problem requires only non-empty subsequences.2. Why is time complexity O(n × 2ⁿ)?Because there are 2ⁿ subsequences and each takes O(n) time to construct.3. Which approach is best?Recursion → best for understandingBit manipulation → best for optimization

GeeksforGeeksRecursionJavaBacktrackingMedium
LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

IntroductionIf you are preparing for coding interviews or improving your Data Structures and Algorithms skills, LeetCode 39 Combination Sum is one of the most important backtracking problems to learn. This problem helps you understand how recursion explores multiple possibilities and how combinations are generated efficiently. It is a foundational problem that builds strong problem-solving skills and prepares you for many advanced recursion and backtracking questions.Why Should You Solve This Problem?Combination Sum is not just another coding question — it teaches you how to think recursively and break a complex problem into smaller decisions. By solving it, you learn how to manage recursive paths, avoid duplicate combinations, and build interview-level backtracking intuition. Once you understand this pattern, problems like subsets, permutations, N-Queens, and Sudoku Solver become much easier to approach.LeetCode Problem LinkProblem Name: Combination SumProblem Link: Combination SumProblem StatementGiven an array of distinct integers called candidates and a target integer target, you need to return all unique combinations where the chosen numbers sum to the target.Important rules:You can use the same number unlimited times.Only unique combinations should be returned.Order of combinations does not matter.ExampleExample 1Input:candidates = [2,3,6,7]target = 7Output:[[2,2,3],[7]]Explanation2 + 2 + 3 = 77 itself equals targetUnderstanding the Problem in Simple WordsWe are given some numbers.We need to:Pick numbers from the arrayAdd them togetherReach the target sumUse numbers multiple times if neededAvoid duplicate combinationsThis problem belongs to the Backtracking + Recursion category.Real-Life AnalogyImagine you have coins of different values.You want to make an exact payment.You can reuse coins multiple times.You need to find every possible valid coin combination.This is exactly what Combination Sum does.Intuition Behind the SolutionAt every index, we have two choices:Pick the current numberSkip the current numberSince numbers can be reused unlimited times, when we pick a number, we stay at the same index.This creates a recursion tree.We continue until:Target becomes 0 → valid answerTarget becomes negative → invalid pathArray ends → stop recursionWhy Backtracking Works HereBacktracking helps us:Explore all possible combinationsUndo previous decisionsTry another pathIt is useful whenever we need:All combinationsAll subsetsPath explorationRecursive searchingApproach 1: Backtracking Using Pick and SkipCore IdeaAt every element:Either take itOr move to next elementJava Code (Pick and Skip Method)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] candidates, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == candidates.length) {return;}if (candidates[index] <= target) {current.add(candidates[index]);solve(candidates, index, target - candidates[index], current);current.remove(current.size() - 1);}solve(candidates, index + 1, target, current);}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Approach 2: Backtracking Using Loop (Optimized)This is the cleaner and more optimized version.Your code belongs to this category.Java Code (Loop-Based Backtracking)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == arr.length) {return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Dry Run of the AlgorithmInputcandidates = [2,3,6,7]target = 7Step-by-Step ExecutionStart:solve([2,3,6,7], index=0, target=7, [])Pick 2[2]target = 5Pick 2 again:[2,2]target = 3Pick 2 again:[2,2,2]target = 1No valid choice possible.Backtrack.Try 3[2,2,3]target = 0Valid answer found.Add:[2,2,3]Try 7[7]target = 0Valid answer found.Add:[7]Final Output[[2,2,3],[7]]Recursion Tree Visualization[]/ | | \2 3 6 7/2/2/3Every branch explores a different combination.Time Complexity AnalysisTime ComplexityO(2^Target)More accurately:O(N^(Target/minValue))Where:N = Number of candidatesTarget = Required sumReason:Every number can be picked multiple times.This creates many recursive branches.Space ComplexityO(Target)Reason:Recursion stack stores elements.Maximum recursion depth depends on target.Why We Pass Same Index AgainNotice this line:solve(arr, i, target - arr[i], current);We pass i, not i+1.Why?Because we can reuse the same number unlimited times.If we used i+1, we would move forward and lose repetition.Why Duplicate Combinations Are Not CreatedWe start loop from current index.This guarantees:[2,3]and[3,2]are not both generated.Order remains controlled.Common Mistakes Beginners Make1. Using i+1 Instead of iWrong:solve(arr, i+1, target-arr[i], current)This prevents reuse.2. Forgetting Backtracking StepWrong:current.remove(current.size()-1)Without removing, recursion keeps incorrect values.3. Missing Target == 0 Base CaseThis is where valid answer is stored.Important Interview InsightCombination Sum is a foundational problem.It helps build understanding for:Combination Sum IISubsetsPermutationsN-QueensWord SearchSudoku SolverThis question is frequently asked in coding interviews.Pattern RecognitionUse Backtracking when problem says:Find all combinationsGenerate all subsetsFind all pathsUse recursionExplore possibilitiesOptimized Thinking StrategyWhenever you see:Target sumRepeated selectionMultiple combinationsThink:Backtracking + DFSEdge CasesCase 1candidates = [2]target = 1Output:[]No possible answer.Case 2candidates = [1]target = 3Output:[[1,1,1]]Interview Answer in One Line“We use backtracking to recursively try all candidate numbers while reducing the target and backtrack whenever a path becomes invalid.”Final Java Codeclass Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Key TakeawaysCombination Sum uses Backtracking.Reuse same element by passing same index.Target becomes smaller in recursion.Backtracking removes last element.Very important for interview preparation.Frequently Asked QuestionsIs Combination Sum DP or Backtracking?It is primarily solved using Backtracking.Dynamic Programming can also solve it but recursion is more common.Why is this Medium difficulty?Because:Requires recursion understandingRequires backtracking logicRequires duplicate preventionCan we sort the array?Yes.Sorting can help with pruning.ConclusionLeetCode 39 Combination Sum is one of the best problems to learn recursion and backtracking.Once you understand this pattern, many interview problems become easier.The loop-based recursive solution is clean, optimized, and interview-friendly.If you master this question, you gain strong understanding of recursive decision trees and combination generation.

LeetcodeMediumRecursionBacktrackingJava
Reverse a Stack — GFG Problem Solved (3 Approaches Explained)

Reverse a Stack — GFG Problem Solved (3 Approaches Explained)

What Is This Problem About?This is a classic stack problem from GeeksForGeeks — "Reverse a Stack" (Medium | 4 Points). You can find it on GFG by Reverse a Stack.You are given a stack. Your job is simple — reverse it. The element that was at the bottom should now be at the top, and vice versa.Example:Input: [1, 2, 3, 4] → bottom to top, so 4 is on topOutput: [1, 2, 3, 4] → after reversal, 1 is on topWait — the input and output look the same? That is because GFG displays the result top to bottom after reversal. So after reversing, 1 comes to the top, and printing top to bottom gives [1, 2, 3, 4]. The stack is indeed reversed internally.Approach 1 — Using Two Extra StacksIntuition: Pop everything from the original stack into Stack 1 — this reverses the order once. Then pop everything from Stack 1 into Stack 2 — this reverses it again, back to original order. Now push everything from Stack 2 back into the original stack. The result? The original stack is reversed.Why does this work? Two reversals cancel each other out to give you... wait, that sounds wrong. Let us trace it:Original: [1, 2, 3, 4] → top is 4After → S1: [4, 3, 2, 1] → top is 1After → S2: [1, 2, 3, 4] → top is 4Push S2 back → st: [1, 2, 3, 4] → top is 4Hmm, that brings it back to the same thing. This approach with two stacks actually does NOT work correctly — it ends up restoring the original order. This is why the approach was commented out in the original code. Good observation to catch in an interview.Lesson: Two full reversals = no change. One reversal = what we want. Keep this in mind.Approach 2 — Using an ArrayList (Clean & Simple) ✅Intuition: Pop all elements from the stack into an ArrayList. At this point, the ArrayList holds elements in reverse order (because popping reverses). Then push them back from index 0 to end. This is the clean, working solution.Stack: [1, 2, 3, 4] → top is 4Pop into ArrayList: [4, 3, 2, 1]Push back index 0→end: push 4 → st: [4] push 3 → st: [4, 3] push 2 → st: [4, 3, 2] push 1 → st: [4, 3, 2, 1] → top is now 1 ✓The stack is now reversed. 1 is on top.public static void reverseStack(Stack<Integer> st) { if (st.empty()) return; ArrayList<Integer> list = new ArrayList<>(); // Pop all elements — goes in reverse order into list while (!st.empty()) { list.add(st.pop()); } // Push back from index 0 — restores in reversed order for (int i = 0; i < list.size(); i++) { st.push(list.get(i)); }}Time Complexity: O(n) — one pass to pop, one pass to push.Space Complexity: O(n) — for the ArrayList.Why this works: When you pop all elements into a list, the top element (last inserted) goes to index 0. When you push back from index 0, that element goes in first and ends up at the bottom. The bottom element (first inserted) was popped last, sits at the end of the list, and gets pushed last — ending up on top. That is a perfect reversal.Approach 3 — Using Recursion (No Extra Space) ✅This is the most elegant approach and the one interviewers love to ask about.Intuition: Use two recursive functions:reverseStack — pops the top element, recursively reverses the rest, then inserts the popped element at the bottom.insertAtBottom — holds all elements out while inserting one element at the very bottom, then restores everything.// Insert an item at the bottom of the stackstatic void insertAtBottom(Stack<Integer> st, int item) { if (st.empty()) { st.push(item); return; } int top = st.pop(); insertAtBottom(st, item); st.push(top);}// Reverse the stackpublic static void reverseStack(Stack<Integer> st) { if (st.empty()) return; int top = st.pop(); reverseStack(st); // reverse remaining stack insertAtBottom(st, top); // put popped element at the bottom}```**Dry Run with [1, 2, 3]:**```reverseStack([1,2,3]) → pop 3, reverseStack([1,2]) reverseStack([1,2]) → pop 2, reverseStack([1]) reverseStack([1]) → pop 1, reverseStack([]) base case → return insertAtBottom([], 1) → push 1 → [1] insertAtBottom([1], 2) → 2 < 1? no → pop 1, insert 2, push 1 → [2,1]insertAtBottom([2,1], 3) → pop 1, pop 2, push 3, push 2, push 1 → [3,2,1]Final stack top → 3... wait, let us recheck display.Top is 3, which was originally at bottom. ✓ Reversed!Time Complexity: O(n²) — for each of n elements, insertAtBottom takes O(n).Space Complexity: O(n) — recursive call stack.Which Approach Should You Use?ApproachTimeSpaceSimplicityInterview ValueTwo Extra Stacks❌ Does not workO(n)SimpleLowArrayListO(n)O(n)Very EasyMediumRecursionO(n²)O(n)ModerateHighFor a coding interview, always mention the recursive approach — it shows you understand stack mechanics deeply. For production code, the ArrayList approach is cleaner and faster.Key TakeawayReversing a stack is fundamentally about understanding LIFO. Because a stack only allows access from the top, you need a systematic way to invert the order — whether that is using auxiliary storage like an ArrayList, or using the call stack itself via recursion. Both are valid. Both teach you something different about how stacks behave.The next time you see a problem that involves reversing, reordering, or inserting at the bottom of a stack — your first instinct should be recursion with insertAtBottom. It is a pattern that appears again and again in DSA.And if you want to understand Stack from Scratch?If you are just getting started with stacks or want a complete reference — I have written a detailed in-depth guide on the Stack Data Structure in Java covering everything from what a stack is, how LIFO works, all three implementations (Array, ArrayList, LinkedList), every operation explained with code, time complexity, advantages, disadvantages, real-world use cases, and six practice problems with full solutions.Check it out here → Stack Data Structure in Java: The Complete GuideIt is the perfect companion to this problem walkthrough — start there if you want the full picture, then come back here for the problem-solving side.

StackProblemsJavaMediumGeeksForGeeksReverseStack
LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

IntroductionThe Generate Parentheses problem is one of the most important and frequently asked backtracking questions in coding interviews.At first glance, it may look like a simple string generation problem—but the real challenge is to generate only valid (well-formed) parentheses combinations.This problem is a perfect example of:Constraint-based recursionBacktracking with conditionsDecision tree pruningIn this article, we’ll break down the intuition, understand the constraints, and implement a clean and efficient solution.🔗 Problem LinkLeetCode: Generate ParenthesesProblem StatementGiven n pairs of parentheses:👉 Generate all combinations of well-formed parenthesesExamplesExample 1Input:n = 3Output:["((()))","(()())","(())()","()(())","()()()"]Example 2Input:n = 1Output:["()"]Key InsightWe are not generating all possible strings—we are generating only valid parentheses.Rules of Valid ParenthesesNumber of ( must equal number of )At any point:closing brackets should never exceed opening bracketsIntuition (Decision Making)At every step, we have two choices:Add "(" OR Add ")"But we cannot always take both choices.Valid ConditionsWhen can we add "("?If open > 0When can we add ")"?If close > open👉 This ensures the string always remains valid.Decision Tree (n = 3)👉 You can add your tree diagram here for better visualization.Conceptual FlowStart: ""→ "(" → "(("→ "(((" → "((()"→ ...Invalid paths like ")(" are never explored because of constraints.Approach: Backtracking with ConstraintsIdeaKeep track of:Remaining open bracketsRemaining close bracketsBuild string step by stepOnly take valid decisionsJava Codeimport java.util.*;class Solution {// List to store all valid combinationsList<String> lis = new ArrayList<>();public void solve(int open, int close, String curr) {// Base case: no brackets leftif (open == 0 && close == 0) {lis.add(curr); // valid combinationreturn;}// Choice 1: Add opening bracket "("// Allowed only if we still have opening brackets leftif (open > 0) {solve(open - 1, close, curr + "(");}// Choice 2: Add closing bracket ")"// Allowed only if closing brackets > opening bracketsif (open < close) {solve(open, close - 1, curr + ")");}}public List<String> generateParenthesis(int n) {solve(n, n, ""); // start recursionreturn lis;}}Step-by-Step Execution (n = 2)Start: ""→ "("→ "(("→ "(())"→ "()"→ "()()"Complexity AnalysisTime Complexity: O(4ⁿ / √n) (Catalan Number)Space Complexity: O(n) recursion stackWhy Catalan Number?The number of valid parentheses combinations is:Cn = (1 / (n+1)) * (2n choose n)Why This Approach WorksIt avoids invalid combinations earlyUses constraints to prune recursion treeGenerates only valid resultsEfficient compared to brute force❌ Naive Approach (Why It Fails)Generate all combinations of ( and ):Total combinations = 2^(2n)Then filter valid ones👉 Very inefficient → TLEKey TakeawaysThis is a constraint-based recursion problemAlways:Add "(" if availableAdd ")" only if validBacktracking avoids invalid pathsImportant pattern for interviewsCommon Interview VariationsValid parentheses checkingLongest valid parenthesesRemove invalid parenthesesBalanced expressionsConclusionThe Generate Parentheses problem is a must-know backtracking problem. It teaches how to apply constraints during recursion to efficiently generate valid combinations.Once mastered, this pattern becomes extremely useful in solving many advanced recursion problems.Frequently Asked Questions (FAQs)1. Why can’t we add ")" anytime?Because it may create invalid sequences like ")(".2. What is the key trick?Ensure:close > open3. Is recursion the best approach?Yes, it is the most intuitive and efficient method.

MediumLeetCodeJavaRecursion
Merge Sort Algorithm Explained | Java Implementation, Intuition & Complexity

Merge Sort Algorithm Explained | Java Implementation, Intuition & Complexity

IntroductionSorting is one of the most fundamental operations in computer science, and Merge Sort is among the most efficient and widely used sorting algorithms.It follows the Divide and Conquer approach, making it highly scalable and predictable even for large datasets.In this article, we will cover:Intuition behind Merge SortStep-by-step breakdownMultiple approachesJava implementation with commentsTime & space complexity analysis🔗 Problem LinkGeeksforGeeks: Merge SortProblem StatementGiven an array arr[] with starting index l and ending index r, sort the array using the Merge Sort algorithm.ExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]Output:[1, 2, 3, 4, 5, 6, 7, 8, 9, 10]Key InsightMerge Sort works by:Divide → Conquer → CombineDivide the array into two halvesRecursively sort each halfMerge both sorted halvesIntuition (Visual Understanding)For:[4, 1, 3, 9, 7]Step 1: Divide[4, 1, 3] [9, 7][4, 1] [3] [9] [7][4] [1]Step 2: Merge[4] [1] → [1, 4][1, 4] [3] → [1, 3, 4][9] [7] → [7, 9]Step 3: Final Merge[1, 3, 4] + [7, 9] → [1, 3, 4, 7, 9]Approach 1: Recursive Merge Sort (Top-Down)IdeaKeep dividing until single elements remainMerge sorted subarraysJava Codeclass Solution { // Function to merge two sorted halves void merge(int[] arr, int l, int mid, int h) { // Temporary array to store merged result int[] temp = new int[h - l + 1]; int i = l; // pointer for left half int j = mid + 1; // pointer for right half int k = 0; // pointer for temp array // Compare elements from both halves while (i <= mid && j <= h) { if (arr[i] <= arr[j]) { temp[k] = arr[i]; i++; } else { temp[k] = arr[j]; j++; } k++; } // Copy remaining elements from left half while (i <= mid) { temp[k] = arr[i]; i++; k++; } // Copy remaining elements from right half while (j <= h) { temp[k] = arr[j]; j++; k++; } // Copy sorted elements back to original array for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } // Recursive merge sort function void mergeSort(int arr[], int l, int h) { // Base case: single element if (l >= h) return; int mid = l + (h - l) / 2; // Sort left half mergeSort(arr, l, mid); // Sort right half mergeSort(arr, mid + 1, h); // Merge both halves merge(arr, l, mid, h); }}Approach 2: Iterative Merge Sort (Bottom-Up)IdeaStart with subarrays of size 1Merge pairsIncrease size graduallyCodeclass Solution { void merge(int[] arr, int l, int mid, int h) { int[] temp = new int[h - l + 1]; int i = l, j = mid + 1, k = 0; while (i <= mid && j <= h) { if (arr[i] <= arr[j]) temp[k++] = arr[i++]; else temp[k++] = arr[j++]; } while (i <= mid) temp[k++] = arr[i++]; while (j <= h) temp[k++] = arr[j++]; for (int m = 0; m < temp.length; m++) { arr[l + m] = temp[m]; } } void mergeSort(int[] arr, int n) { for (int size = 1; size < n; size *= 2) { for (int l = 0; l < n - size; l += 2 * size) { int mid = l + size - 1; int h = Math.min(l + 2 * size - 1, n - 1); merge(arr, l, mid, h); } } }}Approach 3: Using Built-in Sorting (For Comparison)Arrays.sort(arr);👉 Internally uses optimized algorithms (TimSort in Java)Complexity AnalysisTime ComplexityCaseComplexityBestO(n log n)AverageO(n log n)WorstO(n log n)Space ComplexityO(n) (extra array for merging)Why Merge Sort is PowerfulStable sorting algorithmWorks efficiently on large datasetsPredictable performanceUsed in external sorting (large files)❌ Why Not Use Bubble/Selection Sort?AlgorithmTime ComplexityBubble SortO(n²)Selection SortO(n²)Merge SortO(n log n) ✅Key TakeawaysMerge Sort uses divide and conquerRecursion splits problem into smaller partsMerging is the key stepAlways O(n log n), regardless of inputWhen to Use Merge SortLarge datasetsLinked lists (very efficient)Stable sorting requiredExternal sortingConclusionMerge Sort is one of the most reliable and efficient sorting algorithms. Understanding its recursive structure and merging process is essential for mastering advanced algorithms.Once you grasp the divide-and-conquer pattern, it becomes easier to solve many complex problems.Frequently Asked Questions (FAQs)1. Is Merge Sort stable?Yes, it maintains the relative order of equal elements.2. Why is extra space required?Because we use a temporary array during merging.3. Can it be done in-place?Not efficiently; standard merge sort requires extra space.

GeekfOfGeeksMediumSortingMerge SortJava
LeetCode 104: Maximum Depth of Binary Tree – Java Recursive Solution Explained

LeetCode 104: Maximum Depth of Binary Tree – Java Recursive Solution Explained

IntroductionLeetCode 104 – Maximum Depth of Binary Tree is one of the most important beginner tree problems in Data Structures and Algorithms.This problem teaches:Binary Tree TraversalDepth First Search (DFS)RecursionTree Height CalculationDivide and ConquerIt is one of the most frequently asked tree questions in coding interviews because it builds the foundation for:Tree recursionHeight problemsBalanced tree problemsDiameter problemsDFS traversalIf you are starting binary trees, this is one of the best problems to master first.Problem Link🔗 https://leetcode.com/problems/maximum-depth-of-binary-tree/Problem StatementGiven the root of a binary tree:Return:Maximum depth of the treeMaximum depth means:Number of nodes along the longest path from root to the farthest leaf node.Example 1Inputroot = [3,9,20,null,null,15,7]Tree: 3 / \ 9 20 / \ 15 7Output3Explanation:Longest path:3 → 20 → 15contains:3 nodesExample 2Inputroot = [1,null,2]Tree:1 \ 2Output:2Understanding Maximum DepthDepth means:How many levels exist in the treeFor example: 1 / \ 2 3 / 4Levels:Level 1 → 1Level 2 → 2,3Level 3 → 4Maximum depth:3Key ObservationThe depth of a tree depends on:Maximum depth of left subtreeandMaximum depth of right subtreeSo:Depth(root)=1 + max(leftDepth, rightDepth)This is the core recursive formula.Recursive IntuitionAt every node:Find depth of left subtreeFind depth of right subtreeTake maximumAdd current nodeThis naturally becomes a recursive DFS problem.Java Recursive Solutionclass Solution { public int maxDepth(TreeNode root) { if(root == null) return 0; int left = maxDepth(root.left); int right = maxDepth(root.right); return 1 + Math.max(left, right); }}Why This WorksAt every node:Recursively calculate left depthRecursively calculate right depthChoose bigger depthAdd:1for current node.This continues until leaf nodes.Dry RunInput 3 / \ 9 20 / \ 15 7Step 1Start from root:3Step 2Left subtree:9Depth:1Step 3Right subtree:20Its children:15 and 7Depth becomes:2Step 4At root:1 + max(1,2)Result:3Recursive Call FlowmaxDepth(3) ├── maxDepth(9) │ ├── 0 │ └── 0 │ └── maxDepth(20) ├── maxDepth(15) └── maxDepth(7)Then values return upward.Alternative BFS ApproachWe can also solve this using:Level Order Traversalusing a queue.Every level increases depth by:1BFS Java Solutionclass Solution { public int maxDepth(TreeNode root) { if(root == null) return 0; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); int depth = 0; while(!queue.isEmpty()) { int size = queue.size(); for(int i = 0; i < size; i++) { TreeNode node = queue.poll(); if(node.left != null) queue.offer(node.left); if(node.right != null) queue.offer(node.right); } depth++; } return depth; }}DFS vs BFSApproachTechniqueSpaceDFSRecursionO(H)BFSQueueO(N)Time Complexity AnalysisRecursive DFS SolutionTime ComplexityO(N)because every node is visited once.Space ComplexityO(H)where:H = tree heightWorst case:O(N)for skewed tree.BFS SolutionTime ComplexityO(N)Space ComplexityO(N)queue may contain full level.Interview ExplanationIn interviews, explain:The depth of a node depends on the maximum depth between its left and right subtree. This naturally forms a recursive divide-and-conquer problem.This demonstrates:Tree recursion understandingDFS traversal knowledgeDivide and conquer thinkingCommon Mistakes1. Forgetting Base CaseAlways handle:if(root == null) return 0;2. Using Min Instead of MaxWe need:Longest pathnot shortest.3. Incorrect Depth CountingRemember to add:1for current node.FAQsQ1. What is maximum depth?It is the number of nodes in the longest root-to-leaf path.Q2. Why is recursion preferred?Tree problems naturally fit recursive structures.Q3. Can this be solved iteratively?Yes.Using BFS with queue.Q4. Is this problem important for interviews?Very important.It is one of the most fundamental tree recursion problems.Related ProblemsAfter mastering this problem, practice:Minimum Depth of Binary TreeBalanced Binary TreeDiameter of Binary TreeBinary Tree Level Order TraversalPath SumConclusionLeetCode 104 is one of the most important beginner binary tree problems.It teaches:Recursive DFSTree height calculationDivide and conquerBinary tree traversalThe key insight is:Maximum depth equals 1 + maximum depth of left and right subtree.Once this recursive pattern becomes clear, many advanced tree problems become easier to solve.

LeetCodeDepth of Binary TreeJavaBinary TreeDFSBFSRecursionTreeEasy
Quick Sort Algorithm Explained | Java Implementation, Partition Logic & Complexity

Quick Sort Algorithm Explained | Java Implementation, Partition Logic & Complexity

IntroductionQuick Sort is one of the most powerful and widely used sorting algorithms in computer science. It follows the Divide and Conquer approach and is known for its excellent average-case performance.What makes Quick Sort special is:It sorts in-place (no extra array required)It is faster in practice than many O(n log n) algorithms like Merge SortIt is heavily used in real-world systems and librariesIn this article, we’ll go deep into:Intuition behind Quick SortPartition logic (most important part)Step-by-step dry runJava implementation with commentsTime complexity analysisCommon mistakes and optimizations🔗 Problem LinkGeeksforGeeks: Quick SortProblem StatementGiven an array arr[], sort it in ascending order using Quick Sort.Requirements:Use Divide and ConquerChoose pivot elementPlace pivot in correct positionElements smaller → left sideElements greater → right sideExamplesExample 1Input:arr = [4, 1, 3, 9, 7]Output:[1, 3, 4, 7, 9]Example 2Input:arr = [2, 1, 6, 10, 4, 1, 3, 9, 7]Output:[1, 1, 2, 3, 4, 6, 7, 9, 10]Core Idea of Quick SortPick a pivot → Place it correctly → Recursively sort left & right🔥 Key Insight (Partition is Everything)Quick Sort depends entirely on partitioning:👉 After partition:Pivot is at its correct sorted positionLeft side → smaller elementsRight side → larger elementsIntuition (Visual Understanding)Consider:[4, 1, 3, 9, 7]Step 1: Choose PivotLet’s say pivot = 4Step 2: Rearrange Elements[1, 3] 4 [9, 7]Now:Left → smallerRight → largerStep 3: Apply RecursivelyLeft: [1, 3]Right: [9, 7]Final result:[1, 3, 4, 7, 9]Partition Logic (Most Important)Your implementation uses:Pivot = first elementTwo pointers:i → moves forwardj → moves backwardJava Codeclass Solution { public void quickSort(int[] arr, int low, int high) { // Base case: if array has 1 or 0 elements if (low < high) { // Partition array and get pivot index int pivotInd = partition(arr, low, high); // Sort left part quickSort(arr, low, pivotInd - 1); // Sort right part quickSort(arr, pivotInd + 1, high); } } // Function to swap two elements void swap(int[] arr, int i, int j) { int temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; } private int partition(int[] arr, int low, int high) { int pivot = arr[low]; // choosing first element as pivot int i = low + 1; // start from next element int j = high; // start from end while (i <= j) { // Move i forward until element > pivot while (i <= high && arr[i] <= pivot) { i++; } // Move j backward until element <= pivot while (j >= low && arr[j] > pivot) { j--; } // Swap if pointers haven't crossed if (i < j) { swap(arr, i, j); } } // Place pivot at correct position swap(arr, low, j); return j; // return pivot index }}Step-by-Step Dry RunInput:[4, 1, 3, 9, 7]Execution:Pivot = 4i → moves until element > 4j → moves until element ≤ 4Swaps happen → pivot placed correctlyFinal partition:[1, 3, 4, 9, 7]Complexity AnalysisTime ComplexityCaseComplexityBest CaseO(n log n)Average CaseO(n log n)Worst CaseO(n²)Why Worst Case Happens?When array is:Already sortedReverse sortedPivot always becomes smallest/largest.Space ComplexityO(log n) (recursion stack)❌ Common MistakesWrong partition logicInfinite loops in while conditionsIncorrect pivot placementNot handling duplicates properly⚡ Optimizations1. Random PivotAvoid worst-case:int pivotIndex = low + new Random().nextInt(high - low + 1);swap(arr, low, pivotIndex);2. Median of ThreeChoose better pivot:median(arr[low], arr[mid], arr[high])Quick Sort vs Merge SortFeatureQuick SortMerge Sort link to get moreSpaceO(log n)O(n)SpeedFaster (practical)StableWorst CaseO(n²)O(n log n)Why Quick Sort is PreferredCache-friendlyIn-place sortingFaster in real-world scenariosKey TakeawaysPartition is the heart of Quick SortPivot must be placed correctlyRecursion splits problem efficientlyAvoid worst case using random pivotWhen to Use Quick SortLarge arraysMemory constraints (in-place)Performance-critical applicationsConclusionQuick Sort is one of the most efficient and practical sorting algorithms. Mastering its partition logic is crucial for solving advanced problems and performing well in coding interviews.Understanding how pointers move and how pivot is placed will make this algorithm intuitive and powerful.Frequently Asked Questions (FAQs)1. Is Quick Sort stable?No, it is not stable.2. Why is Quick Sort faster than Merge Sort?Because it avoids extra space and is cache-efficient.3. What is the most important part?👉 Partition logic

MediumJavaSortingQuick SortGeeksofGeeks
Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

IntroductionThe Permutation with Spaces problem is a classic recursion question that helps build a strong understanding of decision-making and backtracking patterns.Instead of generating permutations by rearranging characters, this problem focuses on inserting spaces between characters in all possible ways.What makes this problem powerful is its decision tree structure, which you’ve already visualized perfectly. In this article, we will directly connect that intuition with code.Link of Problem: GeeksforGeeks – Permutation with SpacesProblem StatementGiven a string s, generate all possible strings by placing:Either a spaceOr no spacebetween every pair of characters.Return all results in sorted order.ExampleInput:s = "ABC"Output:A B CA BCAB CABCUnderstanding Your Decision Tree (Very Important)Two Choices at Each Step:❌ Do NOT add space before the character✔️ Add space before the characterMapping TreeFrom diagram:At B:"AB" → no space"A B" → spaceAt C:From "AB":"ABC""AB C"From "A B":"A BC""A B C"Final Output (Leaf Nodes)As shown in your diagram:ABC, AB C, A BC, A B C📌 This is exactly what recursion generates.Key InsightAt every index (except first), we have:2 choices → space OR no spaceSo total combinations:2^(n-1)Approach: Recursion + Decision MakingIdeaFix the first characterFor every next character:Add space + characterAdd character directlyContinue recursivelyJava Code with Detailed Commentsimport java.util.*;class Solution { // List to store all results ArrayList<String> lis = new ArrayList<>(); void solve(String s, int ind, String curr) { // Base case: // If index reaches end of string, // we have formed one valid permutation if (ind == s.length()) { lis.add(curr); // store the result return; } // Choice 1: Add SPACE before current character // Example: "A" → "A B" solve(s, ind + 1, curr + " " + s.charAt(ind)); // Choice 2: Do NOT add space // Example: "A" → "AB" solve(s, ind + 1, curr + s.charAt(ind)); } ArrayList<String> permutation(String s) { // Start with first character (no space before it) String curr = "" + s.charAt(0); // Start recursion from index 1 solve(s, 1, curr); // Sort results as required in problem Collections.sort(lis); return lis; }}Step-by-Step Execution (Using Your Tree)For "ABC":Start → "A"At "B":"AB""A B"At "C":"ABC", "AB C""A BC", "A B C"Exactly matches your decision tree leaf nodes ✅Complexity AnalysisTime Complexity: O(2ⁿ)Space Complexity: O(2ⁿ)Why This Approach WorksRecursion explores every possible choiceEach level = one characterEach branch = decision (space / no space)Leaf nodes = final answersKey TakeawaysThis is a binary decision recursion problemAlways identify:ChoicesBase conditionYour decision tree = direct blueprint of recursionSame pattern applies to:SubsetsBinary choices problemsConclusionThe Permutation with Spaces problem becomes extremely simple once the decision tree is understood—and your diagram already captures that perfectly.The recursion directly follows the same structure:Every branch = one decisionEvery leaf = one answerMaster this pattern, and you’ll find many recursion problems much easier to solve.

MediumGeeksforGeeksRecursionJava
LeetCode 701: Insert into a Binary Search Tree – Java Recursive Solution with Dry Run

LeetCode 701: Insert into a Binary Search Tree – Java Recursive Solution with Dry Run

IntroductionLeetCode 701 – Insert into a Binary Search Tree is one of the most important Binary Search Tree problems for coding interviews.This problem helps developers understand:BST propertiesRecursive traversalTree modificationNode insertion logicDFS recursionIt is frequently asked because BST insertion is a foundational concept used in:Search operationsTree balancingDatabase indexingOrdered data structuresProblem Link🔗 https://leetcode.com/problems/insert-into-a-binary-search-tree/Problem StatementYou are given:Root of a Binary Search TreeA value to insertReturn:Root of BST after insertionThe inserted value is guaranteed to be unique.What is a Binary Search Tree?A BST follows this rule:Left subtree values < RootRight subtree values > RootExample: 4 / \ 2 7 / \ 1 3If we insert:5It becomes: 4 / \ 2 7 / \ / 1 3 5Key ObservationWhile traversing:If value is smaller → go leftIf value is larger → go rightEventually:We reach a null positionThat is the insertion point.IntuitionBST insertion behaves exactly like BST search.We recursively move:left or rightuntil we find:nullThen create the new node there.Brute Force ThinkingA beginner might think:Store tree in arrayInsert valueSort againRebuild BSTBut rebuilding the tree is unnecessary and inefficient.BST already provides ordered traversal naturally.Optimized Recursive ApproachIdeaAt every node:If value is smaller → insert into left subtreeElse → insert into right subtreeWhen root becomes:nullcreate a new node.Java Solutionclass Solution { public void solve(TreeNode root, TreeNode prevnode, int val) { if(root == null) { if(prevnode.val < val) { prevnode.right = new TreeNode(val); } else { prevnode.left = new TreeNode(val); } return; } if(root.val > val) { solve(root.left, root, val); } else { solve(root.right, root, val); } } public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } TreeNode originalRoot = root; solve(root, root, val); return originalRoot; }}Cleaner Recursive Versionclass Solution { public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } if(val < root.val) { root.left = insertIntoBST(root.left, val); } else { root.right = insertIntoBST(root.right, val); } return root; }}Why This WorksBST property guarantees:Smaller values go leftLarger values go rightSo recursion naturally finds the correct insertion position.When recursion reaches:nullwe create the new node.Dry RunInputroot = [4,2,7,1,3]val = 5Step 1Current node:4Since:5 > 4move right.Step 2Current node:7Since:5 < 7move left.Step 3Left child is:nullInsert:5Final Tree 4 / \ 2 7 / \ / 1 3 5Time Complexity AnalysisAverage CaseTime ComplexityO(log N)Balanced BST height remains logarithmic.Space ComplexityO(log N)due to recursion stack.Worst CaseIf BST becomes skewed:1 -> 2 -> 3 -> 4Then:Time ComplexityO(N)Space ComplexityO(N)Recursive vs IterativeApproachTime ComplexitySpace ComplexityRecursiveO(H)O(H)IterativeO(H)O(1)Where:H = height of BSTIterative Java Solutionclass Solution { public TreeNode insertIntoBST(TreeNode root, int val) { if(root == null) { return new TreeNode(val); } TreeNode curr = root; while(true) { if(val < curr.val) { if(curr.left == null) { curr.left = new TreeNode(val); break; } curr = curr.left; } else { if(curr.right == null) { curr.right = new TreeNode(val); break; } curr = curr.right; } } return root; }}Interview ExplanationIn interviews, explain:Binary Search Tree insertion follows BST ordering rules. We recursively traverse left or right depending on the value until we reach a null node, where the new node is inserted.This demonstrates:BST understandingRecursive traversalTree manipulationDFS logicCommon Mistakes1. Forgetting to Return RootAlways return original root after insertion.2. Breaking BST PropertyIncorrect comparisons can violate BST ordering.Correct logic:if(val < root.val)3. Missing Base CaseWithout:if(root == null)recursion never stops.4. Rebuilding Entire TreeInsertion should modify existing BST directly.FAQsQ1. Why use recursion?BST naturally divides into smaller subtrees.Recursion simplifies traversal logic.Q2. Can insertion be iterative?Yes.Using loops avoids recursion stack usage.Q3. Why does BST insertion work efficiently?Because BST reduces search space at every step.Q4. Is this problem important for interviews?Absolutely.BST insertion is one of the most frequently asked tree concepts.ConclusionLeetCode 701 is an excellent BST problem for learning:Recursive tree traversalBST propertiesNode insertion logicDFS recursionThe core insight is:Move left for smaller values and right for larger values until a null position is found.Once this becomes intuitive, most BST operations become much easier to solve.

LeetCodeBSTBinary Search TreeJavaRecursionTreeMedium
LeetCode 110: Balanced Binary Tree – Java Optimized DFS Solution Explained

LeetCode 110: Balanced Binary Tree – Java Optimized DFS Solution Explained

IntroductionLeetCode 110 – Balanced Binary Tree is one of the most important binary tree interview problems.This problem teaches:Tree recursionHeight calculationDepth First Search (DFS)Bottom-up recursionOptimization techniquesIt is frequently asked in coding interviews because it checks whether you can:Traverse trees efficientlyAvoid repeated calculationsCombine recursion with conditionsOptimize brute force tree solutionsThis problem is also a foundation for advanced tree problems like:AVL TreesHeight-balanced treesDiameter of Binary TreeTree DP problemsProblem Link🔗 https://leetcode.com/problems/balanced-binary-tree/Problem StatementGiven the root of a binary tree:Return:trueif the tree is:height-balancedOtherwise return:falseWhat is a Balanced Binary Tree?A binary tree is balanced if:For every node,|height(left subtree) - height(right subtree)| <= 1Meaning:Left and right subtree heights should not differ by more than:1Example 1Inputroot = [3,9,20,null,null,15,7]Tree:3/ \9 20/ \15 7OutputtrueExplanation:Every node satisfies:height difference <= 1Example 2Inputroot = [1,2,2,3,3,null,null,4,4]Tree:1/ \2 2/ \3 3/ \4 4OutputfalseExplanation:Left subtree becomes much deeper than right subtree.Difference becomes greater than:1Key ObservationTo determine if tree is balanced:At every node we need:Height of left subtreeHeight of right subtreeCompare differenceThis naturally becomes a recursive DFS problem.Brute Force ApproachIntuitionFor every node:Calculate left heightCalculate right heightCompare differenceRecursively check childrenBrute Force Java Solutionclass Solution {public int height(TreeNode root) {if(root == null)return 0;return 1 + Math.max(height(root.left), height(root.right));}public boolean isBalanced(TreeNode root) {if(root == null)return true;int left = height(root.left);int right = height(root.right);if(Math.abs(left - right) > 1)return false;return isBalanced(root.left) && isBalanced(root.right);}}Problem with Brute ForceThe height function gets called repeatedly.For every node:Heights are recalculated again and again.This increases complexity significantly.Brute Force ComplexityTime ComplexityO(N²)because height calculation repeats.Space ComplexityO(H)for recursion stack.Optimized DFS ApproachInstead of:Calculating heights separatelyWe can:Calculate height and balance together.Core Optimization IdeaWhile calculating height:If subtree becomes unbalanced:Return negative value immediatelyThis avoids unnecessary computation.Optimized Java Solutionclass Solution {public int solve(TreeNode roo) {if(roo == null)return 0;int left = solve(roo.left);if(left < 0) {return -1;}int right = solve(roo.right);if(right < 0) {return -1;}if(Math.abs(left - right) > 1) {return -1000;}return 1 + Math.max(left, right);}public boolean isBalanced(TreeNode root) {int ans = solve(root);return ans < 0 ? false : true;}}Cleaner Optimized VersionWe can simplify negative returns using:-1consistently.Cleaner Java Solutionclass Solution {public int height(TreeNode root) {if(root == null)return 0;int left = height(root.left);if(left == -1)return -1;int right = height(root.right);if(right == -1)return -1;if(Math.abs(left - right) > 1)return -1;return 1 + Math.max(left, right);}public boolean isBalanced(TreeNode root) {return height(root) != -1;}}Why This WorksAt every node:Recursively calculate left heightRecursively calculate right heightIf difference > 1:Tree is unbalancedPropagate failure upward immediately.Dry RunInput1/ \2 2/ \3 3/ \4 4Step 1Start from leaf nodes:4 → height = 1Step 2Node:3gets:left = 1right = 1Difference:0Balanced.Height:2Step 3At node:2Left height:2Right height:0Difference:2Unbalanced.Return:-1Final ResultTree is:Not balancedReturn:falseTime Complexity AnalysisOptimized DFS SolutionTime ComplexityO(N)because every node is visited once.Space ComplexityO(H)where:H = height of treeWorst case:O(N)for skewed tree.Brute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(H)Optimized DFSO(N)O(H)Interview ExplanationIn interviews, explain:Instead of recalculating heights repeatedly, we combine height calculation and balance checking into a single DFS traversal.This demonstrates:Optimization skillsRecursive DFS understandingBottom-up tree processingCommon Mistakes1. Recalculating Heights RepeatedlyThis causes:O(N²)complexity.2. Forgetting Absolute DifferenceAlways use:Math.abs(left - right)3. Not Handling Null NodesBase case:if(root == null)return 0;is necessary.FAQsQ1. What is a balanced binary tree?A tree where left and right subtree heights differ by at most:1for every node.Q2. Why use DFS?Because height calculation naturally follows recursive depth traversal.Q3. Why return -1?It acts as a signal:Subtree already unbalancedQ4. Is this problem important for interviews?Very important.It is one of the most common tree optimization questions.ConclusionLeetCode 110 is an excellent binary tree optimization problem.It teaches:DFS traversalHeight calculationBottom-up recursionOptimization techniquesThe key insight is:Combine balance checking and height calculation in one DFS traversal.Once you understand this optimization pattern, many advanced tree problems become much easier.

LeetCodeBalanced Binary TreeJavaBinary TreeDFSTree HeightRecursionTree
LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 144 – Binary Tree Preorder Traversal is one of the most important beginner-friendly tree traversal problems in Data Structures and Algorithms.This problem helps you understand:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPreorder traversal is widely used in:Tree copyingSerializationExpression treesDFS-based problemsHierarchical data processingIt is also one of the most commonly asked tree problems in coding interviews.Problem Link🔗 ProblemLeetCode 144: Binary Tree Preorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the preorder traversal of its nodes' values.What is Preorder Traversal?In preorder traversal, nodes are visited in this order:Root → Left → RightThe root node is processed first before traversing subtrees.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Preorder TraversalTraversal order:1 → 2 → 3Output:[1,2,3]Recursive Approach (Most Common)IntuitionIn preorder traversal:Visit current nodeTraverse left subtreeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Root → Left → RightRecursive function:visit(node)preorder(node.left)preorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;list.add(root.val);solve(list, root.left);solve(list, root.right);}public List<Integer> preorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Add:1Move right to:2Step 2Add:2Move left to:3Step 3Add:3Final Answer[1,2,3]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Preorder IntuitionPreorder traversal order is:Root → Left → RightUsing a stack:Process current node immediatelyPush right child firstPush left child secondWhy?Because stacks follow:Last In First Out (LIFO)So left subtree gets processed first.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value.Push right child.Push left child.Repeat until stack becomes empty.Java Iterative Solutionclass Solution {public List<Integer> preorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.add(node.val);if(node.right != null) {stack.push(node.right);}if(node.left != null) {stack.push(node.left);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add:[1]Push right child:2Step 3Pop:2Add:[1,2]Push left child:3Step 4Pop:3Add:[1,2,3]Final Answer[1,2,3]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Preorder traversal processes nodes in Root → Left → Right order. Recursion naturally handles this traversal. Iteratively, we use a stack and push the right child before the left child so the left subtree gets processed first.This demonstrates strong DFS and stack understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Left → Root → RightThat is inorder traversal.Correct preorder:Root → Left → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Wrong Stack Push OrderFor iterative traversal:Push right firstPush left secondOtherwise traversal order becomes incorrect.FAQsQ1. Why is preorder traversal useful?It is heavily used in:Tree cloningSerializationDFS traversalExpression treesQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can preorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Preorder TraversalMorris traversal performs preorder traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 144 is one of the most fundamental binary tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key preorder pattern is:Root → Left → RightMastering this traversal builds a strong foundation for advanced tree problems such as:Tree serializationDFS-based problemsTree reconstructionExpression treesMorris traversal

LeetCodeBinary Tree Preorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
Left and Right Sum Differences

Left and Right Sum Differences

LeetCode 2574: Left and Right Sum Differences (Java)The Left and Right Sum Difference problem is a classic array manipulation challenge. It tests your ability to efficiently calculate prefix and suffix values—a skill essential for more advanced algorithms like "Product of Array Except Self."🔗 ResourcesProblem Link: LeetCode 2574 - Left and Right Sum Differences📝 Problem StatementYou are given a 0-indexed integer array nums. You need to return an array answer of the same length where:answer[i] = |leftSum[i] - rightSum[i]|leftSum[i] is the sum of elements to the left of index i.rightSum[i] is the sum of elements to the right of index i.💡 Approach 1: The Three-Array Method (Beginner Friendly)This approach is highly intuitive. We pre-calculate all left sums and all right sums in separate arrays before computing the final difference.The LogicPrefix Array: Fill pref[] by adding the previous element to the cumulative sum.Suffix Array: Fill suff[] by iterating backward from the end of the array.Result: Loop one last time to calculate Math.abs(pref[i] - suff[i]).Java Implementationpublic int[] leftRightDifference(int[] nums) {int n = nums.length;int[] pref = new int[n];int[] suff = new int[n];int[] ans = new int[n];// Calculate Left Sums (Prefix)for (int i = 1; i < n; i++) {pref[i] = pref[i - 1] + nums[i - 1];}// Calculate Right Sums (Suffix)for (int i = n - 2; i >= 0; i--) {suff[i] = suff[i + 1] + nums[i + 1];}// Combine resultsfor (int i = 0; i < n; i++) {ans[i] = Math.abs(pref[i] - suff[i]);}return ans;}Time Complexity: O(n)Space Complexity: O(n) (Uses extra space for pref and suff arrays).🚀 Approach 2: The Running Sum Method (Space Optimized)In technical interviews, you should aim for O(1) extra space. Instead of storing every suffix sum, we calculate the Total Sum first and derive the right sum using logic.The LogicWe use the mathematical property:Right Sum = Total Sum - Left Sum - Current ElementBy maintaining a single variable leftSum that updates as we iterate, we can calculate the result using only the output array.Java Implementationpublic int[] leftRightDifference(int[] nums) {int n = nums.length;int[] ans = new int[n];int totalSum = 0;int leftSum = 0;// 1. Get the total sum of all elementsfor (int num : nums) {totalSum += num;}// 2. Calculate rightSum and difference on the flyfor (int i = 0; i < n; i++) {int rightSum = totalSum - leftSum - nums[i];ans[i] = Math.abs(leftSum - rightSum);// Update leftSum for the next indexleftSum += nums[i];}return ans;}Time Complexity: O(n)Space Complexity: O(1) (Excluding the output array).📊 Summary ComparisonFeatureApproach 1Approach 2Space ComplexityO(n) (Higher)O(1) (Optimal)Logic TypeStorage-basedMathematicalUse CaseBeginnersInterviewsKey TakeawayWhile Approach 1 is easier to visualize, Approach 2 is more professional. It shows you can handle data efficiently without unnecessary memory allocation, which is critical when dealing with large-scale systems.

LeetCodePrefixSuffix
LeetCode 20: Valid Parentheses — Java Solution Explained

LeetCode 20: Valid Parentheses — Java Solution Explained

IntroductionLeetCode 20 Valid Parentheses is arguably the single most asked Easy problem in coding interviews. It appears at Google, Amazon, Microsoft, Meta, and virtually every company that does technical interviews. It is the textbook introduction to the Stack data structure and teaches you a pattern that shows up in compilers, code editors, HTML parsers, and mathematical expression evaluators.Here is the Link of Question -: LeetCode 20In this article we cover plain English explanation, real life analogy, the optimal stack solution with detailed dry run, all tricky edge cases, complexity analysis, common mistakes, and FAQs.What Is the Problem Really Asking?You are given a string containing only bracket characters — (, ), {, }, [, ]. You need to check if the brackets are correctly matched and nested.Three rules must hold:Every opening bracket must be closed by the same type of closing bracketBrackets must be closed in the correct order — the most recently opened must be closed firstEvery closing bracket must have a corresponding opening bracketReal Life Analogy — Russian Nesting DollsThink of Russian nesting dolls. You open the biggest doll first, then a medium one inside it, then a small one inside that. To close them back, you must close the smallest first, then medium, then biggest. You cannot close the biggest doll while the smallest is still open inside.That is exactly how brackets work. The last opened bracket must be the first one closed. This Last In First Out behavior is precisely what a Stack is built for.Another analogy — think of a text editor like VS Code. When you type (, it automatically adds ). If you try to close with ] instead, the editor highlights an error. This problem is essentially building that validation logic.The Only Approach You Need: StackThe IdeaScan the string left to rightIf you see an opening bracket → push it onto the stackIf you see a closing bracket → check the top of the stack. If the top is the matching opening bracket, pop it. Otherwise the string is invalid.At the end, if the stack is empty → all brackets matched → return true. If stack still has elements → some brackets were never closed → return false.public boolean isValid(String s) {if (s.length() == 1) return false; // single char can never be validStack<Character> st = new Stack<>();for (int i = 0; i < s.length(); i++) {char c = s.charAt(i);if (c == '(' || c == '{' || c == '[') {st.push(c); // opening bracket — push and wait for its match} else {if (!st.empty()) {// check if top of stack is the matching openerif ((c == ')' && st.peek() != '(') ||(c == '}' && st.peek() != '{') ||(c == ']' && st.peek() != '[')) {return false; // wrong type of closing bracket} else {st.pop(); // matched! remove the opener}} else {return false; // closing bracket with nothing open}}}return st.empty(); // true only if all openers were matched}Detailed Dry Run — s = "([)]"This is the trickiest example. Looks balanced at first glance but is actually invalid.( → opening, push → stack: [(][ → opening, push → stack: [(, []) → closing, peek is [, but ) needs ( → mismatch → return false ✅The stack correctly catches that [ was opened after ( but we tried to close ( before closing [ — wrong order!Dry Run — s = "([{}])"( → push → stack: [(][ → push → stack: [(, []{ → push → stack: [(, [, {]} → peek is {, match! pop → stack: [(, []] → peek is [, match! pop → stack: [(]) → peek is (, match! pop → stack: []Stack is empty → return true ✅Dry Run — s = "(["( → push → stack: [(][ → push → stack: [(, []Loop ends. Stack is NOT empty → return false ✅Two brackets were opened but never closed.All the Edge Cases You Must KnowSingle character like "(" or ")" A single character can never be valid — an opener has nothing to close it, a closer has nothing before it. The early return if (s.length() == 1) return false handles this cleanly.Only closing brackets like "))" The stack is empty when the first ) arrives → return false immediately.Only opening brackets like "(((" All get pushed, nothing gets popped, stack is not empty at end → return false.Interleaved wrong types like "([)]" Caught by the mismatch check when the closing bracket does not match the stack top.Empty string Stack stays empty → st.empty() returns true → returns true. An empty string is technically valid since there are no unmatched brackets. The constraints say length ≥ 1 so this is just good to know.A Cleaner Variation Using HashMapSome developers prefer using a HashMap to store bracket pairs, making the matching condition more readable:public boolean isValid(String s) {Stack<Character> st = new Stack<>();Map<Character, Character> map = new HashMap<>();map.put(')', '(');map.put('}', '{');map.put(']', '[');for (char c : s.toCharArray()) {if (map.containsKey(c)) {// closing bracketif (st.empty() || st.peek() != map.get(c)) {return false;}st.pop();} else {st.push(c); // opening bracket}}return st.empty();}The HashMap maps each closing bracket to its expected opening bracket. This makes adding new bracket types trivial — just add one line to the map. Great for extensibility in real world code.Both versions are O(n) time and O(n) space. Choose whichever feels more readable to you.Time Complexity: O(n) — single pass through the string Space Complexity: O(n) — stack holds at most n/2 opening bracketsWhy Stack Is the Perfect Data Structure HereThe key property this problem exploits is LIFO — Last In First Out. The most recently opened bracket must be the first one closed. That is literally the definition of a stack's behavior.Any time you see a problem where the most recently seen item determines what comes next — think Stack immediately. Valid Parentheses is the purest example of this principle.How This Fits Into the Bigger Stack PatternLooking at everything you have solved so far, notice the pattern evolution:844 Backspace String Compare — # pops the last character 1047 Remove Adjacent Duplicates — matching character pops itself 2390 Removing Stars — * pops the last character 3174 Clear Digits — digit pops the last character 20 Valid Parentheses — closing bracket pops its matching openerAll of these are stack simulations. The difference here is that instead of any character being popped, only the correct matching opener is popped. This matching condition is what makes Valid Parentheses a step up in logic from the previous problems.Common Mistakes to AvoidNot checking if stack is empty before peeking If a closing bracket arrives and the stack is empty, calling peek() throws an EmptyStackException. Always check !st.empty() before peeking or popping.Returning true without checking if stack is empty Even if the loop completes without returning false, unclosed openers remain on the stack. Always return st.empty() at the end, not just true.Pushing closing brackets onto the stack Only push opening brackets. Pushing closing brackets gives completely wrong results and is the most common beginner mistake.Not handling odd length strings If s.length() is odd, it is impossible for all brackets to be matched — you can add if (s.length() % 2 != 0) return false as an early exit for a small optimization.FAQs — People Also AskQ1. Why is a Stack used to solve Valid Parentheses? Because the problem requires LIFO matching — the most recently opened bracket must be the first one closed. Stack's Last In First Out behavior maps perfectly to this requirement, making it the natural and optimal data structure choice.Q2. What is the time complexity of LeetCode 20? O(n) time where n is the length of the string. We make a single pass through the string, and each character is pushed and popped at most once. Space complexity is O(n) in the worst case when all characters are opening brackets.Q3. Can LeetCode 20 be solved without a Stack? Technically yes for simple cases using counters, but only when dealing with a single type of bracket. With three types of brackets that can be nested, a Stack is the only clean solution. Counter-based approaches break down on cases like "([)]".Q4. Is LeetCode 20 asked in FAANG interviews? Absolutely. It is one of the most commonly asked problems across all major tech companies. It tests understanding of the Stack data structure and is often used as a warmup before harder stack problems like Largest Rectangle in Histogram or Decode String.Q5. What happens if the input string has an odd length? An odd-length string can never be valid since brackets always come in pairs. You can add if (s.length() % 2 != 0) return false as an early optimization, though the stack logic handles this correctly on its own.Similar LeetCode Problems to Practice Next1047. Remove All Adjacent Duplicates In String — Easy — stack pattern with characters394. Decode String — Medium — nested brackets with encoding678. Valid Parenthesis String — Medium — wildcards added32. Longest Valid Parentheses — Hard — longest valid substring1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets to make validConclusionLeetCode 20 Valid Parentheses is the definitive introduction to the Stack data structure in competitive programming and technical interviews. The logic is elegant — push openers, pop on matching closers, check empty at the end. Three rules, one data structure, one pass.Master this problem thoroughly, understand every edge case, and you will have a rock-solid foundation for every stack problem that follows — from Decode String to Largest Rectangle in Histogram.

StringStackEasyLeetCode
Stack Data Structure in Java: The Complete In-Depth Guide

Stack Data Structure in Java: The Complete In-Depth Guide

1. What Is a Stack?A Stack is a linear data structure that stores elements in a sequential order, but with one strict rule — you can only insert or remove elements from one end, called the top.It is one of the simplest yet most powerful data structures in computer science. Its strength comes from its constraint. Because everything happens at one end, the behavior of a stack is completely predictable.The formal definition: A Stack is a linear data structure that follows the Last In, First Out (LIFO) principle — the element inserted last is the first one to be removed.Here is what a stack looks like visually: ┌──────────┐ │ 50 │ ← TOP (last inserted, first removed) ├──────────┤ │ 40 │ ├──────────┤ │ 30 │ ├──────────┤ │ 20 │ ├──────────┤ │ 10 │ ← BOTTOM (first inserted, last removed) └──────────┘When you push 60 onto this stack, it goes on top. When you pop, 60 comes out first. That is LIFO.2. Real-World AnalogiesBefore writing a single line of code, it helps to see stacks in the real world. These analogies will make the concept permanently stick.A Pile of Plates In a cafeteria, clean plates are stacked on top of each other. You always pick the top plate. You always place a new plate on top. You never reach into the middle. This is a stack.Browser Back Button Every time you visit a new webpage, it gets pushed onto a history stack. When you press the Back button, the browser pops the most recent page off the stack and takes you there. The page you visited first is at the bottom — you only reach it after going back through everything else.Undo Feature in Text Editors When you type in a document and press Ctrl+Z, the most recent action is undone first. That is because every action you perform is pushed onto a stack. Undo simply pops from that stack.Call Stack in Programming When a function calls another function, the current function's state is pushed onto the call stack. When the inner function finishes, it is popped off and execution returns to the outer function. This is the literal stack your programs run on.A Stack of Books Put five books on a table, one on top of another. You can only take the top book without knocking the pile over. That is a stack.3. The LIFO Principle ExplainedLIFO stands for Last In, First Out.It means whatever you put in last is the first thing to come out. This is the exact opposite of a Queue (which is FIFO — First In, First Out).Let us trace through an example step by step:Start: Stack is empty → []Push 10 → [10] (10 is at the top)Push 20 → [10, 20] (20 is at the top)Push 30 → [10, 20, 30] (30 is at the top)Pop → returns 30 (30 was last in, first out) Stack: [10, 20]Pop → returns 20 Stack: [10]Peek → returns 10 (just looks, does not remove) Stack: [10]Pop → returns 10 Stack: [] (stack is now empty)Every single operation happens only at the top. The bottom of the stack is never directly accessible.4. Stack Operations & Time ComplexityA stack supports the following core operations:OperationDescriptionTime Complexitypush(x)Insert element x onto the top of the stackO(1)pop()Remove and return the top elementO(1)peek() / top()Return the top element without removing itO(1)isEmpty()Check if the stack has no elementsO(1)isFull()Check if the stack has reached its capacity (Array only)O(1)size()Return the number of elements in the stackO(1)search(x)Find position of element from top (Java built-in only)O(n)All primary stack operations — push, pop, peek, isEmpty — run in O(1) constant time. This is what makes the stack so efficient. It does not matter whether the stack has 10 elements or 10 million — these operations are always instant.Space complexity for a stack holding n elements is O(n).5. Implementation 1 — Using a Static ArrayThis is the most fundamental way to implement a stack. We use a fixed-size array and a variable called top to track where the top of the stack currently is.How it works:top starts at -1 (stack is empty)On push: increment top, then place the element at arr[top]On pop: return arr[top], then decrement topOn peek: return arr[top] without changing it// StackUsingArray.javapublic class StackUsingArray { private int[] arr; private int top; private int capacity; // Constructor — initialize with a fixed capacity public StackUsingArray(int capacity) { this.capacity = capacity; arr = new int[capacity]; top = -1; } // Push: add element to the top public void push(int value) { if (isFull()) { System.out.println("Stack Overflow! Cannot push " + value); return; } arr[++top] = value; System.out.println("Pushed: " + value); } // Pop: remove and return top element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } return arr[top--]; } // Peek: view the top element without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return arr[top]; } // Check if stack is empty public boolean isEmpty() { return top == -1; } // Check if stack is full public boolean isFull() { return top == capacity - 1; } // Return current size public int size() { return top + 1; } // Display all elements public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = top; i >= 0; i--) { System.out.print(arr[i] + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArray stack = new StackUsingArray(5); stack.push(10); stack.push(20); stack.push(30); stack.push(40); stack.push(50); stack.push(60); // This will trigger Stack Overflow stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 10Pushed: 20Pushed: 30Pushed: 40Pushed: 50Stack Overflow! Cannot push 60Stack (top → bottom): 50 40 30 20 10Peek: 50Pop: 50Pop: 40Stack (top → bottom): 30 20 10Size: 3Key Points about Array Implementation:Fixed size — you must declare capacity upfrontVery fast — direct array index accessStack Overflow is possible if capacity is exceededMemory is pre-allocated even if stack is not full6. Implementation 2 — Using an ArrayListAn ArrayList-based stack removes the fixed-size limitation. The ArrayList grows dynamically, so you never have to worry about stack overflow due to capacity.How it works:The end of the ArrayList acts as the topadd() is used for pushremove(size - 1) is used for popget(size - 1) is used for peek// StackUsingArrayList.javaimport java.util.ArrayList;public class StackUsingArrayList { private ArrayList<Integer> list; // Constructor public StackUsingArrayList() { list = new ArrayList<>(); } // Push: add to the end (which is our top) public void push(int value) { list.add(value); System.out.println("Pushed: " + value); } // Pop: remove and return the last element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int top = list.get(list.size() - 1); list.remove(list.size() - 1); return top; } // Peek: view the last element public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return list.get(list.size() - 1); } // Check if stack is empty public boolean isEmpty() { return list.isEmpty(); } // Return size public int size() { return list.size(); } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = list.size() - 1; i >= 0; i--) { System.out.print(list.get(i) + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArrayList stack = new StackUsingArrayList(); stack.push(5); stack.push(15); stack.push(25); stack.push(35); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Is Empty: " + stack.isEmpty()); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 5Pushed: 15Pushed: 25Pushed: 35Stack (top → bottom): 35 25 15 5Peek: 35Pop: 35Pop: 25Stack (top → bottom): 15 5Is Empty: falseSize: 2Key Points about ArrayList Implementation:Dynamic size — grows automatically as neededNo overflow riskSlight overhead compared to raw array due to ArrayList internalsExcellent for most practical use cases7. Implementation 3 — Using a LinkedListA LinkedList-based stack is the most memory-efficient approach when you do not know the stack size in advance. Each element (node) holds data and a pointer to the next node. The head of the LinkedList acts as the top of the stack.How it works:Each node stores a value and a reference to the node below itPush creates a new node and makes it the new headPop removes the head node and returns its valuePeek returns the head node's value without removing it// StackUsingLinkedList.javapublic class StackUsingLinkedList { // Inner Node class private static class Node { int data; Node next; Node(int data) { this.data = data; this.next = null; } } private Node top; // Head of the linked list = top of stack private int size; // Constructor public StackUsingLinkedList() { top = null; size = 0; } // Push: create new node and link it to top public void push(int value) { Node newNode = new Node(value); newNode.next = top; // new node points to current top top = newNode; // new node becomes the new top size++; System.out.println("Pushed: " + value); } // Pop: remove and return top node's data public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int value = top.data; top = top.next; // move top pointer to next node size--; return value; } // Peek: return top node's data without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return top.data; } // Check if empty public boolean isEmpty() { return top == null; } // Return size public int size() { return size; } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); Node current = top; while (current != null) { System.out.print(current.data + " "); current = current.next; } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingLinkedList stack = new StackUsingLinkedList(); stack.push(100); stack.push(200); stack.push(300); stack.push(400); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 100Pushed: 200Pushed: 300Pushed: 400Stack (top → bottom): 400 300 200 100Peek: 400Pop: 400Pop: 300Stack (top → bottom): 200 100Size: 2Key Points about LinkedList Implementation:Truly dynamic — each node allocated only when neededNo wasted memory from pre-allocationSlightly more memory per element (each node carries a pointer)Ideal for stacks where size is completely unknown8. Java's Built-in Stack ClassJava provides a ready-made Stack class inside java.util. It extends Vector and is thread-safe by default.// JavaBuiltinStack.javaimport java.util.Stack;public class JavaBuiltinStack { public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); // Push elements stack.push(10); stack.push(20); stack.push(30); stack.push(40); System.out.println("Stack: " + stack); // Peek — look at top without removing System.out.println("Peek: " + stack.peek()); // Pop — remove top System.out.println("Pop: " + stack.pop()); System.out.println("After pop: " + stack); // Search — returns 1-based position from top System.out.println("Search 20: position " + stack.search(20)); // isEmpty System.out.println("Is Empty: " + stack.isEmpty()); // Size System.out.println("Size: " + stack.size()); }}```**Output:**```Stack: [10, 20, 30, 40]Peek: 40Pop: 40After pop: [10, 20, 30]Search 20: position 2Is Empty: falseSize: 3Important Note: In modern Java development, it is often recommended to use Deque (specifically ArrayDeque) instead of Stack for better performance, since Stack is synchronized and carries the overhead of Vector.// Using ArrayDeque as a stack (modern preferred approach)import java.util.ArrayDeque;import java.util.Deque;public class ModernStack { public static void main(String[] args) { Deque<Integer> stack = new ArrayDeque<>(); stack.push(10); // pushes to front stack.push(20); stack.push(30); System.out.println("Top: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Stack: " + stack); }}9. Comparison of All ImplementationsFeatureArrayArrayListLinkedListJava StackArrayDequeSizeFixedDynamicDynamicDynamicDynamicStack Overflow RiskYesNoNoNoNoMemory UsagePre-allocatedAuto-growsPer-node overheadAuto-growsAuto-growsPush TimeO(1)O(1) amortizedO(1)O(1)O(1)Pop TimeO(1)O(1)O(1)O(1)O(1)Peek TimeO(1)O(1)O(1)O(1)O(1)Thread SafeNoNoNoYesNoBest ForKnown size, max speedGeneral useUnknown/huge sizeLegacy codeModern Java10. Advantages & DisadvantagesAdvantagesAdvantageExplanationSimple to implementVery few rules and operations to worry aboutO(1) operationsPush, pop, and peek are all constant timeMemory efficientNo extra pointers needed (array-based)Supports recursionThe call stack is itself a stackEasy undo/redoNatural fit for reversible action trackingBacktrackingPerfectly suited for maze, puzzle, and game solvingExpression evaluationPowers compilers and calculatorsDisadvantagesDisadvantageExplanationLimited accessCannot access elements in the middle directlyFixed size (array)Array-based stacks overflow if size is exceededNo random accessYou cannot do stack[2] — only top is accessibleMemory waste (array)Pre-allocated array wastes space if underusedNot suitable for all problemsMany problems need queues, trees, or graphs insteadStack overflow in recursionVery deep recursion can overflow the JVM call stack11. Real-World Use Cases of StackUnderstanding when to use a stack is just as important as knowing how to implement one. Here is where stacks show up in real software:Function Call Management (Call Stack) Every time your Java program calls a method, the JVM pushes that method's frame onto the call stack. When the method returns, the frame is popped. This is why you see "StackOverflowError" when you write infinite recursion.Undo and Redo Operations Text editors, image editors (Photoshop), and IDEs use two stacks — one for undo history and one for redo history. Every action pushes onto the undo stack. Ctrl+Z pops from it and pushes to the redo stack.Browser Navigation Your browser maintains a back-stack and a forward-stack. Visiting a new page pushes to the back-stack. Pressing Back pops from it and pushes to the forward-stack.Expression Evaluation and Conversion Compilers use stacks to evaluate arithmetic expressions and convert between infix, prefix, and postfix notations. For example: 3 + 4 * 2 must be evaluated considering operator precedence — this is done with a stack.Balanced Parentheses Checking Linters, compilers, and IDEs use stacks to check if brackets are balanced: {[()]} is valid, {[(])} is not.Backtracking Algorithms Maze solving, N-Queens, Sudoku solvers, and depth-first search all use stacks (explicitly or via recursion) to backtrack to previous states when a path fails.Syntax Parsing Compilers parse source code using stacks to match opening and closing constructs like if/else, try/catch, { and }.12. Practice Problems with Full SolutionsHere is where things get really interesting. These problems will sharpen your stack intuition and prepare you for coding interviews.Problem 1 — Reverse a String Using a StackDifficulty: EasyProblem: Write a Java program to reverse a string using a Stack.Approach: Push every character of the string onto a stack, then pop them all. Since LIFO reverses the order, the characters come out reversed.// ReverseString.javaimport java.util.Stack;public class ReverseString { public static String reverse(String str) { Stack<Character> stack = new Stack<>(); // Push all characters for (char c : str.toCharArray()) { stack.push(c); } // Pop all characters to build reversed string StringBuilder reversed = new StringBuilder(); while (!stack.isEmpty()) { reversed.append(stack.pop()); } return reversed.toString(); } public static void main(String[] args) { System.out.println(reverse("hello")); // olleh System.out.println(reverse("java")); // avaj System.out.println(reverse("racecar")); // racecar (palindrome) System.out.println(reverse("datastructure")); // erutcurtasatad }}Problem 2 — Check Balanced ParenthesesDifficulty: Easy–MediumProblem: Given a string containing (, ), {, }, [, ], determine if the brackets are balanced.Approach: Push every opening bracket onto the stack. When you see a closing bracket, check if it matches the top of the stack. If it does, pop. If it does not, the string is unbalanced.// BalancedParentheses.javaimport java.util.Stack;public class BalancedParentheses { public static boolean isBalanced(String expr) { Stack<Character> stack = new Stack<>(); for (char c : expr.toCharArray()) { // Push all opening brackets if (c == '(' || c == '{' || c == '[') { stack.push(c); } // For closing brackets, check the top of stack else if (c == ')' || c == '}' || c == ']') { if (stack.isEmpty()) return false; char top = stack.pop(); if (c == ')' && top != '(') return false; if (c == '}' && top != '{') return false; if (c == ']' && top != '[') return false; } } // Stack must be empty at the end for a balanced expression return stack.isEmpty(); } public static void main(String[] args) { System.out.println(isBalanced("{[()]}")); // true System.out.println(isBalanced("{[(])}")); // false System.out.println(isBalanced("((()))")); // true System.out.println(isBalanced("{]")); // false System.out.println(isBalanced("")); // true (empty is balanced) }}Problem 3 — Reverse a Stack (Without Extra Data Structure)Difficulty: Medium–HardProblem: Reverse all elements of a stack using only recursion — no array or extra stack allowed.Approach: This is a classic recursion problem. You need two recursive functions:insertAtBottom(stack, item) — inserts an element at the very bottom of the stackreverseStack(stack) — pops all elements, reverses, and uses insertAtBottom to rebuild// ReverseStack.javaimport java.util.Stack;public class ReverseStack { // Insert an element at the bottom of the stack public static void insertAtBottom(Stack<Integer> stack, int item) { if (stack.isEmpty()) { stack.push(item); return; } int top = stack.pop(); insertAtBottom(stack, item); stack.push(top); } // Reverse the stack using insertAtBottom public static void reverseStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); reverseStack(stack); // reverse the remaining stack insertAtBottom(stack, top); // insert popped element at bottom } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(1); stack.push(2); stack.push(3); stack.push(4); stack.push(5); System.out.println("Before: " + stack); // [1, 2, 3, 4, 5] reverseStack(stack); System.out.println("After: " + stack); // [5, 4, 3, 2, 1] }}Problem 4 — Evaluate a Postfix ExpressionDifficulty: MediumProblem: Evaluate a postfix (Reverse Polish Notation) expression. Example: "2 3 4 * +" should return 14 because it is 2 + (3 * 4).Approach: Scan left to right. If you see a number, push it. If you see an operator, pop two numbers, apply the operator, and push the result.// PostfixEvaluation.javaimport java.util.Stack;public class PostfixEvaluation { public static int evaluate(String expression) { Stack<Integer> stack = new Stack<>(); String[] tokens = expression.split(" "); for (String token : tokens) { // If it's a number, push it if (token.matches("-?\\d+")) { stack.push(Integer.parseInt(token)); } // If it's an operator, pop two and apply else { int b = stack.pop(); // second operand int a = stack.pop(); // first operand switch (token) { case "+": stack.push(a + b); break; case "-": stack.push(a - b); break; case "*": stack.push(a * b); break; case "/": stack.push(a / b); break; } } } return stack.pop(); } public static void main(String[] args) { System.out.println(evaluate("2 3 4 * +")); // 14 → 2 + (3*4) System.out.println(evaluate("5 1 2 + 4 * + 3 -")); // 14 → 5+((1+2)*4)-3 System.out.println(evaluate("3 4 +")); // 7 }}Problem 5 — Next Greater ElementDifficulty: MediumProblem: For each element in an array, find the next greater element to its right. If none exists, output -1.Example: Input: [4, 5, 2, 10, 8] → Output: [5, 10, 10, -1, -1]Approach: Iterate right to left. Maintain a stack of candidates. For each element, pop all stack elements that are smaller than or equal to it — they can never be the answer for any element to the left. The top of the stack (if not empty) is the next greater element.// NextGreaterElement.javaimport java.util.Stack;import java.util.Arrays;public class NextGreaterElement { public static int[] nextGreater(int[] arr) { int n = arr.length; int[] result = new int[n]; Stack<Integer> stack = new Stack<>(); // stores elements, not indices // Traverse from right to left for (int i = n - 1; i >= 0; i--) { // Pop elements smaller than or equal to current while (!stack.isEmpty() && stack.peek() <= arr[i]) { stack.pop(); } // Next greater element result[i] = stack.isEmpty() ? -1 : stack.peek(); // Push current element for future comparisons stack.push(arr[i]); } return result; } public static void main(String[] args) { int[] arr1 = {4, 5, 2, 10, 8}; System.out.println(Arrays.toString(nextGreater(arr1))); // [5, 10, 10, -1, -1] int[] arr2 = {1, 3, 2, 4}; System.out.println(Arrays.toString(nextGreater(arr2))); // [3, 4, 4, -1] int[] arr3 = {5, 4, 3, 2, 1}; System.out.println(Arrays.toString(nextGreater(arr3))); // [-1, -1, -1, -1, -1] }}Problem 6 — Sort a Stack Using RecursionDifficulty: HardProblem: Sort a stack in ascending order (smallest on top) using only recursion — no loops, no extra data structure.// SortStack.javaimport java.util.Stack;public class SortStack { // Insert element in correct sorted position public static void sortedInsert(Stack<Integer> stack, int item) { if (stack.isEmpty() || item > stack.peek()) { stack.push(item); return; } int top = stack.pop(); sortedInsert(stack, item); stack.push(top); } // Sort the stack public static void sortStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); sortStack(stack); // sort remaining sortedInsert(stack, top); // insert top in sorted position } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(34); stack.push(3); stack.push(31); stack.push(98); stack.push(92); stack.push(23); System.out.println("Before sort: " + stack); sortStack(stack); System.out.println("After sort: " + stack); // smallest on top }}13. Summary & Key TakeawaysA stack is a simple, elegant, and powerful data structure. Here is everything in one place:What it is: A linear data structure that follows LIFO — Last In, First Out.Core operations: push (add to top), pop (remove from top), peek (view top), isEmpty — all in O(1) time.Three ways to implement it in Java:Array-based: fast, fixed size, risk of overflowArrayList-based: dynamic, easy, slightly more overheadLinkedList-based: truly dynamic, memory-efficient per-element, best for unknown sizesWhen to use it:Undo/redo systemsBrowser navigationBalancing brackets and parenthesesEvaluating mathematical expressionsBacktracking problemsManaging recursive function callsDepth-first searchWhen NOT to use it:When you need random access to elementsWhen insertion/deletion is needed from both ends (use Deque)When you need to search efficiently (use HashMap or BST)Modern Java recommendation: Prefer ArrayDeque over the legacy Stack class for non-thread-safe scenarios. Use Stack only when you need synchronized access.The stack is one of those data structures that once you truly understand, you start seeing it everywhere — in your browser, in your IDE, in recursive algorithms, and deep within the operating system itself.This article covered everything from the fundamentals of the Stack data structure to multiple Java implementations, time complexity analysis, real-world applications, and six practice problems of increasing difficulty. Bookmark it as a reference and revisit the practice problems regularly — they are the real test of your understanding.

DataStructuresJavaStackDataStructureLIFO
Floor in a Sorted Array – Binary Search Explained with Story & Visuals | GeeksforGeeks

Floor in a Sorted Array – Binary Search Explained with Story & Visuals | GeeksforGeeks

Problem StatementPlatform: GeeksforGeeksYou are given a sorted array arr[] and an integer x. Your task is to find the index of the largest element in the array that is less than or equal to x.Return -1 if no such element exists.If multiple elements equal the floor, return the last occurrence.Example:Input: arr = [1, 2, 8, 10, 10, 12, 19], x = 11Output: 4✅ The largest element ≤ 11 is 10. The last occurrence is at index 4.👉 Try this problem here: GeeksforGeeks – Floor in a Sorted ArrayIntuition: What is “Floor” and Why It MattersImagine climbing stairs:You want to step as high as possible without going past a certain height.That step is your floor – the largest number ≤ x.In arrays:The floor of x is the largest number smaller than or equal to x.Because the array is sorted, we can search efficiently with binary search instead of checking every element.This is faster and helps you handle large arrays with millions of elements.Multiple Approaches1️⃣ Linear Search (Easy but Slow)Check each element from left to right. If it’s ≤ x, update the answer.int ans = -1;for(int i = 0; i < arr.length; i++){if(arr[i] <= x){ans = i; // store last occurrence}}return ans;Time Complexity: O(n) – slow for large arraysSpace Complexity: O(1) – constant memory2️⃣ Binary Search (Fast & Efficient)Binary search cuts the search space in half at every step.int ans = -1;int low = 0, high = arr.length - 1;while(low <= high){int mid = low + (high - low)/2;if(arr[mid] == x){ans = mid; // candidate floorlow = mid + 1; // move right for last occurrence} else if(arr[mid] < x){ans = mid; // candidate floorlow = mid + 1;} else {high = mid - 1; // too large, move left}}return ans;Time Complexity: O(log n) – very fastSpace Complexity: O(1) – no extra spaceDry Run / Step-by-StepInput: arr = [1, 2, 8, 10, 10, 12, 19], x = 11Steplowhighmidarr[mid]ansAction1063103arr[mid] < x → move right2465123arr[mid] > x → move left3444104arr[mid] < x → move right454--4low > high → stop, return 4✅ Finds floor = 10 at index 4.Code Explanation in Simple Wordsans = -1 → stores best candidate for floor.Use low and high as binary search boundaries.mid = low + (high - low)/2 → safe midpoint.If arr[mid] <= x, it can be the floor → move right to find last occurrence.If arr[mid] > x, move left → floor is smaller.Loop ends when low > high, return ans.Edge Cases to Rememberx < arr[0] → return -1 (floor doesn’t exist)x ≥ arr[n-1] → return last index (floor is last element)Duplicates → always return last occurrenceStory-Based Visual Example: “Alice’s Book Shelf Adventure” 📚Scenario:Alice is a librarian.Books are arranged by height on a shelf.She has a new book and wants to place it next to the tallest book shorter than or equal to hers.Instead of checking each book, she uses a binary search approach to find the position quickly."Alice is scanning the bookshelf, which represents a sorted array: [1, 2, 8, 10, 10, 12, 19]. She is thinking where to place her new book labeled 11. This step represents the initial step of the floor algorithm, understanding the array elements.""Alice places the book labeled 11 right after the last 10 on the shelf. This demonstrates finding the floor: the largest number ≤ 11 is 10, and the book is positioned next to it, illustrating the last occurrence logic.""From a top view, Alice is scanning all the books. This shows how binary search would conceptually divide the array: she quickly decides which section the book 11 belongs to without checking every book, demonstrating efficient search.""Alice has successfully placed the book 11 at the correct position. The floor of 11 is 10 (index 4). This visual confirms the algorithm’s result: the new element is positioned immediately after the last element ≤ x, exactly as binary search would determine."Why This Problem is ImportantStrengthens binary search skillsTeaches last occurrence / boundary conditions handlingMakes you think algorithmically, not just about numbersStory-based learning improves retention and understandingConclusionLinear search: easy but slow (O(n))Binary search: fast, elegant (O(log n))Multiple dry run steps make it easy to followStory-based images make abstract concepts concrete and memorable

GeeksforGeeksBinary SearchEasy
Maximum Subarray

Maximum Subarray

LeetCode Problem 53Link of the Problem to try -: LinkGiven an integer array nums, find the subarray with the largest sum, and return its sum.Example 1:Input: nums = [-2,1,-3,4,-1,2,1,-5,4]Output: 6Explanation: The subarray [4,-1,2,1] has the largest sum 6.Example 2:Input: nums = [1]Output: 1Explanation: The subarray [1] has the largest sum 1.Example 3:Input: nums = [5,4,-1,7,8]Output: 23Explanation: The subarray [5,4,-1,7,8] has the largest sum 23.Constraints:1 <= nums.length <= 105-104 <= nums[i] <= 104Follow up: If you have figured out the O(n) solution, try coding another solution using the divide and conquer approach, which is more subtle.My Approach -: I successfully addressed this problem by implementing nested loops to generate the required subarrays. My approach effectively handles the subarray creation logic as specified. Please find the implementation code below.int ans=0;for(int i=0;i<nums.length;i++){int sum =0;for(int j =i;j<nums.length;j++){sum += nums[j];ans = Math.max(sum,ans);}}return ans;Although this solution passed local tests, it encountered a 'Time Limit Exceeded' (TLE) error on LeetCode due to the constraints of the problem. While the nested loop approach is logically sound, further optimization is required to improve its time complexity for larger test cases.Optimized Algorithm (Kadane's Algorithm)This algorithm is highly efficient, solving the problem in a single pass with a time complexity of O(n), not O(1) constant time, as the algorithm must iterate through all n elements of the input array.The core principle is based on the idea that any negative prefix sum acts as a 'debt' that subsequent positive numbers must overcome. The strategy is to always pursue the maximum sum. If the running sum becomes negative at any point, it is reset to zero, effectively 'discarding' the previous negative sequence, and the search for a new maximum sum begins with the next element.Here is a video for more better understandingMy Understanding Steps to solve this QuestionTo solve this problem efficiently in (O(n)) time, I implemented the following steps:Initialization: Define two integer variables: currentSum (initialized to 0) and maxSum (initialized to Integer.MIN_VALUE). currentSum tracks the running total, while maxSum stores the overall maximum subarray sum found so far.Iteration: Traverse the array using a single for loop.Update Running Sum: At each element, add its value to currentSum.Update Maximum: Compare currentSum with maxSum. If currentSum is greater, update maxSum with this new value.Reset Negative Sums: If currentSum drops below zero, reset it to 0. This effectively "discards" a negative prefix that would otherwise reduce the sum of subsequent subarrays.Return Result: After the loop completes, return maxSum as the final result.Here is the Code:int sum = 0;int max = Integer.MIN_VALUE;for(int i=0;i <nums.length;i++){sum +=nums[i];max =Math.max(sum,max);if(sum < 0){sum =0;}}return max;(Note this same solution can also write in another way as well)Here is another way to write this same solution:int sum = 0;int max = Integer.MIN_VALUE;for(int i=0;i <nums.length;i++){// sum +=nums[i];sum = Math.max(sum+nums[i],nums[i]); // Here we are ensuring that sum will alwaays be grestest in all time so that it will not be negative or smaller ass previously we directly putting value in it.max =Math.max(sum,max);// if(sum < 0){ We don't need this as we already ensure that sum will never be negative and always a positive number// sum =0;// }}return max;

LeetCodeArrayMedium
My 2025 Year Rewind: Krishna Shrivastava

My 2025 Year Rewind: Krishna Shrivastava

My 2025 Builder Rewind: From Overthinking to Getting it Done2025 wasn't the year where everything suddenly worked out for me.No big announcements. No viral launches.But this was the year I stopped staying in perpetual learning mode and started building real things.Instead of waiting to be "ready," I shipped projects. Some were small, some were complex, and some broke more times than I expected — but every one of them taught me something real about what it actually takes to build software that works beyond localhost.Here's a rewind of what I built this year and why each one mattered.Brillicode — Online Code IDE & CompilerTry Brillicode →Brillicode is a browser-based code editor where you can write and compile code in multiple programming languages without setting up anything locally.I built this because environment setup is still one of the biggest blockers for beginners — and even experienced devs sometimes just want to test an idea quickly without spinning up Docker containers or installing dependencies.What this project taught me:Running untrusted user code is risky and complex. Sandboxing, resource limits, and security aren't nice-to-haves — they're critical from day one. One infinite loop could crash the entire server if not properly isolated.Edge cases are not actually edge cases. Syntax errors, empty inputs, massive files, concurrent requests — these happen constantly in production and need proper handling.This was my first real push beyond frontend thinking into building systems that need to handle unpredictable user behavior reliably.Mokai — Online Mock Test PlatformTake a Mock Test →Mokai is an online mock test platform where users can take role-based mock tests, track their test history over time, and compete using a leaderboard system.This wasn't just about creating another quiz app. I deliberately focused on things that are usually ignored in side projects but critical in production systems:Security — Never trusting client-side data blindly. Validation happens on the server, answers are verified server-side, and timing is controlled backend-first.Caching — Implementing smart caching strategies to reduce database load and improve response times without serving stale data.Fair and consistent test evaluation — Ensuring the scoring system works identically for all users regardless of network conditions or device performance.This project made one thing crystal clear to me: "It works on my machine" is not the same as "it works correctly for real users."Working on Mokai taught me about database optimization, proper API design, AI integration and why authentication/authorization patterns exist the way they do.Krido Studio — Code Writing Video GeneratorGenerate Your Video →Krido Studio turns plain code into professional code-writing videos:Paste your codeGenerate smooth typing animationAdd voice-over and customize timingExport and post directly to YouTube or social mediaI built this because creating coding content is harder than it should be. Screen recording, editing, syncing audio, re-recording when you make typos — it's all slow, manual, and exhausting.What made Krido challenging:Animation timing — Making the typing speed feel natural, not robotic. Too fast feels fake, too slow loses viewer attention.UX details that break easily if done wrong — Things like preview accuracy, progress indicators, and error messages when generation fails.A cool idea on paper, but way harder in execution — and that's exactly why it was worth building. Krido Studio attracted 100+ visitors organically and taught me that solving real creator pain points matters more than technical complexity.My First Mobile App — Calculator (React Native + Expo)Download APK → | GitHub →This was a simple calculator app built using React Native with Expo, packaged into a real APK and installed on actual Android devices.I didn't build this to innovate or disrupt the calculator market.I built it to understand mobile app development — from writing React Native code to generating a working APK that real people can download and use.What I learned:Mobile apps have their own constraints. Touch targets, screen sizes, keyboard behavior, app lifecycle — everything behaves differently from the web.Packaging and builds are real challenges. Gradle errors, dependency conflicts, signing certificates — the "boring" DevOps side of mobile is where beginners get stuck.Cross-platform doesn't mean zero platform knowledge. You still need to understand Android/iOS differences, even when using React Native.This project removed my hesitation around mobile development completely. Now I know that shipping mobile apps is very achievable, not some mystical separate skill tree.Karos — My First Published NPM PackageInstall: npm install karos → | GitHub → | BlogKaros is a Node.js utility package that standardizes API responses and error handling for Express applications.I built it because every backend project ends up doing the same thing manually:Different JSON response formats across routesInconsistent HTTP status codesMessy error handling with try-catch everywhereNo predictable structure for frontend developersInstead of rewriting the same wrapper functions again and again, I packaged it into a reusable library with TypeScript support and clean documentation.What publishing Karos taught me:Small, boring tools can still be valuable. Not every package needs to be a framework. Solving one specific pain point well is enough.Documentation matters more than clever code. If other developers can't understand how to use it in 2 minutes, they'll just write their own version.Shipping something is more important than perfect design. I can always publish v2 with improvements. Version 1 just needs to work and solve the core problem.Publishing Karos was a huge personal milestone — it's one thing to write code for yourself, another to write code that others trust enough to install in their projects.What This Year Actually ChangedThis year didn't make me an expert.But it did something more important.It forced me to:Stop hiding behind tutorials and actually finish what I startThink in terms of systems, not just features — considering failure modes, scale, and maintainabilityAccept that breaking things is part of building things — bugs aren't failures, they're feedbackShip imperfect products instead of perfect plans that never launchMost of what I built won't go viral — and that's completely okay.What matters is that I now understand how real projects behave in the real world: how users break assumptions, how systems fail under load, and how to recover gracefully when things go wrong.On to 2026Next year isn't about building more projects just to build them.It's about:Taking existing projects deeper (scaling Krido, improving Mokai's backend architecture)Contributing to open source beyond my own packagesWriting more technical content sharing what I've learnedFocusing on fewer things, but executing them at a higher levelIf you've been stuck in tutorial hell or afraid to ship something "not good enough yet" — this is your sign.Pick one idea. Scope it down brutally. Build it. Ship it. Learn from it.The version you release today will always teach you more than the perfect version that never leaves your localhost.Happy New Year 🎉Connect with me:📝 Read more on my blog: KodeSword💻 GitHub:Github Krishna Shrivastava🔗 LinkedIn: LinkedIn Krishna Shrivastava📦 NPM: NPM Pakcage KAROS📩 Contact me: Reach Out Me

YearInReview2025Rewind
Max Consecutive Ones III – Sliding Window with Limited Flips

Max Consecutive Ones III – Sliding Window with Limited Flips

IntroductionLeetCode 1004: Max Consecutive Ones III is a classic sliding window problem that challenges your understanding of arrays, window manipulation, and frequency counting.The goal is to find the longest subarray of consecutive 1's in a binary array if you are allowed to flip at most K zeros to 1’s.This problem is an excellent example of transforming a brute-force solution into a linear-time efficient approach using the sliding window pattern.If you’d like to try solving the problem first, you can attempt it here: Try the problem on LeetCode: https://leetcode.com/problems/max-consecutive-ones-iii/Problem UnderstandingYou are given:A binary array nums containing only 0's and 1'sAn integer k representing the maximum number of zeros you can flipYou need to return the length of the longest contiguous subarray of 1's after flipping at most k zeros.Examples:Input: nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Output: 6Explanation: Flip two zeros to get [1,1,1,0,0,1,1,1,1,1,1].Longest consecutive ones = 6.Input: nums = [0,0,1,1,0,0,1,1,1,0,1,1,0,0,0,1,1,1,1], k = 3Output: 10Explanation: Flip three zeros to get longest consecutive ones of length 10.A naive approach would check every possible subarray, flip zeros, and count consecutive ones:Time Complexity: O(n²) → too slow for large arraysInefficient for constraints up to 10⁵ elementsKey Idea: Sliding Window with Zero CountInstead of brute-force, notice that:We only care about how many zeros are in the current windowWe can maintain a sliding window [i, j]Keep a counter z for zeros in the windowExpand the window by moving jIf z exceeds k, shrink the window from the left by moving i and decrementing z for each zero removedIntuition:The window always contains at most k zerosThe length of the window gives the maximum consecutive ones achievable with flipsThis allows linear traversal of the array with O(1) space, making it optimal.Approach (Step-by-Step)Initialize pointers: i = 0, j = 0Initialize z = 0 (zeros count in current window) and co = 0 (max length)Iterate j from 0 to nums.length - 1:If nums[j] == 0, increment zCheck z:If z <= k: window is valid → update co = max(co, j - i + 1)Else: shrink window by moving i until z <= k, decrement z for zeros leaving windowContinue expanding window with jReturn co as the maximum consecutive onesOptimization:Only need one variable for zeros countAvoids recomputing sums or scanning subarrays repeatedlyImplementation (Java)class Solution { public int longestOnes(int[] nums, int k) { int co = 0; // maximum length of valid window int i = 0, j = 0; // window pointers int z = 0; // count of zeros in current window while (j < nums.length) { if (nums[j] == 0) { z++; // increment zeros count } if (z <= k) { co = Math.max(co, j - i + 1); // valid window j++; } else { // shrink window until zeros <= k while (z > k) { if (nums[i] == 0) { z--; } i++; } co = Math.max(co, j - i + 1); j++; } } return co; }}Dry Run ExampleInput:nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Execution:Window [i, j]Zeros zValid?Max length co[0,0] → [1]0Yes1[0,2] → [1,1,1]0Yes3[0,3] → [1,1,1,0]1Yes4[0,4] → [1,1,1,0,0]2Yes5[0,5] → [1,1,1,0,0,0]3No → shrink i5[3,8] → [0,0,1,1,1,1]2Yes6Output:6Complexity AnalysisTime Complexity: O(n) → Each element is visited at most twice (once when j moves, once when i moves)Space Complexity: O(1) → Only counters and pointers usedEdge Cases Consideredk = 0 → cannot flip any zeros, just count consecutive onesArray with all 1’s → return full lengthArray with all 0’s → return min(k, length)Single element arrays → works correctlySliding Window Pattern ImportanceThis problem is a perfect example of the sliding window pattern:Use a window to track a condition (max zeros allowed)Expand and shrink dynamically based on constraintsEfficiently computes maximum/minimum contiguous subarray lengthsIt also demonstrates counting with limited violations – a key interview concept.ConclusionBy tracking zeros with a sliding window, we convert a naive O(n²) problem into O(n) linear time.Understanding this pattern allows you to solve:Max consecutive ones/zeros problemsLongest substring/subarray with constraintsSubarray problems with limited replacements or violationsOnce mastered, this approach applies to many binary array and string problems efficiently.

SlidingWindowBinaryArrayLeetCodeMedium
LeetCode 682 Baseball Game - Java Solution Explained

LeetCode 682 Baseball Game - Java Solution Explained

IntroductionLeetCode 682 Baseball Game is one of the cleanest and most beginner-friendly stack simulation problems on LeetCode. It does not require any fancy algorithm or deep insight — it purely tests whether you can carefully read the rules and simulate them faithfully using the right data structure.But do not let "Easy" fool you. This problem is a great place to practice thinking about which data structure fits best and why. We will solve it three different ways — Stack, ArrayList, and Deque — so you can see the tradeoffs and pick the one that makes most sense to you.You can find the problem here — LeetCode 682 Baseball Game.What Is the Problem Really Asking?You are keeping score for a baseball game with four special rules. You process a list of operations one by one and maintain a record of scores. At the end, return the total sum of all scores in the record.The four operations are:A number (like "5" or "-2") — just add that number as a new score to the record."C" — the last score was invalid, remove it from the record."D" — add a new score that is double the most recent score."+" — add a new score that is the sum of the two most recent scores.That is it. Four rules, simulate them in order, sum up what is left.Real Life Analogy — A Scoreboard With CorrectionsImagine a scoreboard operator at a sports event. They write scores on a whiteboard as the game progresses:A player scores 5 points → write 5Another player scores 2 → write 2Referee says last score was invalid → erase the last number (C)Special bonus rule kicks in → double the last valid score (D)Two scores combine → add the last two scores as one entry (+)At the end, add up everything on the whiteboard. The stack is your whiteboard — you write on top and erase from the top.Why Stack Is the Natural FitAll four operations only ever look at or modify the most recently added scores. C removes the last one. D doubles the last one. + uses the last two. This "most recent first" access pattern is the definition of LIFO — Last In First Out — which is exactly what a Stack provides.Any time a problem says "the previous score" or "the last two scores," your brain should immediately think Stack.Approach 1: Stack (Your Solution) ✅The IdeaUse a Stack of integers. For each operation:Number → parse and pushC → pop the topD → peek the top, push doubled value+ → pop top two, push both back, push their sumpublic int calPoints(String[] operations) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < operations.length; i++) { String op = operations[i]; if (op.equals("C")) { st.pop(); // remove last score } else if (op.equals("D")) { st.push(st.peek() * 2); // double of last score } else if (op.equals("+")) { int prev1 = st.pop(); // most recent score int prev2 = st.pop(); // second most recent score int sum = prev1 + prev2; st.push(prev2); // put them back st.push(prev1); st.push(sum); // push the new score } else { st.push(Integer.parseInt(op)); // regular number } } // sum all remaining scores int total = 0; while (!st.empty()) { total += st.pop(); } return total;}One small improvement over your original solution — using op.equals("C") instead of op.charAt(0) == 'C'. This is cleaner and handles edge cases better since negative numbers like "-2" also start with - not a digit, so charAt(0) comparisons can get tricky. Using equals is always safer for string operations.Why the + Operation Needs Pop-Push-PopThe trickiest part is the + operation. You need the two most recent scores. Stack only lets you see the top. So you pop the first, then the second, compute the sum, then push both back before pushing the sum. This restores the record correctly — the previous two scores stay, and the new sum score is added on top.Detailed Dry Run — ops = ["5","2","C","D","+"]Let us trace every step carefully:"5" → number, parse and push Stack: [5]"2" → number, parse and push Stack: [5, 2]"C" → remove last score, pop Stack: [5]"D" → double last score, peek=5, push 10 Stack: [5, 10]"+" → sum of last two:pop prev1 = 10pop prev2 = 5sum = 15push prev2=5, push prev1=10, push sum=15 Stack: [5, 10, 15]Sum all: 5 + 10 + 15 = 30 ✅Detailed Dry Run — ops = ["5","-2","4","C","D","9","+","+"]"5" → push 5. Stack: [5]"-2" → push -2. Stack: [5, -2]"4" → push 4. Stack: [5, -2, 4]"C" → pop 4. Stack: [5, -2]"D" → peek=-2, push -4. Stack: [5, -2, -4]"9" → push 9. Stack: [5, -2, -4, 9]"+" → prev1=9, prev2=-4, sum=5. Push -4, 9, 5. Stack: [5, -2, -4, 9, 5]"+" → prev1=5, prev2=9, sum=14. Push 9, 5, 14. Stack: [5, -2, -4, 9, 5, 14]Sum: 5 + (-2) + (-4) + 9 + 5 + 14 = 27 ✅Approach 2: ArrayList (Most Readable)The IdeaArrayList gives you index-based access which makes the + operation much cleaner — no need to pop and push back. Just access the last two elements directly using size()-1 and size()-2.public int calPoints(String[] operations) { ArrayList<Integer> record = new ArrayList<>(); for (String op : operations) { int n = record.size(); if (op.equals("C")) { record.remove(n - 1); // remove last element } else if (op.equals("D")) { record.add(record.get(n - 1) * 2); // double last } else if (op.equals("+")) { // sum of last two — no need to remove and re-add! record.add(record.get(n - 1) + record.get(n - 2)); } else { record.add(Integer.parseInt(op)); } } int total = 0; for (int score : record) { total += score; } return total;}See how the + operation becomes a single line with ArrayList? record.get(n-1) + record.get(n-2) directly accesses the last two elements without any pop-push gymnastics.Dry Run — ops = ["5","2","C","D","+"]"5" → add 5. List: [5]"2" → add 2. List: [5, 2]"C" → remove last. List: [5]"D" → 5×2=10, add 10. List: [5, 10]"+" → get(0)+get(1) = 5+10=15, add 15. List: [5, 10, 15]Sum: 30 ✅Time Complexity: O(n) — single pass through operations Space Complexity: O(n) — ArrayList stores at most n scoresThe one tradeoff — remove(n-1) on an ArrayList is O(1) for the last element (no shifting needed). And get() is O(1). So this is fully O(n) overall and arguably the cleanest solution to read and understand.Approach 3: Deque (ArrayDeque — Fastest in Java)The IdeaArrayDeque is faster than Stack in Java because Stack is synchronized (thread-safe overhead) and ArrayDeque is not. For single-threaded LeetCode problems, ArrayDeque is always the better choice over Stack.public int calPoints(String[] operations) { Deque<Integer> deque = new ArrayDeque<>(); for (String op : operations) { if (op.equals("C")) { deque.pollLast(); // remove last } else if (op.equals("D")) { deque.offerLast(deque.peekLast() * 2); // double last } else if (op.equals("+")) { int prev1 = deque.pollLast(); int prev2 = deque.pollLast(); int sum = prev1 + prev2; deque.offerLast(prev2); // restore deque.offerLast(prev1); // restore deque.offerLast(sum); // new score } else { deque.offerLast(Integer.parseInt(op)); } } int total = 0; for (int score : deque) { total += score; } return total;}The logic is identical to the Stack approach. The only difference is the method names — offerLast instead of push, pollLast instead of pop, peekLast instead of peek.Time Complexity: O(n) Space Complexity: O(n)For iterating a Deque to sum, you can use a for-each loop directly — no need to pop everything out like with Stack.Approach ComparisonApproachTimeSpaceBest ForStackO(n)O(n)Classic interview answer, clear LIFO intentArrayListO(n)O(n)Cleanest code, easiest to readArrayDequeO(n)O(n)Best performance, preferred in productionAll three approaches have identical time and space complexity. The difference is purely in code style and readability. In an interview, any of these is perfectly acceptable. Mention that ArrayDeque is preferred over Stack in Java for performance if you want to impress.Why op.equals() Is Better Than op.charAt(0)Your original solution uses operations[i].charAt(0) == 'C' to check operations. This works but has a subtle risk — the + character check with charAt(0) is fine, but imagine if a future test had a number starting with C or D (it will not in this problem but defensive coding is a good habit). More importantly, "-2".charAt(0) is '-' which is fine, but using equals is semantically clearer — you are comparing the whole string, not just the first character. This shows cleaner coding habits in interviews.Edge Cases to KnowNegative numbers like "-2" Integer.parseInt("-2") handles negatives perfectly. The D operation on -2 gives -4. The + operation works correctly with negatives too. No special handling needed."C" after a "+" that added a score The problem guarantees C always has at least one score to remove. So after + adds a score, a C removes just that one new score — the previous two scores that + used remain intact. This is correct behavior and our solution handles it automatically.All scores removed If all operations are numbers followed by C operations removing every score, the stack ends up empty and the sum is 0. Our while loop handles this correctly — it simply never executes and returns 0.Only one operation A single number like ["5"] → push 5, sum is 5. Works fine.Common Mistakes to AvoidIn the + operation, forgetting to push both numbers back When you pop prev1 and prev2 to compute the sum, you must push them back onto the stack before pushing the sum. If you only push the sum without restoring prev1 and prev2, those scores disappear from the record permanently — which is wrong. The + operation only adds a new score, it does not remove the previous ones.Using charAt(0) comparison for detecting numbers Negative numbers start with -, not a digit. If you check charAt(0) >= '0' && charAt(0) <= '9' to detect numbers, you will miss negatives. The safest approach is to check for C, D, and + explicitly using equals, and fall through to the else for everything else (which covers both positive and negative numbers).Calling st.peek() or st.pop() without checking empty The problem guarantees valid operations — C always has something to remove, + always has two previous scores, D always has one. But in real code and defensive interview solutions, adding empty checks shows good habits even when the constraints guarantee safety.FAQs — People Also AskQ1. Why is Stack a good choice for LeetCode 682 Baseball Game? Because all four operations only access the most recently added scores — the last score for C and D, the last two for +. This "most recent first" access pattern is exactly what LIFO (Last In First Out) provides. Stack's push, pop, and peek all run in O(1) making it perfectly efficient.Q2. What is the time complexity of LeetCode 682? O(n) time where n is the number of operations. Each operation performs a constant number of stack operations (at most 3 pushes/pops for the + case). Space complexity is O(n) for storing scores.Q3. Why does the + operation need to pop and push back in the Stack approach? Stack only gives direct access to the top element. To get the second most recent score, you must pop the first one, peek/pop the second, then push the first one back. The ArrayList approach avoids this by using index-based access directly.Q4. What is the difference between Stack and ArrayDeque in Java for this problem? Both work correctly. ArrayDeque is faster because Stack is a legacy class that extends Vector and is synchronized (thread-safe), adding unnecessary overhead for single-threaded use. ArrayDeque has no synchronization overhead. For LeetCode and interviews, either is acceptable but ArrayDeque is technically better.Q5. Is LeetCode 682 asked in coding interviews? It appears occasionally as a warmup or screening problem. Its main value is testing whether you can carefully simulate rules without making logical errors — a skill that matters in systems programming, game development, and any domain with complex state management.Similar LeetCode Problems to Practice Next71. Simplify Path — Medium — stack simulation with path operations1047. Remove All Adjacent Duplicates In String — Easy — stack simulation735. Asteroid Collision — Medium — stack simulation with conditions150. Evaluate Reverse Polish Notation — Medium — stack with arithmetic operations, very similar pattern227. Basic Calculator II — Medium — stack with operator precedenceConclusionLeetCode 682 Baseball Game is a perfect problem to build confidence with stack simulation. The four operations are clearly defined, the rules are unambiguous, and the stack maps naturally to every operation. Once you understand why pop-push-back is needed for + in the stack approach and how ArrayList simplifies that with index access, you have genuinely understood the tradeoffs between these data structures.If you are newer to stacks, start with the ArrayList solution for clarity. Once that clicks, rewrite it with Stack to understand the LIFO mechanics. Then try ArrayDeque to understand why it is preferred in modern Java code.

LeetCodeJavaStackArrayListDequeEasy
Roman to Integer – Easy Explanation with Java Solution (LeetCode 13)

Roman to Integer – Easy Explanation with Java Solution (LeetCode 13)

Try the QuestionYou can try solving the problem here before reading the solution:👉 https://leetcode.com/problems/roman-to-integer/Practicing it yourself first helps you understand the logic better.Roman to Integer – Complete GuideRoman numerals are an ancient numbering system used by the Romans. Instead of digits like 1, 2, 3, they used specific characters to represent values.This problem asks us to convert a Roman numeral string into its corresponding integer value.It is a very common interview question and frequently appears in coding platforms like LeetCode, HackerRank, and coding interviews at product-based companies.Roman Numeral SymbolsRoman numerals consist of seven characters, each representing a fixed value.SymbolValueI1V5X10L50C100D500M1000Example conversions:III = 3 → 1 + 1 + 1XII = 12 → 10 + 1 + 1XXVII = 27 → 10 + 10 + 5 + 1 + 1Normally, Roman numerals are written from largest to smallest from left to right.But there is an important exception.The Subtraction RuleIn some cases, Roman numerals use subtraction instead of addition.If a smaller value appears before a larger value, it means we subtract it.Examples:RomanCalculationResultIV5 − 14IX10 − 19XL50 − 1040XC100 − 1090CD500 − 100400CM1000 − 100900These are the only valid subtraction cases.Example WalkthroughExample 1Inputs = "III"ExplanationI + I + I = 1 + 1 + 1 = 3Output3Example 2Inputs = "LVIII"ExplanationL = 50V = 5III = 350 + 5 + 3 = 58Output58Example 3Inputs = "MCMXCIV"ExplanationM = 1000CM = 900XC = 90IV = 4Total = 1994Output1994Intuition Behind the SolutionThe key idea is to compare each Roman numeral with the numeral to its right.Two situations occur:Case 1 — Normal AdditionIf the current value ≥ next valueWe simply add it to the total.ExampleVI5 + 1 = 6Case 2 — Subtraction CaseIf the current value < next valueWe subtract it.ExampleIV5 - 1 = 4Strategy to SolveCreate a HashMap to store Roman numeral values.Start from the rightmost character.Initialize total with the last character's value.Move from right to left.Compare the current numeral with the next numeral.If smaller → subtract.Otherwise → add.Continue until the beginning of the string.This approach works because Roman numerals follow a local comparison rule.Java Implementationclass Solution { public int romanToInt(String s) { HashMap<Character,Integer> mp = new HashMap<>(); mp.put('I',1); mp.put('V',5); mp.put('X',10); mp.put('L',50); mp.put('C',100); mp.put('D',500); mp.put('M',1000); int tot = mp.get(s.charAt(s.length()-1)); char arr[] = s.toCharArray(); int j = s.length()-2; for(int i = arr.length-1; i >= 0; i--){ if(j >= 0){ if(mp.get(arr[j]) < mp.get(arr[i])){ tot -= mp.get(arr[j]); }else if(mp.get(arr[j]) > mp.get(arr[i])){ tot += mp.get(arr[j]); }else{ tot += mp.get(arr[j]); } } j--; } return tot; }}Code ExplanationStep 1 — Store Roman ValuesWe create a HashMap so we can quickly get the numeric value of each Roman character.I → 1V → 5X → 10...This allows O(1) lookup time.Step 2 — Initialize TotalWe start with the last character.int tot = mp.get(s.charAt(s.length()-1));Why?Because the last numeral is always added, never subtracted.Step 3 — Traverse from Right to LeftWe move backward through the string.for(int i = arr.length-1; i >= 0; i--)And compare with the previous character.Step 4 — Apply Roman RulesIf the previous numeral is smaller than the current numeral:tot -= valueExampleIV5 - 1If it is greater or equal:tot += valueExampleVI5 + 1Time ComplexityO(n)Where n = length of the string.We only traverse the string once.Space ComplexityO(1)The HashMap size is constant (only 7 entries).Key Takeaways✔ Roman numerals mostly use addition✔ Subtraction occurs only in six specific cases✔ Comparing current and next value is the simplest approach✔ A single pass solution (O(n)) is enoughThis is why this problem is commonly used to test string processing and logical reasoning in coding interviews.Final ThoughtsThe Roman to Integer problem is a great beginner-friendly problem that teaches:HashMap usageString traversalConditional logicPattern recognitionMastering these simple problems builds a strong foundation for more complex algorithmic questions.If you're preparing for coding interviews, this is definitely a problem you should practice.

LeetCodeJavaString ProblemsEasyRoman Numerals
LeetCode 462: Minimum Moves to Equal Array Elements II | Java Solution Explained (Median Approach)

LeetCode 462: Minimum Moves to Equal Array Elements II | Java Solution Explained (Median Approach)

IntroductionLeetCode 462 is a classic mathematical and greedy problem.We are given an integer array where each operation allows us to:Increment an element by 1Decrement an element by 1Our task is to make all numbers equal while using the minimum number of moves.At first glance, this may look like a simple array problem.But the hidden concept behind this question is:Median propertyGreedy optimizationAbsolute difference minimizationThis problem is extremely popular in coding interviews because it tests logical thinking more than coding complexity.# Problem LinkProblem StatementYou are given an integer array nums.In one move:You can increase an element by 1Or decrease an element by 1You must make all array elements equal.Return the minimum number of operations required.Example 1Input:nums = [1,2,3]Output:2Explanation:[1,2,3]→ [2,2,3]→ [2,2,2]Total operations = 2Example 2Input:nums = [1,10,2,9]Output:16Key ObservationWe need to choose one target value such that all numbers move toward it.Question:Which target gives minimum total moves?Answer:MedianMedian minimizes the sum of absolute differences.Why Median Works?Suppose:nums = [1,2,3,10]If target = 2|1-2| + |2-2| + |3-2| + |10-2|= 1 + 0 + 1 + 8= 10If target = 5|1-5| + |2-5| + |3-5| + |10-5|= 4 + 3 + 2 + 5= 14Median gives minimum moves.Approach 1: Brute ForceIn this approach, we try every possible value as target.For each target:Calculate total operations neededStore minimum answerAlgorithmFind minimum and maximum elementTry every value between themCompute total movesReturn minimumJava Code (Brute Force)class Solution {public int minMoves2(int[] nums) {int min = Integer.MAX_VALUE;int max = Integer.MIN_VALUE;for (int num : nums) {min = Math.min(min, num);max = Math.max(max, num);}int result = Integer.MAX_VALUE;for (int target = min; target <= max; target++) {int moves = 0;for (int num : nums) {moves += Math.abs(num - target);}result = Math.min(result, moves);}return result;}}Time ComplexityO(N × Range)Very slow for large values.Approach 2: Sorting + Median (Optimal)This is the best and most commonly used approach.IdeaSort arrayPick median elementCalculate total absolute differenceStepsStep 1: Sort ArraySorting helps us easily find median.Step 2: Pick MedianMedian index = n / 2Step 3: Calculate MovesFor every element:moves += abs(median - value)Optimal Java Solutionclass Solution {public int minMoves2(int[] nums) {Arrays.sort(nums);int mid = nums.length / 2;int ans = 0;for (int i = 0; i < nums.length; i++) {int diff = Math.abs(nums[mid] - nums[i]);ans += diff;}return ans;}}Code ExplanationStep 1: Sort ArrayArrays.sort(nums);Sorting allows median calculation.Step 2: Get Medianint mid = nums.length / 2;Middle element becomes target.Step 3: Compute DifferenceMath.abs(nums[mid] - nums[i])Find distance from median.Step 4: Add All Movesans += diff;Store total moves.Approach 3: Two Pointer OptimizationAfter sorting, we can use two pointers.Instead of calculating absolute difference manually, we can pair smallest and largest values.IdeaAfter sorting:moves += nums[right] - nums[left]Because both numbers will meet toward median.Java Code (Two Pointer)class Solution {public int minMoves2(int[] nums) {Arrays.sort(nums);int left = 0;int right = nums.length - 1;int moves = 0;while (left < right) {moves += nums[right] - nums[left];left++;right--;}return moves;}}Why Two Pointer Works?Because:Median minimizes total distancePairing smallest and largest values gives direct movement cost.Dry RunInput:nums = [1,10,2,9]Sort:[1,2,9,10]Median:9Operations:|1-9| = 8|2-9| = 7|9-9| = 0|10-9| = 1Total:16Time ComplexitySortingO(N log N)TraversingO(N)TotalO(N log N)Space ComplexityO(1)Ignoring sorting stack.Common Mistakes1. Using Average Instead of MedianMany people think average gives minimum.Wrong.Average minimizes squared difference.Median minimizes absolute difference.2. Forgetting SortingMedian requires sorted order.3. Overflow IssueValues can be large.Sometimes use:long ansfor safer calculation.4. Using Wrong Median IndexCorrect:n / 2Edge CasesCase 1Single element array.Answer = 0Case 2All elements already equal.Answer = 0Case 3Negative numbers.Algorithm still works.FAQsQ1. Why median gives minimum moves?Median minimizes total absolute difference.Q2. Can average work?No.Average does not minimize absolute distance.Q3. Is sorting necessary?Yes.Sorting helps us easily find median.Q4. Which approach is best?Sorting + median approach.Interview InsightInterviewers ask this problem to test:Median property understandingGreedy optimizationMathematical thinkingArray manipulationConclusionLeetCode 462 is one of the most important median-based interview questions.The major learning is:Median minimizes total absolute differenceSorting makes finding median easySum of distances gives answerOnce you understand why median works, this question becomes very simple.

MathMedianMediumLeetCodeJavaArrayTwo PointerSorting
LeetCode 235: Lowest Common Ancestor of a Binary Search Tree – Java BST Solution with Dry Run

LeetCode 235: Lowest Common Ancestor of a Binary Search Tree – Java BST Solution with Dry Run

IntroductionLeetCode 235 – Lowest Common Ancestor of a Binary Search Tree is one of the most important BST interview problems.This problem helps you understand:Binary Search Tree propertiesRecursive traversalTree navigationAncestor relationshipsOptimized searchingIt is frequently asked in coding interviews because it combines tree traversal with BST optimization.Problem Link🔗 https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-search-tree/Problem StatementGiven:Root of a Binary Search TreeTwo nodes p and qReturn:The Lowest Common Ancestor (LCA) of p and qThe LCA is the lowest node in the tree that has both nodes as descendants.A node can also be a descendant of itself.Example 1Inputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 8Output6Example 2Inputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 4Output2Understanding the BST PropertyA Binary Search Tree follows:Left Subtree < RootRight Subtree > RootExample: 6 / \ 2 8 / \ / \ 0 4 7 9 / \ 3 5This property allows us to find the LCA efficiently.Key ObservationThere are only three possible cases:Case 1Both nodes are smaller than root.Move LeftCase 2Both nodes are greater than root.Move RightCase 3One node is on the left and the other is on the right.OROne node equals root.Then:Current root is the LCAIntuitionSuppose:p = 2q = 8root = 6Now:2 < 68 > 6This means:One node is in left subtreeOne node is in right subtreeSo:6 is the first common split pointHence:6 is the Lowest Common AncestorBrute Force ApproachIdeaFind path from root to pFind path from root to qCompare both pathsLast common node is the LCABrute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)Extra path storage required.Optimized BST ApproachUsing BST properties:No need to store pathsNo need to traverse entire treeMove intelligentlyThis gives a much cleaner solution.Java Solutionclass Solution { public TreeNode solve(TreeNode root, TreeNode p, TreeNode q) { if(root == null) return root; if(root.val < p.val && root.val < q.val) { return solve(root.right, p, q); } else if(root.val > p.val && root.val > q.val) { return solve(root.left, p, q); } else { return root; } } public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { if(root == null) return root; return solve(root, p, q); }}Cleaner Recursive Versionclass Solution { public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { if(root.val > p.val && root.val > q.val) { return lowestCommonAncestor(root.left, p, q); } if(root.val < p.val && root.val < q.val) { return lowestCommonAncestor(root.right, p, q); } return root; }}Iterative ApproachWe can also solve this without recursion.Iterative Java Solutionclass Solution { public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) { while(root != null) { if(root.val > p.val && root.val > q.val) { root = root.left; } else if(root.val < p.val && root.val < q.val) { root = root.right; } else { return root; } } return null; }}Dry RunInputroot = [6,2,8,0,4,7,9,null,null,3,5]p = 2q = 8Step 1Current root:6Check:2 < 68 > 6One node is on left.One node is on right.So:6 is the LCAFinal Output6Another Dry RunInputp = 2q = 4Step 1Current root:6Both nodes smaller than 6.Move left.Step 2Current root:2Now:p == rootSo:2 is the LCAWhy This WorksBST ordering helps us eliminate half the tree at every step.If:p and q both smallerthen LCA must exist in left subtree.If:p and q both greaterthen LCA must exist in right subtree.Otherwise:Current node is the split pointwhich becomes the Lowest Common Ancestor.Time Complexity AnalysisOptimized BST SolutionAverage Time ComplexityO(log N)Because BST halves search space.Worst Case Time ComplexityO(N)Occurs when BST becomes skewed.Space ComplexityRecursiveO(H)Where:H = height of treeIterativeO(1)No recursion stack used.Interview ExplanationIn interviews, explain:Since this is a BST, we can use node ordering to decide whether both nodes lie in the left subtree, right subtree, or on different sides. The first split point becomes the Lowest Common Ancestor.This demonstrates:BST understandingTree recursionSearch optimizationEfficient traversal logicCommon Mistakes1. Treating It Like a Normal Binary TreeThis problem becomes easier because it is a BST.Use BST properties.2. Forgetting Split Point LogicThe LCA occurs when:p <= root <= qor vice versa.3. Traversing Entire TreeUnnecessary.BST lets us eliminate half the tree.4. Confusing Ancestor DefinitionA node can be ancestor of itself.Important for cases like:p = 2q = 4Answer becomes:2FAQsQ1. Why is BST important here?BST ordering allows efficient searching.Without BST property, we need a completely different approach.Q2. Can this be solved iteratively?Yes.Iterative traversal is even more space-efficient.Q3. Is recursion necessary?No.Both recursive and iterative solutions work.Q4. What is the Lowest Common Ancestor?The deepest node that has both target nodes as descendants.ConclusionLeetCode 235 is an excellent BST problem for mastering:BST propertiesRecursive traversalTree navigationOptimized searchingAncestor-based reasoningThe main insight is:In a BST, the first node where paths to p and q split becomes the Lowest Common Ancestor.Once this concept becomes intuitive, many BST interview problems become much easier to solve.

LeetCodeBinary Search TreeBSTJavaTreeMedium
LeetCode 2033: Minimum Operations to Make a Uni-Value Grid | Java Solution Explained (Median Approach)

LeetCode 2033: Minimum Operations to Make a Uni-Value Grid | Java Solution Explained (Median Approach)

IntroductionIn this problem, we are given a 2D grid and an integer x.We can perform one operation where we either:Add x to any grid elementSubtract x from any grid elementOur goal is to make all elements in the grid equal using the minimum number of operations.If making all values equal is not possible, we return -1.This problem may initially look like a matrix manipulation question, but the actual logic is based on:Array transformationMedian propertyGreedy optimization# Problem LinkProblem StatementYou are given:A 2D integer grid of size m × nAn integer xYou can perform operations where you add or subtract x from any cell.A grid becomes uni-value when all elements become equal.Return the minimum number of operations needed.If impossible, return -1.ExampleExample 1Input:grid = [[2,4],[6,8]]x = 2Output:4Explanation:We can make every element equal to 4.2 → 4 (1 operation)6 → 4 (1 operation)8 → 4 (2 operations)Total = 4 operations.Key ObservationBefore solving the problem, we must understand one important rule.If we can add or subtract only x, then:All numbers must belong to the same remainder group when divided by x.Meaning:value % x must be same for every elementWhy?Because if two numbers have different remainders, they can never become equal using only +x or -x operations.IntuitionWe need to convert all numbers into a single target value.But what target value gives minimum operations?The answer is:MedianFor minimizing total absolute distance, median gives the optimal answer.Since every operation changes value by x, we can:Flatten grid into a listSort the listPick median as targetCalculate operations requiredWhy Median Works?Median minimizes:Sum of absolute differencesFor example:Numbers = [1, 2, 3, 10]If target = 2|1-2| + |2-2| + |3-2| + |10-2| = 10If target = 5|1-5| + |2-5| + |3-5| + |10-5| = 14Median gives minimum total distance.Approach 1: Brute ForceWe can try every possible number as target.For each target:Calculate operations requiredStore minimum answerTime ComplexityO(N²)Where N = total grid elementsThis is slow for large constraints.Approach 2: Optimal Median ApproachThis is the best approach.StepsStep 1: Flatten GridConvert 2D grid into 1D array.Step 2: Sort ArraySorting helps us find median.Step 3: Check ValidityAll values must have same remainder when divided by x.value % x must matchOtherwise return -1.Step 4: Pick MedianMedian minimizes operations.Step 5: Count OperationsFor every element:operations += abs(value - median) / xJava Solutionclass Solution {public int minOperations(int[][] grid, int x) {List<Integer> lis = new ArrayList<>();for (int i = 0; i < grid.length; i++) {for (int j = 0; j < grid[0].length; j++) {lis.add(grid[i][j]);}}Collections.sort(lis);int mid = lis.size() / 2;int remainder = lis.get(0) % x;for (int value : lis) {if (value % x != remainder) {return -1;}}int ans = 0;for (int value : lis) {int diff = Math.abs(lis.get(mid) - value);ans += diff / x;}return ans;}}Code ExplanationStep 1: Flatten Matrixlis.add(grid[i][j]);We convert grid into list.Step 2: Sort ListCollections.sort(lis);Sorting allows median selection.Step 3: Check Possibilityif(value % x != remainder)If remainders differ, answer becomes impossible.Step 4: Select Medianint mid = lis.size()/2;Median becomes target value.Step 5: Calculate Operationsans += diff/x;Difference divided by x gives operations.Dry RunInput:grid = [[2,4],[6,8]]x = 2Flatten:[2,4,6,8]Sort:[2,4,6,8]Median:6Operations:2 → 6 = 2 operations4 → 6 = 1 operation6 → 6 = 0 operation8 → 6 = 1 operationTotal:4 operationsTime ComplexityFlatten GridO(N)SortingO(N log N)Traverse ArrayO(N)Total ComplexityO(N log N)Where:N = m × nSpace ComplexityWe store all elements in list.O(N)Common Mistakes1. Forgetting Mod CheckMany people directly calculate operations.But without checking:value % xanswer may become invalid.2. Choosing Average Instead of MedianAverage does not minimize absolute distance.Median is required.3. Not Sorting Before Finding MedianMedian requires sorted array.4. Forgetting Division by xOperations are not direct difference.Correct formula:abs(target - value) / xEdge CasesCase 1All values already equal.Answer = 0Case 2Different modulo values.Return -1Case 3Single cell grid.No operation neededFAQsQ1. Why do we use median?Median minimizes total absolute difference.Q2. Why not average?Average minimizes squared distance, not absolute operations.Q3. Why modulo condition is important?Because we can only move by multiples of x.Q4. Can we solve without sorting?Sorting is easiest way to get median.Alternative median-finding algorithms exist but are unnecessary here.Interview InsightInterviewers ask this problem to test:Greedy thinkingMedian propertyMathematical observationArray flatteningOptimization logicConclusionLeetCode 2033 is a great problem that combines math with greedy logic.The most important learning points are:Flatten the gridValidate modulo conditionUse median as targetCalculate operations using difference divided by xThis approach is optimal and easy to implement.Once you understand why median works, this problem becomes very straightforward.

ArraySortingMathMedianMediumMatrixGridLeetCodeJava
LeetCode 402: Remove K Digits — Java Solution Explained

LeetCode 402: Remove K Digits — Java Solution Explained

IntroductionLeetCode 402 Remove K Digits is one of those problems where the brute force solution feels obvious but completely falls apart at scale — and the optimal solution requires a genuinely clever insight that, once you see it, feels like magic.This problem sits at the intersection of two powerful techniques — Greedy thinking and Monotonic Stack. If you have already solved Next Greater Element and Asteroid Collision, you have all the building blocks you need. This is where those patterns level up.You can find the problem here — LeetCode 402 Remove K Digits.What Is the Problem Really Asking?You are given a number as a string and an integer k. Remove exactly k digits from the number such that the resulting number is as small as possible. Return it as a string without leading zeros.Example:num = "1432219", k = 3We want to remove 3 digits to make the number as small as possibleRemove 4, 3, 2 → remaining is "1219"Output: "1219"Simple goal — smallest possible number after exactly k removals.Real Life Analogy — Choosing the Best Price TagImagine you are reading a price tag digit by digit from left to right. Every time you see a digit that is bigger than the next one coming, you have a chance to remove it and make the price smaller. You have a limited number of removals — use them wisely on the biggest offenders from the left side, because leftmost digits have the most impact on the overall value.Removing a 9 from the front of a number shrinks it far more than removing a 9 from the end. This left-to-right priority with greedy removal is the entire insight of this problem.The Core Greedy InsightHere is the key question — which digit should we remove first to make the number as small as possible?Think about it this way. In the number "1432219", which digit is hurting us the most? It is 4 — because it is large and sits early in the number. After removing 4 we get "132219". Now 3 is the biggest early offender. And so on.More precisely — whenever you see a digit that is greater than the digit immediately after it, removing it makes the number smaller. This is because a larger digit sitting before a smaller digit inflates the overall value.This is the Greedy rule: scan left to right, and whenever the current digit on the stack is greater than the incoming digit, remove it (if we still have removals left).A Monotonic Increasing Stack enforces exactly this — it keeps digits in non-decreasing order, automatically kicking out any digit that is larger than what comes next.The Solution — Monotonic Stackpublic String removeKdigits(String num, int k) { Stack<Character> st = new Stack<>(); // build monotonic increasing stack for (int i = 0; i < num.length(); i++) { // while stack top is greater than current digit and we still have removals while (!st.empty() && k != 0 && st.peek() > num.charAt(i)) { st.pop(); // remove the larger digit — greedy choice k--; } st.push(num.charAt(i)); } // if k removals still remaining, remove from the end (largest digits are at top) while (k != 0) { st.pop(); k--; } // build result string from stack StringBuilder sb = new StringBuilder(); while (!st.empty()) { sb.append(st.pop()); } sb.reverse(); // stack gives reverse order // remove leading zeros while (sb.length() > 0 && sb.charAt(0) == '0') { sb.deleteCharAt(0); } // if nothing left, return "0" return sb.length() == 0 ? "0" : sb.toString();}Step-by-Step Dry Run — num = "1432219", k = 3Processing 1: Stack empty → push. Stack: [1]Processing 4: Stack top 1 < 4 → no pop. Push 4. Stack: [1, 4]Processing 3: Stack top 4 > 3 and k=3 → pop 4, k=2. Stack: [1] Stack top 1 < 3 → stop. Push 3. Stack: [1, 3]Processing 2: Stack top 3 > 2 and k=2 → pop 3, k=1. Stack: [1] Stack top 1 < 2 → stop. Push 2. Stack: [1, 2]Processing 2: Stack top 2 == 2 → not greater, stop. Push 2. Stack: [1, 2, 2]Processing 1: Stack top 2 > 1 and k=1 → pop 2, k=0. Stack: [1, 2] k=0, stop. Push 1. Stack: [1, 2, 1]Processing 9: k=0, no more removals. Push 9. Stack: [1, 2, 1, 9]k is now 0, skip the cleanup loop.Build result: pop all → "9121" → reverse → "1219" No leading zeros. Return "1219" ✅Step-by-Step Dry Run — num = "10200", k = 1Processing 1: stack empty → push. Stack: [1]Processing 0: Stack top 1 > 0 and k=1 → pop 1, k=0. Stack: [] Push 0. Stack: [0]Processing 2: k=0, no removals. Push. Stack: [0, 2]Processing 0: k=0. Push. Stack: [0, 2, 0]Processing 0: k=0. Push. Stack: [0, 2, 0, 0]k=0, skip cleanup.Build result: "0020" → reverse → "0200" Remove leading zero → "200" Return "200" ✅Step-by-Step Dry Run — num = "10", k = 2Processing 1: push. Stack: [1]Processing 0: Stack top 1 > 0 and k=2 → pop 1, k=1. Stack: [] Push 0. Stack: [0]k=1 remaining → cleanup loop → pop 0, k=0. Stack: []Build result: empty string. Remove leading zeros: nothing to remove. Length is 0 → return "0" ✅The Three Tricky Cases You Must HandleCase 1 — k is not fully used after the loop This happens with a non-decreasing number like "12345" with k=2. No element ever gets popped during the loop because no digit is greater than the next one. The stack ends up as [1,2,3,4,5] with k still = 2. The solution is to pop from the top of the stack — which holds the largest digits — until k hits 0.Case 2 — Leading zeros After removing digits, the remaining number might start with zeros. "10200" becomes "0200" after removing 1. We strip leading zeros with a while loop. But we must be careful not to strip the only zero — that is why we check length > 0 before each removal.Case 3 — Empty result If all digits are removed (like "10" with k=2), the StringBuilder ends up empty. We return "0" because an empty number is represented as zero.Why Remaining k Gets Removed From the EndAfter the main loop, if k is still greater than 0, why do we remove from the top of the stack (which corresponds to the end of the number)?Because the stack at this point holds a non-decreasing sequence. In a non-decreasing sequence, the largest values are at the end. Removing from the end removes the largest remaining digits — which is exactly the greedy choice to minimize the number.For example in "12345" with k=2: the stack is [1,2,3,4,5]. Pop top twice → remove 5 and 4 → [1,2,3] → result is "123". Correct!Time and Space ComplexityTime Complexity: O(n) — each digit is pushed onto the stack exactly once and popped at most once. Even with the while loop inside the for loop, total push and pop operations across the entire run never exceed 2n. The leading zero removal is also O(n) in the worst case. Overall stays linear.Space Complexity: O(n) — the stack holds at most n digits in the worst case when no removals happen during the main loop.Common Mistakes to AvoidNot handling remaining k after the loop This is the most common mistake. If the number is already non-decreasing, the loop never pops anything. Forgetting the cleanup loop gives the wrong answer for inputs like "12345" with k=2.Not removing leading zeros After removals, the result might start with zeros. "0200" should be returned as "200". Skipping this step gives wrong output.Returning empty string instead of "0" When all digits are removed, return "0" not "". An empty string is not a valid number representation.Using >= instead of > in the pop condition If you pop on equal digits too, you remove more than necessary and might get wrong results. Only pop when strictly greater — equal digits in sequence are fine to keep.How This Connects to the Monotonic Stack SeriesLooking at the stack problems you have been solving:496 Next Greater Element — monotonic decreasing stack, find first bigger to the right 735 Asteroid Collision — stack simulation, chain reactions 402 Remove K Digits — monotonic increasing stack, greedy removal for minimum numberThe direction of the monotonic stack flips based on what you are optimizing. For "next greater" you keep a decreasing stack. For "smallest number" you keep an increasing stack. Recognizing which direction to go is the skill that connects all these problems.FAQs — People Also AskQ1. Why does a Monotonic Stack give the smallest number in LeetCode 402? A monotonic increasing stack ensures that at every point, the digits we have kept so far are in the smallest possible order. Whenever a smaller digit arrives and the stack top is larger, removing that larger digit can only make the number smaller — this greedy choice is always optimal.Q2. What happens if k is not fully used after the main loop in LeetCode 402? The number is already in non-decreasing order so no removals happened during the loop. The remaining removals should be made from the end of the number (top of stack) since those are the largest values in a non-decreasing sequence.Q3. How are leading zeros handled in LeetCode 402? After building the result string, strip any leading zeros with a while loop. If stripping leaves an empty string, return "0" because the empty case represents zero.Q4. What is the time complexity of LeetCode 402? O(n) time because each digit is pushed and popped at most once across the entire algorithm. Space complexity is O(n) for the stack.Q5. Is LeetCode 402 asked in coding interviews? Yes, it is frequently asked at companies like Google, Amazon, and Microsoft. It tests greedy thinking combined with monotonic stack — two patterns that interviewers love because they require genuine insight rather than memorization.Similar LeetCode Problems to Practice Next496. Next Greater Element I — Easy — monotonic decreasing stack739. Daily Temperatures — Medium — next greater with distances316. Remove Duplicate Letters — Medium — similar greedy stack with constraints1081. Smallest Subsequence of Distinct Characters — Medium — same approach as 31684. Largest Rectangle in Histogram — Hard — advanced monotonic stackConclusionLeetCode 402 Remove K Digits is a beautiful problem that rewards clear thinking. The greedy insight — always remove a digit when a smaller digit comes after it — naturally leads to the monotonic stack solution. The three edge cases (remaining k, leading zeros, empty result) are what separate a buggy solution from a clean, accepted one.Work through all three dry runs carefully. Once you see how the stack stays increasing and how each pop directly corresponds to a greedy removal decision, this pattern will click permanently and carry you through harder stack problems ahead.

LeetCodeJavaStackMonotonic StackGreedyStringMedium
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
Queue Data Structure Complete Guide - Java Explained With All Operations

Queue Data Structure Complete Guide - Java Explained With All Operations

IntroductionIf you have been learning Data Structures and Algorithms, you have probably already spent time with arrays, linked lists, and stacks. Now it is time to meet one of the most important and widely used data structures in computer science — the Queue.Queue is not just a theoretical concept. It powers some of the most critical systems you use every day — from how your printer handles jobs, to how your CPU schedules tasks, to how Google Maps finds the shortest path between two locations. Understanding Queue deeply means understanding how real systems work.In this complete guide we will cover absolutely everything — what a Queue is, how it differs from a Stack, every type of Queue, all operations with code, Java implementations, time and space complexity, common interview questions, and the most important LeetCode problems that use Queue.What Is a Queue?A Queue is a linear data structure that follows the FIFO principle — First In First Out. This means the element that was added first is the one that gets removed first.Think of it exactly like a real-world queue (a line of people). The person who joined the line first gets served first. No cutting in line, no serving from the back — strict order from front to back.This is the fundamental difference between a Queue and a Stack:Stack → LIFO (Last In First Out) — like a stack of plates, you take from the topQueue → FIFO (First In First Out) — like a line of people, you serve from the frontReal Life Examples of QueueBefore writing a single line of code, let us understand where queues appear in real life. This will make every technical concept feel natural.Printer Queue — when you send multiple documents to print, they print in the order they were sent. The first document sent prints first.CPU Task Scheduling — your operating system manages running processes in a queue. Tasks get CPU time in the order they arrive (in basic scheduling).Customer Service Call Center — when you call a helpline and are put on hold, you are placed in a queue. The first caller on hold gets connected first.WhatsApp Messages — messages are delivered in the order they are sent. The first message sent is the first one received.BFS (Breadth First Search) — every time you use Google Maps or any navigation app to find the shortest path, it uses BFS internally which is entirely powered by a Queue.Ticket Booking Systems — online booking portals process requests in the order they arrive. First come first served.Queue Terminology — Key Terms You Must KnowBefore diving into code, let us get the vocabulary right:Front — the end from which elements are removed (dequeued). This is where the "first person in line" stands.Rear (or Back) — the end at which elements are added (enqueued). New arrivals join here.Enqueue — the operation of adding an element to the rear of the queue. Like joining the back of a line.Dequeue — the operation of removing an element from the front of the queue. Like the first person in line being served and leaving.Peek (or Front) — looking at the front element without removing it. Like seeing who is first in line without serving them yet.isEmpty — checking whether the queue has no elements.isFull — relevant for fixed-size queues, checking whether no more elements can be added.Types of QueuesThis is where most beginners get confused. There is not just one type of Queue — there are several variations each designed to solve specific problems.1. Simple Queue (Linear Queue)The most basic form. Elements enter from the rear and leave from the front. Strict FIFO, nothing fancy.Enqueue → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue rear frontProblem with Simple Queue: In array-based implementation, once elements are dequeued from the front, those slots cannot be reused even if there is space. This wastes memory. This is why Circular Queue was invented.2. Circular QueueIn a Circular Queue, the rear wraps around to the front when it reaches the end of the array. The last position connects back to the first, forming a circle. This solves the wasted space problem of simple queues. [1] [2] [3] / \ [6] [4] \ / [5] ← rearUsed in: CPU scheduling, memory management, traffic light systems, streaming buffers.3. Double Ended Queue (Deque)A Deque (pronounced "deck") allows insertion and deletion from both ends — front and rear. It is the most flexible queue type.Enqueue Front → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue FrontEnqueue Rear → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue RearTwo subtypes:Input Restricted Deque — insertion only at rear, deletion from both endsOutput Restricted Deque — deletion only at front, insertion at both endsUsed in: browser history (back and forward), undo-redo operations, sliding window problems.4. Priority QueueElements are not served in FIFO order — instead each element has a priority and the element with the highest priority is served first regardless of when it was added.Think of an emergency room. A patient with a critical injury jumps ahead of someone with a minor cut even if they arrived later.Two types:Max Priority Queue — highest value = highest priorityMin Priority Queue — lowest value = highest priorityUsed in: Dijkstra's shortest path, Huffman encoding, A* search algorithm, task scheduling with priorities.5. Blocking QueueA thread-safe queue used in multi-threading. If the queue is empty, a thread trying to dequeue will wait (block) until an element is available. If the queue is full, a thread trying to enqueue will wait until space is available.Used in: Producer-Consumer problems, thread pool implementations, Java's java.util.concurrent package.Queue Operations and Time ComplexityEvery queue operation has a specific time complexity that you must know cold for interviews.OperationDescriptionTime ComplexityEnqueueAdd element to rearO(1)DequeueRemove element from frontO(1)Peek/FrontView front elementO(1)isEmptyCheck if queue is emptyO(1)SizeNumber of elementsO(1)SearchFind a specific elementO(n)Space Complexity: O(n) — where n is the number of elements stored.All core queue operations are O(1). This is what makes Queue so powerful — no matter how many elements are in the queue, adding and removing always takes constant time.Implementing Queue in Java — All WaysJava gives you multiple ways to use a Queue. Let us go through each one.Way 1: Using LinkedList (Most Common)LinkedList implements the Queue interface in Java. This is the most commonly used Queue implementation.import java.util.LinkedList;import java.util.Queue;Queue<Integer> queue = new LinkedList<>();// Enqueue — add to rearqueue.offer(10);queue.offer(20);queue.offer(30);// Peek — view front without removingSystem.out.println(queue.peek()); // 10// Dequeue — remove from frontSystem.out.println(queue.poll()); // 10System.out.println(queue.poll()); // 20// Check emptySystem.out.println(queue.isEmpty()); // false// SizeSystem.out.println(queue.size()); // 1offer() vs add() — both add to the queue. add() throws an exception if the queue is full (for bounded queues). offer() returns false instead. Always prefer offer().poll() vs remove() — both remove from front. remove() throws an exception if queue is empty. poll() returns null. Always prefer poll().peek() vs element() — both view the front. element() throws exception if empty. peek() returns null. Always prefer peek().Way 2: Using ArrayDeque (Fastest)ArrayDeque is faster than LinkedList for Queue operations because it uses a resizable array internally with no node allocation overhead.import java.util.ArrayDeque;import java.util.Queue;Queue<Integer> queue = new ArrayDeque<>();queue.offer(1);queue.offer(2);queue.offer(3);System.out.println(queue.peek()); // 1System.out.println(queue.poll()); // 1System.out.println(queue.size()); // 2When to use ArrayDeque over LinkedList? Use ArrayDeque whenever possible for Queue or Stack operations. It is faster because it avoids the overhead of node objects that LinkedList creates for every element. In competitive programming and interviews, ArrayDeque is the preferred choice.Way 3: Using Deque (Double Ended Queue)import java.util.ArrayDeque;import java.util.Deque;Deque<Integer> deque = new ArrayDeque<>();// Add to frontdeque.offerFirst(10);// Add to reardeque.offerLast(20);deque.offerLast(30);// Remove from frontSystem.out.println(deque.pollFirst()); // 10// Remove from rearSystem.out.println(deque.pollLast()); // 30// Peek front and rearSystem.out.println(deque.peekFirst()); // 20System.out.println(deque.peekLast()); // 20Way 4: Using PriorityQueueimport java.util.PriorityQueue;// Min Heap — smallest element has highest priorityPriorityQueue<Integer> minPQ = new PriorityQueue<>();minPQ.offer(30);minPQ.offer(10);minPQ.offer(20);System.out.println(minPQ.poll()); // 10 — smallest comes out first// Max Heap — largest element has highest priorityPriorityQueue<Integer> maxPQ = new PriorityQueue<>((a, b) -> b - a);maxPQ.offer(30);maxPQ.offer(10);maxPQ.offer(20);System.out.println(maxPQ.poll()); // 30 — largest comes out firstWay 5: Implementing Queue From Scratch Using ArrayUnderstanding the underlying implementation helps you in interviews when asked to build one from scratch.class MyQueue { private int[] arr; private int front; private int rear; private int size; private int capacity; public MyQueue(int capacity) { this.capacity = capacity; arr = new int[capacity]; front = 0; rear = -1; size = 0; } public void enqueue(int val) { if (size == capacity) { System.out.println("Queue is full!"); return; } rear = (rear + 1) % capacity; // circular wrapping arr[rear] = val; size++; } public int dequeue() { if (isEmpty()) { System.out.println("Queue is empty!"); return -1; } int val = arr[front]; front = (front + 1) % capacity; // circular wrapping size--; return val; } public int peek() { if (isEmpty()) return -1; return arr[front]; } public boolean isEmpty() { return size == 0; } public int size() { return size; }}Notice the % capacity in enqueue and dequeue — that is what makes it a Circular Queue. Without this, once the rear reaches the end of the array, you cannot add more even if front has moved forward and freed up space.Way 6: Implementing Queue Using Two StacksThis is a very popular interview question — implement a Queue using two stacks. The idea is to use one stack for enqueue and another for dequeue.class QueueUsingTwoStacks { Stack<Integer> s1 = new Stack<>(); // for enqueue Stack<Integer> s2 = new Stack<>(); // for dequeue public void enqueue(int val) { s1.push(val); // always push to s1 } public int dequeue() { if (s2.isEmpty()) { // transfer all elements from s1 to s2 // this reverses the order, giving FIFO behavior while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.pop(); } public int peek() { if (s2.isEmpty()) { while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.peek(); } public boolean isEmpty() { return s1.isEmpty() && s2.isEmpty(); }}Why does this work?When you transfer elements from s1 to s2, the order reverses. The element that was added first to s1 ends up on top of s2 — which means it gets dequeued first. FIFO achieved using two LIFOs!Amortized time complexity: Each element is pushed and popped at most twice (once in s1, once in s2). So dequeue is O(1) amortized even though individual calls might take O(n).This is LeetCode 232 — Implement Queue using Stacks.Queue vs Stack — Side by SideFeatureQueueStackPrincipleFIFO — First In First OutLIFO — Last In First OutInsert atRearTopRemove fromFrontTopReal lifeLine of peopleStack of platesJava classLinkedList, ArrayDequeStack, ArrayDequeMain useBFS, schedulingDFS, backtracking, parsingPeekFront elementTop elementBFS — The Most Important Application of QueueBreadth First Search (BFS) is the single most important algorithm that uses a Queue. Understanding BFS is why Queue matters so much in DSA.BFS explores a graph or tree level by level — all nodes at distance 1 first, then all at distance 2, and so on. A Queue naturally enforces this level-by-level behavior.public void bfs(int start, List<List<Integer>> graph) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[graph.size()]; queue.offer(start); visited[start] = true; while (!queue.isEmpty()) { int node = queue.poll(); // process front node System.out.print(node + " "); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); // add unvisited neighbors to rear } } }}Why Queue and not Stack for BFS? Queue ensures you process all neighbors of a node before going deeper. Stack would take you deep into one path first — that is DFS, not BFS. The FIFO property is what guarantees level-by-level exploration.BFS with Queue is used in:Shortest path in unweighted graphsLevel order traversal of treesFinding connected componentsWord ladder problemsRotten oranges, flood fill, and matrix BFS problemsLevel Order Traversal — BFS on TreesOne of the most common Queue problems in interviews is Level Order Traversal of a binary tree.public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> result = new ArrayList<>(); if (root == null) return result; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); while (!queue.isEmpty()) { int levelSize = queue.size(); // number of nodes at current level List<Integer> level = new ArrayList<>(); for (int i = 0; i < levelSize; i++) { TreeNode node = queue.poll(); level.add(node.val); if (node.left != null) queue.offer(node.left); if (node.right != null) queue.offer(node.right); } result.add(level); } return result;}The key trick here is using queue.size() at the start of each while loop iteration to know exactly how many nodes belong to the current level. Process exactly that many nodes, then move to the next level.This is LeetCode 102 — Binary Tree Level Order Traversal.Sliding Window Maximum — Monotonic DequeOne of the most impressive Queue applications is the Sliding Window Maximum problem using a Monotonic Deque. This is the queue equivalent of the Monotonic Stack pattern you saw in stack problems.The idea — maintain a deque that stores indices of elements in decreasing order. The front always holds the index of the maximum element in the current window.public int[] maxSlidingWindow(int[] nums, int k) { Deque<Integer> deque = new ArrayDeque<>(); // stores indices int[] result = new int[nums.length - k + 1]; int idx = 0; for (int i = 0; i < nums.length; i++) { // remove indices that are out of the current window while (!deque.isEmpty() && deque.peekFirst() < i - k + 1) { deque.pollFirst(); } // remove indices whose values are smaller than current // they can never be the maximum for any future window while (!deque.isEmpty() && nums[deque.peekLast()] < nums[i]) { deque.pollLast(); } deque.offerLast(i); // window is fully formed, record maximum (front of deque) if (i >= k - 1) { result[idx++] = nums[deque.peekFirst()]; } } return result;}This gives O(n) time for what would otherwise be an O(n×k) problem. This is LeetCode 239 — Sliding Window Maximum.Java Queue Interface — Complete Method ReferenceHere is every method you will ever need from Java's Queue and Deque interfaces:Queue Methods:offer(e) — add to rear, returns false if full (preferred over add) poll() — remove from front, returns null if empty (preferred over remove) peek() — view front without removing, returns null if empty (preferred over element) isEmpty() — returns true if no elements size() — returns number of elements contains(o) — returns true if element existsDeque Additional Methods:offerFirst(e) — add to front offerLast(e) — add to rear pollFirst() — remove from front pollLast() — remove from rear peekFirst() — view front peekLast() — view rearPriorityQueue Specific:offer(e) — add with natural ordering or custom comparator poll() — remove element with highest priority peek() — view highest priority element without removingCommon Interview Questions About QueueThese are the questions interviewers ask to test your understanding of queues conceptually — not just coding.Q1. What is the difference between Queue and Stack? Queue is FIFO — elements are removed in the order they were added. Stack is LIFO — the most recently added element is removed first. Queue removes from the front, Stack removes from the top.Q2. Why is ArrayDeque preferred over LinkedList for Queue in Java? ArrayDeque uses a resizable array internally and has better cache locality and no node allocation overhead. LinkedList creates a new node object for every element added, which means more garbage collection pressure. ArrayDeque is faster in practice for most Queue use cases.Q3. When would you use a PriorityQueue instead of a regular Queue? When the order of processing depends on priority rather than arrival order. For example in a hospital, critical patients are treated before minor cases regardless of when they arrived. Or in Dijkstra's algorithm, always processing the shortest known distance first.Q4. How is Queue used in BFS? BFS uses a Queue to explore nodes level by level. The starting node is enqueued first. Each time a node is dequeued, all its unvisited neighbors are enqueued. Since Queue is FIFO, all neighbors of a node are processed before going deeper — guaranteeing level-by-level exploration.Q5. What is the difference between poll() and remove() in Java Queue? Both remove the front element. remove() throws NoSuchElementException if the queue is empty. poll() returns null instead of throwing. Always use poll() for safer code.Q6. Can a Queue have duplicates? Yes. Queue does not have any restriction on duplicate values unlike Sets. The same value can appear multiple times in a Queue.Q7. What is a Blocking Queue and when is it used? A Blocking Queue is a thread-safe Queue used in multi-threaded applications. When a thread tries to dequeue from an empty queue, it blocks (waits) until an element is available. When a thread tries to enqueue into a full queue, it blocks until space is available. Used in Producer-Consumer patterns.Top LeetCode Problems on QueueHere are the most important LeetCode problems that use Queue — organized from beginner to advanced:Beginner Level:232. Implement Queue using Stacks — implement Queue with two stacks, classic interview question225. Implement Stack using Queues — reverse of 232, implement Stack using Queue933. Number of Recent Calls — sliding window with QueueIntermediate Level:102. Binary Tree Level Order Traversal — BFS on tree, must know107. Binary Tree Level Order Traversal II — same but bottom up994. Rotting Oranges — multi-source BFS on grid1091. Shortest Path in Binary Matrix — BFS shortest path542. 01 Matrix — multi-source BFS, distance to nearest 0127. Word Ladder — BFS on word graph, classicAdvanced Level:239. Sliding Window Maximum — monotonic deque, must know862. Shortest Subarray with Sum at Least K — monotonic deque with prefix sums407. Trapping Rain Water II — 3D BFS with priority queue787. Cheapest Flights Within K Stops — BFS with constraintsQueue Cheat Sheet — Everything at a GlanceCreate a Queue:Queue<Integer> q = new LinkedList<>(); // standardQueue<Integer> q = new ArrayDeque<>(); // faster, preferredDeque<Integer> dq = new ArrayDeque<>(); // double endedPriorityQueue<Integer> pq = new PriorityQueue<>(); // min heapPriorityQueue<Integer> pq = new PriorityQueue<>((a,b) -> b-a); // max heapCore Operations:q.offer(x); // enqueueq.poll(); // dequeueq.peek(); // front elementq.isEmpty(); // check emptyq.size(); // number of elementsDeque Operations:dq.offerFirst(x); // add to frontdq.offerLast(x); // add to reardq.pollFirst(); // remove from frontdq.pollLast(); // remove from reardq.peekFirst(); // view frontdq.peekLast(); // view rearBFS Template:Queue<Integer> queue = new LinkedList<>();queue.offer(start);visited[start] = true;while (!queue.isEmpty()) { int node = queue.poll(); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); } }}ConclusionQueue is one of those data structures that appears simple on the surface but has incredible depth once you start exploring its variations and applications. From the basic FIFO concept to Circular Queues, Deques, Priority Queues, Monotonic Deques, and BFS — each layer adds a new tool to your problem-solving arsenal.Here is the learning path to follow based on everything covered in this guide:Start with understanding FIFO vs LIFO and when each applies. Then get comfortable with Java's Queue interface — offer, poll, peek. Practice the BFS template until it feels automatic. Then move to Level Order Traversal problems. Once BFS clicks, tackle multi-source BFS problems like Rotting Oranges. Finally learn the Monotonic Deque pattern for sliding window problems.Master these and you will handle every Queue problem in any coding interview with confidence.

QueueData StructureJavaBFSDequePriority QueueCircular Queue
I Published My First npm Package: Karos

I Published My First npm Package: Karos

IntroductionPublishing your first npm package is not about building something revolutionary.If you think it is, you’ll either overbuild it or never ship it.Karos exists because I kept running into the same boring, frustrating problem across backend projects — inconsistent API responses and messy error handling.The Problem I Kept SeeingIn most Express or Node.js backends:Every route formats responses differentlySome errors are strings, some are objects, some leak stack tracesStatus codes are inconsistent or guessedFrontend logic becomes defensive and conditional-heavyTeams rewrite the same response boilerplate in every projectThere is no enforced backend–frontend contract.Just “best practices” that slowly decay over time.Why I Didn’t Use Existing SolutionsThere are libraries that help with errors.There are frameworks that encourage conventions.But most of them:Add heavy abstractionsRequire configuration filesLock you into a framework styleMix business logic with infrastructureI didn’t want help.I wanted enforcement — and nothing more.What Karos Does (And Only This)Karos enforces one predictable JSON response contract across your API.That’s it.Success Response{"success": true,"data": {}}Error Response{"success": false,"error": {"code": "NOT_FOUND","message": "User not found"}}No special cases.No custom shapes per route.If a response doesn’t match this structure, it’s wrong.Stop Returning Errors. Start Throwing Them.Instead of this pattern everywhere:if (!user) {return res.status(404).json({ error: 'User not found' });}Karos forces a different mindset:if (!user) {notFoundError('User not found');}The error is thrown, not returned.A single global handler catches it, formats it, and sends the response.No repeated try/catchNo duplicated error formattingNo forgotten status codesKarosError: One Error Model to Rule Them AllAt the core of Karos is a single class: KarosError.Every error has:A strict error code (TypeScript-safe)An explicit HTTP statusOptional structured detailsA guaranteed JSON shapeThis makes backend behavior predictable and frontend handling trivial.Database Errors Are Normalized AutomaticallyRaw database errors should never reach the client.Karos automatically detects and normalizes common DB errors:Prisma unique constraint → CONFLICT (409)Prisma record not found → NOT_FOUND (404)MongoDB duplicate key → CONFLICT (409)Mongoose validation errors → VALIDATION_FAILED (400)The frontend never needs to know which database you’re using.It only cares about the contract.Express and Next.js Share the Same ContractKaros supports:Express via middlewareNext.js (App Router) via Web-standard helpersBoth produce the exact same response format.That means you can switch frameworks or mix them — and your frontend logic stays unchanged.Karos API – All Methods in One PlaceCore API ReferenceCategoryFunction / ClassDescriptionSuccessok(res, data, message?, meta?)Sends a standardized success response (Express)Error BaseKarosErrorBase error class with code, status, detailsError HelpersnotFoundError()Throws 404 NOT_FOUNDvalidationError()Throws 400 VALIDATION_FAILEDunauthorizedError()Throws 401 UNAUTHORIZEDforbiddenError()Throws 403 FORBIDDENconflictError()Throws 409 CONFLICTinternalError()Throws 500 INTERNAL_ERRORhttpError()Custom error with any statusMiddlewareerrorHandlerGlobal Express error handlerDB HandlingresolveDbError()Normalizes Prisma/Mongo errorsNext.jsnextOk()Success response for App RouternextFail()Error response for App RouterhandleNextError()Global Next.js error handlerTypesErrorCodeEnum-style error codesTypesApiSuccessResponseSuccess response typeTypesApiErrorResponseError response typeWhat Karos Is NotThis matters more than features.Karos is not:A validation libraryA logging frameworkA request lifecycle managerA replacement for good architectureA silver bulletIt solves one problem and refuses to grow beyond that.How You Can Publish Your First npm Package TooIf you’re thinking “this looks doable” — it is.Here are the actual steps, no fluff.1. Create an npm AccountGo to https://www.npmjs.comSign up and verify your email2. Prepare Your Packagenpm initMake sure:name is uniquemain points to your build outputtypes points to .d.ts if using TypeScript3. Build Your Packagenpm run build(Usually outputs to dist/)4. Login to npmnpm loginEnter:UsernamePasswordEmailOTP (if 2FA enabled)5. Publishnpm publishThat’s it.No approval process. No gatekeepers.You are officially an npm package author.LinksGitHub Repository: https://github.com/Krishna-Shrivastava-1/Karosnpm Package: https://www.npmjs.com/package/karosWhy Shipping This Mattered to MeKaros won’t make headlines.It won’t go viral.But it forced me to:Design a real API contractThink about DX instead of just codeHandle edge cases like DB errors properlyShip something other people can actually useFor a first npm package, that’s a win.Final ThoughtMost backend bugs don’t come from complex logic.They come from inconsistency.Karos doesn’t make your API smarter.It makes it disciplined.And sometimes, that’s exactly what you need.

npmexpressnextjserror-handlingtypescriptopen-sourcefirst-npm-package
LeetCode 1752: Check if Array Is Sorted and Rotated – Java Solution Explained

LeetCode 1752: Check if Array Is Sorted and Rotated – Java Solution Explained

IntroductionLeetCode 1752 – Check if Array Is Sorted and Rotated is a classic array observation problem that tests your understanding of:Sorted arraysRotation logicCircular traversalEdge case handlingPattern recognitionAt first, many developers overcomplicate this problem by trying to actually rotate arrays and compare them. However, the problem can be solved using a very elegant observation.This problem is commonly asked in coding interviews because it evaluates:Logical thinkingArray traversal skillsOptimization abilityUnderstanding of rotated arraysProblem Link🔗 https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/Problem StatementGiven an array:numsReturn:trueif the array was originally sorted in non-decreasing order and then rotated some number of times.Otherwise return:falseDuplicates are allowed.Understanding RotationSuppose the original sorted array is:[1,2,3,4,5]After rotation:[3,4,5,1,2]The array is still almost sorted except for one “breaking point”.Key ObservationA sorted rotated array can have:At most one decreasing pairExample:[3,4,5,1,2]Breaking point:5 > 1Only once.Invalid Example[2,1,3,4]Breaking points:2 > 1and circularly:4 > 2Two breaking points.So answer is:falseBrute Force ApproachIntuitionTry all possible rotations.For every rotation:Rotate arrayCheck if sortedIf any rotation works → return trueBrute Force AlgorithmFor every rotation count:Create rotated arrayVerify sorted orderIf sorted:return trueElse:return falseBrute Force ComplexityTime ComplexityO(N²)because each rotation requires traversal.Space ComplexityO(N)This solution:Finds rotation pointSorts arrayRotates sorted arrayCompares with originalThis is a valid simulation-based approach.Java Solutionclass Solution { public boolean check(int[] nums) { int[] arr = new int[nums.length]; int o = 0; int mini = Integer.MIN_VALUE; int temp = 0; int maxnumind = 0; for(int a : nums) { arr[o] = a; temp = mini; mini = Math.max(mini, a); if(mini != temp) { maxnumind = o; } o++; } for(int i = 0; i < nums.length - 1; i++) { if(nums[i] > nums[i + 1]) { maxnumind = i; } } int ro = nums.length - maxnumind - 1; Arrays.sort(nums); int[] rotarr = new int[nums.length]; for(int i = 0; i < nums.length; i++) { rotarr[i] = nums[(i + ro) % nums.length]; } for(int i = 0; i < arr.length; i++) { if(rotarr[i] != arr[i]) { return false; } } return true; }}Optimized Approach (Best Solution)We do not need:SortingExtra arraysRotation simulationWe only count:decreasing pairsOptimized IntuitionFor a valid rotated sorted array:nums[i] > nums[i+1]can happen only once.Also check circular condition:last element > first elementOptimized Java Solutionclass Solution { public boolean check(int[] nums) { int count = 0; for(int i = 0; i < nums.length; i++) { if(nums[i] > nums[(i + 1) % nums.length]) { count++; } } return count <= 1; }}Why This WorksIf array is sorted and rotated:Sequence increases normallyOnly one position breaks orderIf more than one break exists:Not a rotated sorted arrayDry RunInputnums = [3,4,5,1,2]Step 1Compare adjacent elements:3 < 44 < 55 > 1 ← breaking point1 < 22 < 3 (circular)Breaking points:1Valid.Return:trueAnother Dry RunInputnums = [2,1,3,4]Comparisons:2 > 1 ← break1 < 33 < 44 > 2 ← circular breakBreaking points:2Invalid.Return:falseTime Complexity AnalysisTime ComplexityO(N log N)because of sorting.Space ComplexityO(N)extra arrays used.Optimized ApproachTime ComplexityO(N)single traversal.Space ComplexityO(1)Comparison of ApproachesApproachTime ComplexitySpace ComplexityRotation SimulationO(N log N)O(N)Decreasing Pair CountO(N)O(1)Interview ExplanationIn interviews, explain:A sorted rotated array can contain only one position where the order decreases. By counting such breaking points including circular comparison, we can determine validity in linear time.This demonstrates:Pattern recognitionCircular traversal understandingOptimization thinkingCommon Mistakes1. Forgetting Circular CheckAlways compare:nums[n-1] > nums[0]using modulo.2. Actually Rotating ArraysUnnecessary and inefficient.3. Using Strictly Increasing LogicDuplicates are allowed.So:1,1,2,2is valid.FAQsQ1. Why use modulo?To compare:last element with first elementcircularly.Q2. Why is only one break allowed?Because rotation shifts sorted order only once.Q3. Is sorting required?No.Observation-based traversal is enough.Q4. Is this problem important for interviews?Yes.It tests:Array logicRotationsOptimizationObservation skillsRelated ProblemsAfter mastering this problem, practice:Search in Rotated Sorted ArrayFind Minimum in Rotated Sorted ArrayFind Minimum in Rotated Sorted Array IIConclusionLeetCode 1752 is an excellent observation-based array problem.It teaches:Rotated array logicCircular traversalOptimization techniquesPattern recognitionThe key insight is:A sorted rotated array can have at most one decreasing point.Once you understand this observation, the optimized solution becomes extremely clean and efficient.

LeetCodeJavaArrayRotation ProblemsSortingEasy
LeetCode 1021: Remove Outermost Parentheses — Java Solution Explained

LeetCode 1021: Remove Outermost Parentheses — Java Solution Explained

IntroductionLeetCode 1021 Remove Outermost Parentheses sounds intimidating with words like "primitive decomposition" but once you strip away the fancy terminology, it is a beautifully simple problem. It builds directly on the depth-counting technique from LeetCode 1614 and is a perfect example of how one clean insight can collapse a seemingly complex problem into just a few lines of code.Here is the Link of Question -: LeetCode 1021In this article we cover plain English explanation, what "primitive" really means, two Java approaches with detailed dry runs, complexity analysis, and everything you need to ace this in an interview.What Is the Problem Really Asking?Let us ignore the formal definition for a moment and think practically.A primitive string is the smallest self-contained valid bracket group. Think of it as a top-level unit — it opens, closes completely, and is not part of a bigger bracket group.For "(()())(())":"(()())" is one primitive — it opens and fully closes"(())" is another primitive — it opens and fully closes afterNow from each primitive, remove only the outermost opening and closing bracket, keep everything inside."(()())" → remove outer → "()()""(())" → remove outer → "()"Combined → "()()()"That is literally the whole problem!Real Life Analogy — Gift Boxes Inside a Shipping BoxImagine you ordered gifts online. They all arrive in one big shipping box. Inside that box are individual gift boxes. Inside some gift boxes are smaller boxes.The "primitive decomposition" is identifying each individual gift box inside the shipping box. Removing the outermost parentheses is like removing just the outer gift box wrapping but keeping everything inside it intact.You are not unpacking the inner boxes — just peeling off one layer from each top-level group.Understanding Primitive Decomposition VisuallyFor s = "(()())(())(()(()))":( ( ) ( ) ) ( ( ) ) ( ( ) ( ( ) ) )|_________| |_______| |_____________| primitive1 primitive2 primitive3Each group that starts at depth 0 and returns to depth 0 is one primitive. Remove the outermost ( and ) from each and concatenate what remains.The depth analogy from LeetCode 1614 is the key — a primitive starts when depth goes from 0 to 1 and ends when depth returns to 0.Approach 1: Counter With Substring (Your Solution) ✅The IdeaTrack depth with a counter. Use start and end pointers to mark the boundaries of each primitive. When depth hits 0, you have found a complete primitive — append everything between start+1 and end (skipping the outermost brackets) to the result.public String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); int c = 0; int start = 0; int end = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { c++; } else { c--; } if (c == 0) { // primitive found from index start to end (inclusive) sb.append(s.substring(start + 1, end)); // skip outermost ( and ) start = end + 1; // next primitive starts after current end } end++; } return sb.toString();}Dry Run — s = "(()())(())"Tracking c, start, end at each step:i=0, ( → c=1, end=1i=1, ( → c=2, end=2i=2, ) → c=1, end=3i=3, ( → c=2, end=4i=4, ) → c=1, end=5i=5, ) → c=0 → primitive found! append s.substring(1, 5) = "()()" → start=6, end=6i=6, ( → c=1, end=7i=7, ( → c=2, end=8i=8, ) → c=1, end=9i=9, ) → c=0 → primitive found! append s.substring(7, 9) = "()" → start=10, end=10Result: "()()" + "()" = "()()()" ✅Time Complexity: O(n) — single pass plus substring operations Space Complexity: O(n) — StringBuilder stores the resultApproach 2: Counter With Depth Filter (Cleaner & More Intuitive)The IdeaInstead of tracking start/end pointers, use depth directly to decide whether to include each character. The insight is:The outermost ( of each primitive is always encountered when c goes from 0 to 1 — skip itThe outermost ) of each primitive is always encountered when c goes from 1 to 0 — skip itEvery other character is inside some primitive — include itpublic String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); int depth = 0; for (char c : s.toCharArray()) { if (c == '(') { if (depth > 0) { sb.append(c); // not the outermost (, include it } depth++; } else { depth--; if (depth > 0) { sb.append(c); // not the outermost ), include it } } } return sb.toString();}This is arguably the most elegant solution. No pointers, no substring, just one rule — if depth is already greater than 0 when you see (, it is not the outer one. If depth is still greater than 0 after decrementing on ), it is not the outer one.Dry Run — s = "()()" (Edge Case)( → depth=0, skip it, depth becomes 1) → depth becomes 0, depth=0 so skip it( → depth=0, skip it, depth becomes 1) → depth becomes 0, depth=0 so skip itResult: "" ✅ Both are primitives "()" and "()", removing outer from each gives empty string.Dry Run — s = "(()())(())(()(()))"Let us trace just which characters get included vs skipped:For the first primitive "(()())":( at depth 0 → skip (outermost opener)( at depth 1 → include) at depth 2→1 → include( at depth 1 → include) at depth 2→1 → include) at depth 1→0 → skip (outermost closer)Inner content "()()" included ✅Same logic applies to each subsequent primitive. Final result: "()()()()(())" ✅Time Complexity: O(n) — single pass Space Complexity: O(n) — StringBuilder stores resultApproach 3: Stack Based (Verbose but Clear)The IdeaUse an explicit stack to track open brackets. When the stack becomes empty after a ), you have found a complete primitive. Collect all characters between the outermost brackets.public String removeOuterParentheses(String s) { StringBuilder sb = new StringBuilder(); Stack<Character> st = new Stack<>(); int start = 0; for (int i = 0; i < s.length(); i++) { if (s.charAt(i) == '(') { st.push('('); } else { st.pop(); } if (st.empty()) { // primitive ends at i, extract inner content sb.append(s.substring(start + 1, i)); start = i + 1; } } return sb.toString();}This is the most verbose but makes the primitive detection very explicit — stack empty means primitive complete. Great for explaining your thought process in an interview before optimizing.Time Complexity: O(n) Space Complexity: O(n) — stack storageApproach ComparisonThe Stack approach is clearest for explaining primitive detection. The pointer-based counter approach (your solution) is direct and efficient. The depth-filter counter approach is the most elegant — no pointers, no substrings, just a single depth check per character. All three are O(n) time. The depth-filter approach wins on code clarity.How This Connects to the Full SeriesLooking at the bracket problem series you have been building:20 Valid Parentheses — is the string valid? 1614 Maximum Nesting Depth — how deep is the nesting? 1021 Remove Outermost Parentheses — identify and strip top-level groupsEach problem adds one more layer of understanding about bracket strings. The depth counter technique from 1614 directly powers the optimal solution here. This is pattern building at its best.Common Mistakes to AvoidOff-by-one in substring indices In your solution, s.substring(start+1, end) skips the outermost ( by using start+1, and end (not end+1) naturally excludes the outermost ) since end points to it. Getting these indices wrong by even one position gives completely wrong output.Appending the outermost brackets in the depth-filter approach The condition order matters — for (, check depth BEFORE incrementing. For ), check depth AFTER decrementing. Flipping these gives wrong results.Forgetting to update start after each primitive In pointer-based approaches, always set start = end + 1 (or start = i + 1) after appending each primitive, otherwise the next primitive's start index is wrong.FAQs — People Also AskQ1. What is a primitive valid parentheses string in LeetCode 1021? A primitive is the smallest self-contained valid bracket group that cannot be split into two smaller valid groups. It starts when depth goes from 0 to 1 and ends when depth returns to 0. For example in "(()())(())", the primitives are "(()())" and "(())".Q2. What is the most elegant solution for LeetCode 1021? The depth-filter counter approach — increment depth on (, decrement on ), and only append characters when depth is greater than 0 for ( and still greater than 0 after decrement for ). This skips outermost brackets naturally without tracking indices.Q3. What is the time complexity of LeetCode 1021? All approaches run in O(n) time with a single pass. Space complexity is O(n) for storing the output string in StringBuilder.Q4. How is LeetCode 1021 different from LeetCode 1614? LeetCode 1614 finds the maximum depth by tracking a counter. LeetCode 1021 uses the same counter technique but to identify primitive boundaries and strip their outermost characters. 1614 returns a number, 1021 returns a modified string.Q5. Is LeetCode 1021 asked in coding interviews? It appears occasionally as a follow-up to Valid Parentheses or Nesting Depth problems. The real skill it tests is understanding primitive decomposition — identifying self-contained units within a bracket string — which appears in real world parser and compiler design.Similar LeetCode Problems to Practice Next20. Valid Parentheses — Easy — validate bracket structure1614. Maximum Nesting Depth of Parentheses — Easy — find max depth1249. Minimum Remove to Make Valid Parentheses — Medium — remove minimum brackets394. Decode String — Medium — nested brackets with encoding32. Longest Valid Parentheses — Hard — longest valid substringConclusionLeetCode 1021 Remove Outermost Parentheses is a satisfying problem once you realize that "primitive decomposition" is just a fancy way of saying "find each top-level bracket group." The depth counter is the key — depth 0 to 1 marks the start of a primitive, depth 1 to 0 marks its end.The depth-filter approach is the cleanest solution — one pass, one counter, one condition. No substring, no pointers, just elegance. Master this alongside LeetCode 20 and 1614 and you will have a complete toolkit for any bracket string problem that comes your way.

StringStackEasyLeetCode
LeetCode 1833: Maximum Ice Cream Bars – Java Greedy & Counting Sort Solution Explained

LeetCode 1833: Maximum Ice Cream Bars – Java Greedy & Counting Sort Solution Explained

LeetCode 1833: Maximum Ice Cream Bars – Java Greedy Solution ExplainedBuy the Maximum Number of Ice Cream Bars Using Sorting and Greedy StrategyIntroductionLeetCode 1833, Maximum Ice Cream Bars, is a classic Greedy Algorithm problem that teaches an important optimization principle:When you want to maximize the number of items purchased with a limited budget, always buy the cheapest items first.Although the problem statement specifically mentions solving it using Counting Sort, understanding the Greedy approach first helps build intuition before moving to the optimized counting-sort solution.In this article, we'll cover:Problem intuitionGreedy strategySorting-based solutionCounting Sort optimizationDry run examplesComplexity analysisInterview insightsProblem StatementProblem Link -: Maximum Ice Cream BarsA boy has a fixed number of coins.You are given:costs[i]which represents the price of the ith ice cream bar.The boy can purchase ice cream bars in any order.Your task is to determine the maximum number of ice cream bars that can be bought without exceeding the available coins.Example 1Inputcosts = [1,3,2,4,1]coins = 7Output4ExplanationSort the costs:[1,1,2,3,4]Buy in order:1 → remaining 61 → remaining 52 → remaining 33 → remaining 0Total bars purchased:4Example 2Inputcosts = [10,6,8,7,7,8]coins = 5Output0Even the cheapest ice cream costs more than the available coins.Example 3Inputcosts = [1,6,3,1,2,5]coins = 20Output6The boy can purchase every ice cream bar.Key ObservationSuppose you have:Coins = 10and:Costs = [1,2,8]Buying:8 firstallows only:8 + 1 = 9Total bars:2But buying cheapest first:1 + 2 + 8 = 11Not possible.Try:1 + 2 = 3Still leaves room for more purchases in many cases.To maximize quantity:Always buy the cheapest available ice cream first.This immediately suggests a Greedy strategy.Approach 1: Sorting + GreedyStepsSort the array.Buy ice creams from cheapest to most expensive.Stop when coins run out.Return the count.Java Solutionclass Solution { public int maxIceCream(int[] costs, int coins) { Arrays.sort(costs); int count = 0; for (int cost : costs) { if (coins >= cost) { coins -= cost; count++; } } return count; }}Dry RunInputcosts = [1,3,2,4,1]coins = 7After Sorting[1,1,2,3,4]Purchase ProcessBuy first:coins = 7 - 1 = 6count = 1Buy second:coins = 6 - 1 = 5count = 2Buy third:coins = 5 - 2 = 3count = 3Buy fourth:coins = 3 - 3 = 0count = 4Cannot buy:4Final answer:4Why Greedy WorksThe goal is:Maximize quantitynot:Maximize money spentChoosing a more expensive ice cream earlier can only reduce the number of future purchases.Therefore:Picking the cheapest available option is always optimal.This makes Greedy the correct strategy.Follow-Up: Counting Sort SolutionThe problem explicitly asks:You must solve it using Counting Sort.Why?Because:1 <= costs[i] <= 100000The cost values have a bounded range.Instead of sorting:O(n log n)we can count frequencies.Counting Sort ApproachStep 1Create frequency array.int[] freq = new int[100001];Step 2Count occurrences.for (int cost : costs) { freq[cost]++;}Step 3Process costs from smallest to largest.for (int price = 1; price <= 100000; price++) { while (freq[price] > 0 && coins >= price) { coins -= price; freq[price]--; count++; }}Optimized Counting Sort Solutionclass Solution { public int maxIceCream(int[] costs, int coins) { int[] freq = new int[100001]; for (int cost : costs) { freq[cost]++; } int count = 0; for (int price = 1; price <= 100000; price++) { while (freq[price] > 0 && coins >= price) { coins -= price; freq[price]--; count++; } } return count; }}Complexity AnalysisSorting SolutionTime ComplexityO(n log n)Space ComplexityO(1)(ignoring sorting implementation details)Counting Sort SolutionTime ComplexityO(n + 100000)Effectively linear.Space ComplexityO(100000)for the frequency array.Which Solution Should You Use?ApproachTimeSpaceSorting + GreedyO(n log n)O(1)Counting SortO(n + 100000)O(100000)For interviews:Explain the Greedy idea first.Mention Sorting solution.Then discuss Counting Sort because the problem explicitly requires it.This demonstrates both problem-solving ability and optimization awareness.Common MistakesMistake 1Buying expensive bars first.Reduces total quantity purchased.Mistake 2Stopping after a single unaffordable item in an unsorted array.Always sort or process costs in increasing order.Mistake 3Ignoring the Counting Sort requirement.The online judge may accept sorting, but interviewers may specifically ask for the linear-time optimization.Key TakeawaysThe problem is based on Greedy selection.To maximize purchases, buy the cheapest items first.Sorting provides a simple solution.Counting Sort satisfies the problem's follow-up requirement.Greedy works because every expensive purchase reduces future buying power.Counting Sort improves performance when value ranges are bounded.ConclusionLeetCode 1833: Maximum Ice Cream Bars is an excellent Greedy Algorithm problem that demonstrates how local optimal choices can lead to a globally optimal solution.The sorting-based approach is intuitive and easy to implement, while the counting-sort optimization leverages the bounded range of costs to achieve near-linear performance.Understanding both approaches prepares you not only for coding interviews but also for real-world optimization problems involving budgets, resources, and constrained selections.

LeetCodeMediumJavaSortingGreedy ApproachCounting Sort
LeetCode 3121: Count the Number of Special Characters II – Java HashMap Solution Explained

LeetCode 3121: Count the Number of Special Characters II – Java HashMap Solution Explained

IntroductionLeetCode 3121 – Count the Number of Special Characters II is an interesting string and hashing problem that extends the logic of the previous Special Characters problem.This problem tests:Character indexingString traversalHashMap usageUppercase and lowercase handlingOrder-based conditionsUnlike Part I, this version adds an important restriction:Every lowercase occurrence must appear before the first uppercase occurrence.This additional condition makes the problem more challenging and interview-relevant.Problem Link🔗 https://leetcode.com/problems/count-the-number-of-special-characters-ii/Problem StatementYou are given a string:wordA character is called:specialif:It appears in both lowercase and uppercaseEvery lowercase occurrence appears before the first uppercase occurrenceReturn:Number of special charactersExample 1Inputword = "aaAbcBC"Output3ExplanationSpecial characters:'a''b''c'because:Lowercase letters appear firstUppercase letters appear laterExample 2Inputword = "abc"Output:0No uppercase letters exist.Example 3Inputword = "AbBCab"Output:0Explanation:Lowercase letters appear after uppercase letters.Condition fails.Key ObservationFor a character to be special:Last lowercase index < First uppercase indexThis is the entire logic of the problem.IntuitionWe need two pieces of information.For every character:Last occurrence of lowercase letterFirst occurrence of uppercase letterIf:lastLowercase < firstUppercasethen character is special.Brute Force ApproachIdeaFor every character:Traverse entire stringFind lowercase occurrencesFind uppercase occurrencesVerify ordering conditionBrute Force ComplexityTime ComplexityO(N²)because repeated traversal is required.Space ComplexityO(1)Optimized HashMap ApproachIdeaUse two HashMaps:Lowercase map stores last indexUppercase map stores first indexThen compare indices.Java Solutionclass Solution { public int numberOfSpecialChars(String word) { HashMap<Character, Integer> lower = new HashMap<>(); HashMap<Character, Integer> upper = new HashMap<>(); for(int i = 0; i < word.length(); i++) { if(word.charAt(i) >= 'a' && word.charAt(i) <= 'z') { lower.put(word.charAt(i), i); } else { if(!upper.containsKey(word.charAt(i))) { upper.put(word.charAt(i), i); } } } int ans = 0; for(int i = 0; i < word.length(); i++) { char up = Character.toUpperCase(word.charAt(i)); if(lower.containsKey(word.charAt(i)) && upper.containsKey(up)) { if(lower.get(word.charAt(i)) < upper.get(up)) { ans++; lower.remove(word.charAt(i)); upper.remove(up); } } } return ans; }}Cleaner Optimized Versionclass Solution { public int numberOfSpecialChars(String word) { int[] lastLower = new int[26]; int[] firstUpper = new int[26]; Arrays.fill(lastLower, -1); Arrays.fill(firstUpper, Integer.MAX_VALUE); for(int i = 0; i < word.length(); i++) { char ch = word.charAt(i); if(Character.isLowerCase(ch)) { lastLower[ch - 'a'] = i; } else { firstUpper[ch - 'A'] = Math.min(firstUpper[ch - 'A'], i); } } int count = 0; for(int i = 0; i < 26; i++) { if(lastLower[i] != -1 && firstUpper[i] != Integer.MAX_VALUE && lastLower[i] < firstUpper[i]) { count++; } } return count; }}Why This WorksFor every character:We store:last lowercase positionand:first uppercase positionThen simply check:lastLowercase < firstUppercaseIf true:Character satisfies problem condition.Dry RunInputword = "aaAbcBC"Step 1: Store IndicesLowercase positions:'a' → 1'b' → 3'c' → 4Uppercase positions:'A' → 2'B' → 5'C' → 6Step 2: Compare1 < 2 → valid3 < 5 → valid4 < 6 → validCount becomes:3Final Answer3Time Complexity AnalysisOptimized HashMap SolutionTime ComplexityO(N)because string traversal happens once.Space ComplexityO(1)Maximum alphabet size remains fixed.Brute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashMap / Array ApproachO(N)O(1)Interview ExplanationIn interviews, explain:A character is special only if its last lowercase occurrence appears before its first uppercase occurrence. We track indices efficiently using HashMaps or arrays.This demonstrates:String manipulation skillsIndex trackingHashing knowledgeOptimization thinkingCommon Mistakes1. Checking Only PresenceMany solutions only verify:lowercase exists && uppercase existsBut ordering condition is also required.2. Storing Wrong IndicesWe need:Last lowercase indexFirst uppercase indexnot the opposite.3. Double Counting CharactersAlways remove counted characters or use controlled traversal.4. Ignoring Case ConversionAlways convert correctly using:Character.toUpperCase(ch)FAQsQ1. Why store last lowercase occurrence?Because all lowercase letters must appear before uppercase.Q2. Why store first uppercase occurrence?Because it defines the earliest uppercase appearance.Q3. Can arrays replace HashMaps?Yes.Arrays are even more optimized because alphabet size is fixed.Q4. Is this problem interview important?Yes.It tests:String traversalIndex trackingCharacter handlingOptimization techniquesRelated ProblemsPractice these next:Count the Number of Special Characters IFirst Unique Character in a StringValid AnagramConclusionLeetCode 3121 is an excellent medium-level hashing and string problem.It teaches:Efficient index trackingHashMap usageOrder-based validationCharacter manipulationThe key insight is:A character is special only if its last lowercase occurrence appears before its first uppercase occurrence.Once this pattern becomes clear, many advanced string indexing problems become much easier.

LeetCodeJavaHashMapStringMedium
LeetCode 2095. Delete the Middle Node of a Linked List – Fast and Slow Pointer Approach

LeetCode 2095. Delete the Middle Node of a Linked List – Fast and Slow Pointer Approach

🔗 Try This Problemhttps://leetcode.com/problems/delete-the-middle-node-of-a-linked-list/🎥 Video ExplanationProblem ExplanationYou are given the head of a singly linked list. The task is to remove the middle node and return the updated list.The middle node is defined using 0-based indexing:Middle Index = ⌊n / 2⌋Where n is the total number of nodes.ExampleInput: [1, 3, 4, 7, 1, 2, 6]Index: 0 1 2 3 4 5 6n = 7Middle index = 3Node to remove = 7Output: [1, 3, 4, 1, 2, 6]Approach 1: Brute Force (Two Traversals)IdeaTraverse the list to count total nodesCompute middle indexTraverse again to delete that nodeComplexityTime Complexity: O(n)Space Complexity: O(1)LimitationThis approach requires two passes, which is not optimal when a single traversal solution exists.Approach 2: Fast and Slow Pointer (Optimal)IntuitionUse two pointers:Slow pointer moves one step at a timeFast pointer moves two steps at a timeWhen the fast pointer reaches the end of the list:Slow pointer will be at the middle nodeImportant DetailTo remove the middle node, access to the previous node is required.Therefore, maintain an additional pointer:prev → tracks node before slowAlgorithm StepsInitialize:slow = headfast = headprev = nullTraverse:Move fast by 2 stepsMove slow by 1 stepUpdate prev = slow (before moving slow)When loop ends:slow points to middle nodeprev points to node before middleDelete node:prev.next = slow.nextDetailed Dry RunInput1 → 3 → 4 → 7 → 1 → 2 → 6Initial Stateslow = 1fast = 1prev = nullIteration 1fast → 4slow → 3prev → 1Iteration 2fast → 1slow → 4prev → 3Iteration 3fast → nullslow → 7prev → 4After Loopslow = 7 (middle node)prev = 4Deletionprev.next = slow.nextResult:1 → 3 → 4 → 1 → 2 → 6Optimized Code (Java)class Solution {public ListNode deleteMiddle(ListNode head) {// Edge case: single nodeif(head == null) return head;if(head.next == null) return null;ListNode slow = head;ListNode fast = head;ListNode prev = null;// Traverse using fast and slow pointerwhile(fast != null && fast.next != null){fast = fast.next.next;prev = slow;slow = slow.next;}// Remove middle nodeprev.next = slow.next;return head;}}Complexity AnalysisTime Complexity: O(n)Space Complexity: O(1)Only one traversal of the linked listNo extra data structures usedEdge CasesSingle NodeInput: [1]Output: []Two NodesInput: [2, 1]Output: [2]Even Length ListInput: [1, 2, 3, 4]n = 4Middle index = 2Node removed = 3Key TakeawaysFast and slow pointer reduces two-pass solution to one-passTracking the previous node is necessary for deletionWorks efficiently for large linked listsA fundamental pattern used in multiple linked list problemsConclusionThe fast and slow pointer technique provides an elegant and efficient way to identify and remove the middle node in a linked list. By leveraging different traversal speeds, the problem can be solved in a single pass with constant space, making it optimal for both interviews and practical implementations.

LeetCodeMediumLinked ListFast and Slow Pointer
LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

IntroductionLeetCode 230 – Kth Smallest Element in a BST is one of the most important Binary Search Tree interview problems.This question is popular because it tests:BST propertiesInorder traversalDFS recursionTree traversal optimizationRecursive state managementUnderstanding this problem properly builds a strong foundation for advanced BST problems.Problem Link🔗 https://leetcode.com/problems/kth-smallest-element-in-a-bst/Problem StatementGiven:Root of a Binary Search TreeInteger kReturn:The kth smallest value in the BSTThe indexing is:1-indexedExample 1Inputroot = [3,1,4,null,2]k = 1Output1ExplanationBST inorder traversal becomes:[1,2,3,4]1st smallest element is:1Example 2Inputroot = [5,3,6,2,4,null,null,1]k = 3Output3Key ObservationThe most important BST property:Inorder Traversal of BST gives sorted orderExample:5/ \3 6/ \2 4/1Inorder traversal:1 → 2 → 3 → 4 → 5 → 6So:kth smallest = kth node in inorder traversalIntuitionWe perform:Left → Root → RightWhile traversing:Keep counting visited nodesWhen count becomes kStore answerNo need to traverse entire tree after finding answer.Brute Force ApproachIdeaStore complete inorder traversal in listReturn:list.get(k - 1)Brute Force Java Solutionclass Solution {public void inorder(TreeNode root, List<Integer> list) {if(root == null) return;inorder(root.left, list);list.add(root.val);inorder(root.right, list);}public int kthSmallest(TreeNode root, int k) {List<Integer> list = new ArrayList<>();inorder(root, list);return list.get(k - 1);}}Complexity of Brute ForceTime ComplexityO(N)Space ComplexityO(N)Extra list storage required.Optimized Recursive ApproachIdeaInstead of storing entire traversal:Maintain counterStop when kth node is reachedThis saves unnecessary storage.Java Solutionclass Solution {int coun = 0;int ans = -1;public void inorder(TreeNode root, int k, List<Integer> lis) {if(root == null) return;inorder(root.left, k, lis);coun++;if(coun == k) {ans = root.val;return;}inorder(root.right, k, lis);}public int kthSmallest(TreeNode root, int k) {List<Integer> lis = new ArrayList<>();inorder(root, k, lis);return ans;}}Cleaner Optimized Versionclass Solution {int count = 0;int answer = -1;public void inorder(TreeNode root, int k) {if(root == null) return;inorder(root.left, k);count++;if(count == k) {answer = root.val;return;}inorder(root.right, k);}public int kthSmallest(TreeNode root, int k) {inorder(root, k);return answer;}}Why This WorksBST inorder traversal always visits nodes in:sorted ascending orderSo:1st visited node = smallest2nd visited node = second smallestkth visited node = kth smallestDry RunInputroot = [5,3,6,2,4,null,null,1]k = 3BST Structure5/ \3 6/ \2 4/1Inorder Traversal1 → 2 → 3 → 4 → 5 → 6Counter ProgressNodeCount112233At count = 3:answer = 3Final Output3Iterative Stack ApproachIdeaUse explicit stack instead of recursion.Iterative Java Solutionclass Solution {public int kthSmallest(TreeNode root, int k) {Stack<TreeNode> stack = new Stack<>();while(true) {while(root != null) {stack.push(root);root = root.left;}root = stack.pop();k--;if(k == 0) {return root.val;}root = root.right;}}}Time Complexity AnalysisOptimized RecursiveTime ComplexityO(H + k)Where:H = tree heightWe visit only required nodesWorst case:O(N)Space ComplexityO(H)Recursive stack space.Iterative ComplexityTime ComplexityO(H + k)Space ComplexityO(H)Stack space.Follow-Up OptimizationProblem Follow-UpWhat if BST changes frequently?Example:Insert operationsDelete operationsFrequent kth smallest queriesAdvanced OptimizationStore:size of subtreeinside every node.This allows:O(log N)kth smallest queries.This concept is used in:Order Statistic TreesAugmented BSTsIndexed TreesInterview ExplanationIn interviews, explain:Inorder traversal of a BST gives nodes in sorted order. Therefore, the kth visited node during inorder traversal is the kth smallest element.This demonstrates:BST understandingDFS recursionTree traversal masteryOptimization thinkingCommon Mistakes1. Forgetting BST PropertyThis solution works because BST inorder traversal is sorted.Not true for normal binary trees.2. Using Extra Array UnnecessarilyOptimized approach avoids storing entire traversal.3. Incorrect Counter PlacementCounter must increase:AFTER left traversalBEFORE right traversal4. Forgetting Early ReturnOnce kth element is found:answer should be stored immediatelyFAQsQ1. Why does inorder traversal work?Because BST inorder traversal produces sorted order.Q2. Can this be solved iteratively?Yes.Using stack-based inorder traversal.Q3. Why is BST important here?Without BST ordering property:kth smallest cannot be determined using inorderQ4. Is this frequently asked?Yes.It is one of the most common BST interview questions.ConclusionLeetCode 230 is an excellent BST problem for mastering:Inorder traversalBST propertiesDFS recursionStack traversalTree optimizationThe core insight is:Inorder traversal of a BST always produces sorted order.Once this concept becomes intuitive, many BST interview problems become much easier.

LeetCodeKth Smallest Element in BSTBinary Search TreeJavaInorder TraversalBSTMedium
LeetCode 328: Odd Even Linked List – Clean and Easy Explanation with Multiple Approaches

LeetCode 328: Odd Even Linked List – Clean and Easy Explanation with Multiple Approaches

Try the ProblemYou can practice the problem here:https://leetcode.com/problems/odd-even-linked-list/Problem Description (In Very Simple Words)You are given the head of a linked list.Your task is:👉 Rearrange the list such that:All nodes at odd positions come firstFollowed by all nodes at even positionsImportant Clarification❗ This problem is about positions (indices), NOT values.1st node → Odd2nd node → Even3rd node → Odd4th node → EvenExample WalkthroughExample 1Input:[1,2,3,4,5]Positions:1(odd), 2(even), 3(odd), 4(even), 5(odd)Output:[1,3,5,2,4]Example 2Input:[2,1,3,5,6,4,7]Output:[2,3,6,7,1,5,4]Constraints0 <= number of nodes <= 10^4-10^6 <= Node.val <= 10^6Core Idea of the ProblemWe need to:Separate nodes into two groups:Odd index nodesEven index nodesMaintain their original orderFinally:👉 Attach even list after odd listThinking About Different ApproachesWhen solving this problem, multiple approaches may come to mind:Approach 1: Create New ListsIdeaTraverse the listCreate new nodes for odd and even positionsBuild two separate listsMerge themProblem with This Approach❌ Uses extra space❌ Not optimal (violates O(1) space requirement)❌ Code becomes messy and harder to maintainYour approach is logically correct, but:👉 It is not optimal and can be simplified a lot.Approach 2: Brute Force Using Array/ListIdeaStore nodes in an arrayRearrange based on indicesRebuild linked listComplexityTime: O(n)Space: O(n) ❌ (Not allowed)Approach 3: Optimal In-Place Approach (Best Solution)This is the cleanest and most important approach.Optimal Approach: Two Pointer Technique (In-Place)IdeaInstead of creating new nodes:👉 We rearrange the existing nodesWe maintain:odd → points to odd nodeseven → points to even nodesevenHead → stores start of even listVisualizationInput:1 → 2 → 3 → 4 → 5We separate into:Odd: 1 → 3 → 5Even: 2 → 4Final:1 → 3 → 5 → 2 → 4Step-by-Step LogicStep 1: Initialize pointersodd = headeven = head.nextevenHead = head.nextStep 2: Traverse the listWhile:even != null && even.next != nullUpdate:odd.next = odd.next.nexteven.next = even.next.nextMove pointers forward:odd = odd.nexteven = even.nextStep 3: Mergeodd.next = evenHeadClean Java Implementation (Optimal)class Solution { public ListNode oddEvenList(ListNode head) { // Edge case if(head == null || head.next == null) return head; // Initialize pointers ListNode odd = head; ListNode even = head.next; ListNode evenHead = even; // Rearranging nodes while(even != null && even.next != null){ odd.next = odd.next.next; // Link next odd even.next = even.next.next; // Link next even odd = odd.next; even = even.next; } // Attach even list after odd list odd.next = evenHead; return head; }}Dry Run (Important)Input:1 → 2 → 3 → 4 → 5Steps:Iteration 1:odd → 1, even → 2Link:1 → 32 → 4Iteration 2:odd → 3, even → 4Link:3 → 54 → nullFinal connection:5 → 2Result:1 → 3 → 5 → 2 → 4Time ComplexityO(n)We traverse the list once.Space ComplexityO(1)No extra space used.Why This Approach is BestFeatureResultExtra Space❌ NoneClean Code✅ YesEfficient✅ O(n)Interview Friendly✅ HighlyCommon Mistakes❌ Confusing values with positions❌ Creating new nodes unnecessarily❌ Forgetting to connect even list at the end❌ Breaking the list accidentallyKey LearningThis problem teaches:In-place linked list manipulationPointer handlingList partitioningFinal ThoughtsThe Odd Even Linked List problem is a classic example of how powerful pointer manipulation can be.Even though creating new nodes might seem easier at first, the in-place approach is:👉 Faster👉 Cleaner👉 Interview optimized👉 Tip: Whenever you are asked to rearrange a linked list, always think:"Can I solve this by just changing pointers instead of creating new nodes?"That’s the key to mastering linked list problems 🚀

Linked ListPointer ManipulationIn-Place AlgorithmTwo PointersLeetCode Medium
Fast and Slow Pointer Technique in Linked List: Cycle Detection, Proof, and Complete Explanation

Fast and Slow Pointer Technique in Linked List: Cycle Detection, Proof, and Complete Explanation

🚀 Before We StartTry these problems (optional but helpful):https://leetcode.com/problems/linked-list-cycle/https://leetcode.com/problems/linked-list-cycle-ii/🤔 Let’s Talk Honestly…When you first learn this technique, you’re told:👉 “Slow moves 1 step, fast moves 2 steps”👉 “If they meet → cycle exists”But your brain asks:❓ Why 2 steps?❓ Why do they meet at all?❓ Why does resetting pointer find cycle start?❓ Is this magic or logic?👉 Let’s answer each doubt one by one.🧩 Doubt 1: Why do we even use two pointers?❓ Question:Why not just use one pointer?✅ Answer:With one pointer:You can only move forwardYou cannot detect loops efficiently👉 Two pointers create a relative motionThat relative motion is the key.🧩 Doubt 2: Why fast = 2 steps and slow = 1 step?❓ Question:Why exactly 2 and 1?✅ Answer:We need:Fast speed > Slow speedSo that:👉 Fast catches up to slow🧠 Think like this:If both move same speed:Slow → 1 stepFast → 1 step👉 They will NEVER meet ❌If:Slow → 1 stepFast → 2 steps👉 Fast gains 1 node every step🔥 Key Insight:Relative speed = fast - slow = 1👉 This means fast is closing the gap by 1 node every step🧩 Doubt 3: Why do they ALWAYS meet in a cycle?❓ Question:Okay, fast is faster… but why guaranteed meeting?🧠 Imagine a Circular TrackInside a cycle, the list behaves like:Circle of length = λNow:Slow moves 1 stepFast moves 2 steps🔄 Gap BehaviorEach step:Gap = Gap - 1Because fast is catching up.Eventually:Gap = 0👉 They meet 🎯💡 Simple AnalogyTwo runners on a circular track:One is fasterOne is slower👉 Faster runner will lap and meet slower runner🧩 Doubt 4: What if there is NO cycle?❓ Question:Why does this fail without cycle?✅ Answer:If no cycle:List ends → fast reaches null👉 No loop → no meeting🧩 Doubt 5: Where do they meet?❓ Question:Do they meet at cycle start?❌ Answer:No, not necessarily.They meet somewhere inside the cycle🧩 Doubt 6: Then how do we find the cycle start?Now comes the most important part.🎯 SetupLet’s define:a = distance from head to cycle startb = distance from cycle start to meeting pointc = remaining cycleCycle length:λ = b + c🧠 What happens when they meet?Slow distance:a + bFast distance:2(a + b)Using relation:2(a + b) = a + b + kλSolve:a + b = kλ=> a = kλ - b=> a = (k-1)λ + (λ - b)💥 Final Meaninga = distance from meeting point to cycle start🔥 BIG CONCLUSION👉 Distance from head → cycle start👉 = Distance from meeting point → cycle start🧩 Doubt 7: Why resetting pointer works?❓ Question:Why move one pointer to head?✅ Answer:Because:One pointer is a away from startOther is also a away (via cycle)👉 Move both 1 step:They meet at:Cycle Start 🎯🔄 VisualizationHead → → → Cycle Start → → Meeting Point → → back to StartBoth pointers:One from headOne from meeting point👉 Same distance → meet at start🧩 Doubt 8: Can we use fast = 3 steps?❓ Question:Will this work?✅ Answer:Yes, BUT:Math becomes complexHarder to reasonNo extra benefit👉 So we use simplest:2 : 1 ratio🧠 Final Mental ModelThink in 3 steps:1. Different SpeedsFast moves faster → gap reduces2. Circular StructureCycle → positions repeat3. Guaranteed MeetingFinite positions + relative motion → collision🧩 TEMPLATE 1: Detect CycleListNode slow = head;ListNode fast = head;while(fast != null && fast.next != null){ slow = slow.next; fast = fast.next.next; if(slow == fast){ return true; }}return false;🧩 TEMPLATE 2: Find Cycle StartListNode slow = head;ListNode fast = head;while(fast != null && fast.next != null){ slow = slow.next; fast = fast.next.next; if(slow == fast){ slow = head; while(slow != fast){ slow = slow.next; fast = fast.next; } return slow; }}return null;🧩 TEMPLATE 3: Find Middle of Linked List❓ ProblemFind the middle node of a linked list.🧠 IntuitionFast moves twice as fast:When fast reaches end → slow reaches half👉 Slow = middle💻 CodeListNode slow = head;ListNode fast = head;while(fast != null && fast.next != null){ slow = slow.next; fast = fast.next.next;}return slow;⚠️ Even Length Case1 → 2 → 3 → 4 → 5 → 6👉 Returns 4 (second middle)❓ How to Get First Middle?while(fast.next != null && fast.next.next != null){ slow = slow.next; fast = fast.next.next;}return slow;🧩 Where Else This Technique Is Used?Detect cycleFind cycle startFind middle nodeCheck palindrome (linked list)Split list (merge sort)Intersection problems⚙️ Time & Space ComplexityTime: O(n)Space: O(1)❌ Common MistakesForgetting fast.next != nullThinking meeting point = cycle start ❌Not resetting pointer properly🧠 Final Mental ModelThink in 3 steps:1. Speed DifferenceFast moves faster → gap reduces2. Circular NatureCycle → repeated positions3. Guaranteed MeetingFinite nodes + relative motion → collision🔥 One Line to RememberFast catches slow because it reduces the gap inside a loop.🚀 ConclusionNow you understand:✅ Why fast moves faster✅ Why they meet✅ Why meeting proves cycle✅ Why reset gives cycle start✅ How to find middle using same logic👉 This is not just a trick…It’s a mathematical guarantee based on motion and cycles.💡 Master this once, and you’ll solve multiple linked list problems easily.

Linked ListFast & Slow PointerTwo Pointer TechniqueFloyd AlgorithmDSA PatternsDeep Intuition
LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

LeetCode 3783 Mirror Distance of an Integer | Java Solution Explained

IntroductionSome problems test complex algorithms, while others focus on fundamental concepts done right.LeetCode 3783 – Mirror Distance of an Integer falls into the second category.This problem is simple yet important because it builds understanding of:Digit manipulationReversing numbersMathematical operationsIn this article, we’ll break down the problem in a clean and intuitive way, along with an optimized Java solution.🔗 Problem LinkLeetCode: Mirror Distance of an IntegerProblem StatementYou are given an integer n.The mirror distance is defined as:| n - reverse(n) |Where:reverse(n) = number formed by reversing digits of n|x| = absolute value👉 Return the mirror distance.ExamplesExample 1Input:n = 25Output:27Explanation:reverse(25) = 52|25 - 52| = 27Example 2Input:n = 10Output:9Explanation:reverse(10) = 1|10 - 1| = 9Example 3Input:n = 7Output:0Key InsightThe problem consists of two simple steps:1. Reverse the number2. Take absolute differenceIntuitionLet’s take an example:n = 120Step 1: Reverse digits120 → 021 → 21👉 Leading zeros are ignored automatically.Step 2: Compute difference|120 - 21| = 99ApproachStep-by-StepExtract digits using % 10Build reversed numberUse Math.abs() for final resultJava Codeclass Solution { // Function to reverse a number public int reverse(int k) { int rev = 0; while (k != 0) { int dig = k % 10; // get last digit k = k / 10; // remove last digit rev = rev * 10 + dig; // build reversed number } return rev; } public int mirrorDistance(int n) { // Calculate mirror distance return Math.abs(n - reverse(n)); }}Dry RunInput:n = 25Execution:Reverse → 52Difference → |25 - 52| = 27Complexity AnalysisTime ComplexityReversing number → O(d)(d = number of digits)👉 Overall: O(log n)Space Complexity👉 O(1) (no extra space used)Why This WorksDigit extraction ensures correct reversalLeading zeros automatically removedAbsolute difference ensures positive resultEdge Cases to ConsiderSingle digit → result = 0Numbers ending with zero (e.g., 10 → 1)Large numbers (up to 10⁹)Key TakeawaysSimple math problems can test core logicDigit manipulation is a must-know skillAlways handle leading zeros carefullyUse built-in functions like Math.abs() effectivelyReal-World RelevanceConcepts used here are helpful in:Number transformationsPalindrome problemsReverse integer problemsMathematical algorithmsConclusionThe Mirror Distance of an Integer problem is a great example of combining basic operations to form a meaningful solution.While simple, it reinforces important programming fundamentals that are widely used in more complex problems.Frequently Asked Questions (FAQs)1. What happens to leading zeros in reverse?They are automatically removed when stored as an integer.2. Can this be solved using strings?Yes, but integer-based approach is more efficient.3. What is the best approach?Using arithmetic operations (% and /) is optimal.

EasyArrayReverse NumberLeetCodeJava
LeetCode 61 Rotate List Java Solution | Brute Force + Optimal Approach Explained (Linked List Rotation)

LeetCode 61 Rotate List Java Solution | Brute Force + Optimal Approach Explained (Linked List Rotation)

🚀 IntroductionThe Rotate List problem is a classic linked list question frequently asked in coding interviews.It tests your understanding of:linked list traversalpointer manipulationhandling large constraints efficiently👉 Try the problem yourself: https://leetcode.com/problems/rotate-list/🧠 IntuitionRotating a list means shifting elements to the right.Example:1 → 2 → 3 → 4 → 5, k = 2 → 4 → 5 → 1 → 2 → 3Instead of rotating one by one, we can:either simulate using extra spaceor optimize using pointer manipulation📘 Problem ExplanationYou are given:Head of a linked listInteger kReturn the list after rotating it k times to the right🧩 Approach 1: Brute Force (Array-Based)💡 IdeaStore values in arrayRotate indicesrebuild linked list💻 Java Codeclass Solution { public ListNode rotateRight(ListNode head, int k) { if(head == null) return head; int count = 0; ListNode curr= head; while(curr != null){ count++; curr = curr.next; } curr = head; int[] arr = new int[count]; for(int i =0; i <count;i++){ arr[i] = curr.val; curr = curr.next; } ListNode ans = new ListNode(-1); ListNode finAns = ans; k = k % count; for(int i = 0;i < arr.length;i++){ int ind =(i+(count-k))%arr.length; ans.next = new ListNode(arr[ind]); ans = ans.next; } return finAns.next; }}🔍 Dry Run (Brute Force)Input:[1,2,3,4,5], k = 2Array:[1,2,3,4,5]After rotation logic:[4,5,1,2,3]Rebuild list → ✅ Final Answer⏱️ ComplexityTypeValueTimeO(n)SpaceO(n)⚠️ DrawbackUses extra spaceNot optimal for large inputs⚡ Approach 2: Optimal (Circular Linked List)💡 IdeaInstead of rebuilding:convert list into circularbreak at correct position💻 Java Codeclass Solution { public ListNode rotateRight(ListNode head, int k) { if (head == null || head.next == null || k == 0) return head; int length = 1; ListNode curr = head; while (curr.next != null) { curr = curr.next; length++; } curr.next = head; k = k % length; int steps = length - k; ListNode newTail = curr; while (steps-- > 0) { newTail = newTail.next; } ListNode newHead = newTail.next; newTail.next = null; return newHead; }}🔍 Dry Run (Optimal)Input: [1,2,3,4,5], k = 2Length = 5k = 2Steps = 5 - 2 = 3Move 3 steps → new tail = 3new head = 4Final:4 → 5 → 1 → 2 → 3⏱️ ComplexityTypeValueTimeO(n)SpaceO(1)📊 ComparisonApproachTimeSpaceBest ForArray (Brute)O(n)O(n)BeginnersCircular (Optimal)O(n)O(1)Interviews📚 Related ProblemsSimilar PatternLinksReverse Linked ListProblem LinkLinked List CycleProblem LinkRemove Nth Node From EndProblem Link⚠️ Common MistakesForgetting k % lengthIncorrect pointer breakingNot handling single nodeOff-by-one in traversal🎯 Key Points to RememberAlways optimize kUse circular approach for best performanceUnderstand pointer movement carefully❓ FAQQ1: Why do we use k % length?Because rotating more than length gives same result.Q2: Which approach is better?Optimal circular linked list approach.Q3: Can we use array approach in interviews?Yes, but optimal is preferred.Q4: What is the key trick here?Convert linked list into circular structure.

Linked ListTwo PointerLeetCodeJavaMedium
LeetCode 3751: Total Waviness of Numbers in Range I – Java Solution with Dry Run and Explanation

LeetCode 3751: Total Waviness of Numbers in Range I – Java Solution with Dry Run and Explanation

IntroductionLeetCode 3751 introduces an interesting digit-based pattern problem where we calculate the total waviness of numbers inside a given range.This problem combines:Digit traversalPattern recognitionPeaks and valleys logicString manipulationBrute force iterationThe problem is straightforward once we clearly understand how peaks and valleys work.Problem StatementYou are given two integers:num1 and num2representing the inclusive range:[num1, num2]For every number:A digit is called a peak if it is strictly greater than both neighbors.A digit is called a valley if it is strictly smaller than both neighbors.The first and last digits can never be peaks or valleys.Return the total waviness across all numbers in the range.ExampleInputnum1 = 120num2 = 130Output3ExplanationNumbers contributing to waviness:120 → 2 is a peak → waviness = 1121 → 2 is a peak → waviness = 1130 → 3 is a peak → waviness = 1Total:1 + 1 + 1 = 3Understanding Peaks and ValleysPeak ConditionA digit is a peak if:digit > left neighborANDdigit > right neighborExample:484Here:8 > 48 > 4So 8 is a peak.Valley ConditionA digit is a valley if:digit < left neighborANDdigit < right neighborExample:202Here:0 < 20 < 2So 0 is a valley.Key ObservationWe only need to check:index 1 to length-2because:First digit has no left neighborLast digit has no right neighborIntuitionThe simplest way:Iterate through every number in the rangeConvert number into charactersCheck each middle digitCount peaks and valleysAdd to final answerSince constraints are small:num2 <= 10^5a brute force approach works efficiently.Java Solutionclass Solution { public int totalWaviness(int num1, int num2) { int ans = 0; if(num1 == num2) { int temp = num1; String c = Integer.toString(temp); char[] arr = c.toCharArray(); for(int i = 1; i < arr.length - 1; i++) { if((arr[i] < arr[i - 1] && arr[i] < arr[i + 1]) || (arr[i] > arr[i - 1] && arr[i] > arr[i + 1])) { ans++; } } return ans; } for(int i = num1; i <= num2; i++) { String c = Integer.toString(i); char[] carr = c.toCharArray(); for(int j = 1; j < carr.length - 1; j++) { if((carr[j] < carr[j - 1] && carr[j] < carr[j + 1]) || (carr[j] > carr[j - 1] && carr[j] > carr[j + 1])) { ans++; } } } return ans; }}Step-by-Step ExplanationStep 1: Iterate Through Rangefor(int i = num1; i <= num2; i++)Process every number.Step 2: Convert Number to Character ArrayString c = Integer.toString(i);char[] carr = c.toCharArray();This makes digit comparison easier.Step 3: Check Middle Digitsfor(int j = 1; j < carr.length - 1; j++)Skip first and last digits.Step 4: Check Peak or Valley(carr[j] < carr[j-1] && carr[j] < carr[j+1])OR(carr[j] > carr[j-1] && carr[j] > carr[j+1])If true:ans++;Dry RunInputnum1 = 198num2 = 202Number 198Digits:1 9 8Check 9:9 > 19 > 8Peak found.Waviness:1Number 1991 9 99 is not strictly greater than right neighbor.No waviness.Number 2012 0 10 is smaller than both neighbors.Valley found.Number 2022 0 2Again:0 < 20 < 2Valley found.Final Answer198 → 1201 → 1202 → 1Total = 3Time Complexity AnalysisLet:N = num2 - num1 + 1D = number of digitsTime ComplexityO(N × D)At most:D = 6which is very small.Efficient for constraints.Space ComplexityO(D)due to character array conversion.Why Brute Force Works HereConstraints are small:num2 <= 100000So checking every number directly is acceptable.For larger constraints:Digit DP would be needed.But here:Simplicity is better.Common Mistakes1. Including First or Last DigitThese digits cannot be peaks or valleys.2. Using Non-Strict ComparisonWrong:>=<=Correct:><because definition says:strictly greaterstrictly smaller3. Forgetting Both ConditionsNeed to check:PeakValleyEdge CasesSingle Digit NumbersWaviness:0because fewer than 3 digits.Repeated DigitsExample:111No peak or valley.Alternating DigitsExample:4848Produces multiple waviness counts.Interview ExplanationIn interviews explain:Since the constraints are small, we can directly iterate through every number, convert it into digits, and count peaks and valleys by checking neighboring digits.This demonstrates:Observation skillsConstraint analysisClean implementationConclusionLeetCode 3751 is a clean implementation problem focused on:Digit traversalPattern recognitionPeaks and valleysBrute force optimizationThe key insight is:A digit contributes to waviness only if it is strictly greater or strictly smaller than both immediate neighbors.Once this condition is understood, the implementation becomes very straightforward.

LeetCodeJavaStringPeaks and ValleysBrute Force SolutionDigit ProblemsMediumArray
Ai Assistant Kas