Search Blogs

Showing results for "ArrayList"

Found 29 results

LeetCode 682 Baseball Game - Java Solution Explained

LeetCode 682 Baseball Game - Java Solution Explained

IntroductionLeetCode 682 Baseball Game is one of the cleanest and most beginner-friendly stack simulation problems on LeetCode. It does not require any fancy algorithm or deep insight — it purely tests whether you can carefully read the rules and simulate them faithfully using the right data structure.But do not let "Easy" fool you. This problem is a great place to practice thinking about which data structure fits best and why. We will solve it three different ways — Stack, ArrayList, and Deque — so you can see the tradeoffs and pick the one that makes most sense to you.You can find the problem here — LeetCode 682 Baseball Game.What Is the Problem Really Asking?You are keeping score for a baseball game with four special rules. You process a list of operations one by one and maintain a record of scores. At the end, return the total sum of all scores in the record.The four operations are:A number (like "5" or "-2") — just add that number as a new score to the record."C" — the last score was invalid, remove it from the record."D" — add a new score that is double the most recent score."+" — add a new score that is the sum of the two most recent scores.That is it. Four rules, simulate them in order, sum up what is left.Real Life Analogy — A Scoreboard With CorrectionsImagine a scoreboard operator at a sports event. They write scores on a whiteboard as the game progresses:A player scores 5 points → write 5Another player scores 2 → write 2Referee says last score was invalid → erase the last number (C)Special bonus rule kicks in → double the last valid score (D)Two scores combine → add the last two scores as one entry (+)At the end, add up everything on the whiteboard. The stack is your whiteboard — you write on top and erase from the top.Why Stack Is the Natural FitAll four operations only ever look at or modify the most recently added scores. C removes the last one. D doubles the last one. + uses the last two. This "most recent first" access pattern is the definition of LIFO — Last In First Out — which is exactly what a Stack provides.Any time a problem says "the previous score" or "the last two scores," your brain should immediately think Stack.Approach 1: Stack (Your Solution) ✅The IdeaUse a Stack of integers. For each operation:Number → parse and pushC → pop the topD → peek the top, push doubled value+ → pop top two, push both back, push their sumpublic int calPoints(String[] operations) { Stack<Integer> st = new Stack<>(); for (int i = 0; i < operations.length; i++) { String op = operations[i]; if (op.equals("C")) { st.pop(); // remove last score } else if (op.equals("D")) { st.push(st.peek() * 2); // double of last score } else if (op.equals("+")) { int prev1 = st.pop(); // most recent score int prev2 = st.pop(); // second most recent score int sum = prev1 + prev2; st.push(prev2); // put them back st.push(prev1); st.push(sum); // push the new score } else { st.push(Integer.parseInt(op)); // regular number } } // sum all remaining scores int total = 0; while (!st.empty()) { total += st.pop(); } return total;}One small improvement over your original solution — using op.equals("C") instead of op.charAt(0) == 'C'. This is cleaner and handles edge cases better since negative numbers like "-2" also start with - not a digit, so charAt(0) comparisons can get tricky. Using equals is always safer for string operations.Why the + Operation Needs Pop-Push-PopThe trickiest part is the + operation. You need the two most recent scores. Stack only lets you see the top. So you pop the first, then the second, compute the sum, then push both back before pushing the sum. This restores the record correctly — the previous two scores stay, and the new sum score is added on top.Detailed Dry Run — ops = ["5","2","C","D","+"]Let us trace every step carefully:"5" → number, parse and push Stack: [5]"2" → number, parse and push Stack: [5, 2]"C" → remove last score, pop Stack: [5]"D" → double last score, peek=5, push 10 Stack: [5, 10]"+" → sum of last two:pop prev1 = 10pop prev2 = 5sum = 15push prev2=5, push prev1=10, push sum=15 Stack: [5, 10, 15]Sum all: 5 + 10 + 15 = 30 ✅Detailed Dry Run — ops = ["5","-2","4","C","D","9","+","+"]"5" → push 5. Stack: [5]"-2" → push -2. Stack: [5, -2]"4" → push 4. Stack: [5, -2, 4]"C" → pop 4. Stack: [5, -2]"D" → peek=-2, push -4. Stack: [5, -2, -4]"9" → push 9. Stack: [5, -2, -4, 9]"+" → prev1=9, prev2=-4, sum=5. Push -4, 9, 5. Stack: [5, -2, -4, 9, 5]"+" → prev1=5, prev2=9, sum=14. Push 9, 5, 14. Stack: [5, -2, -4, 9, 5, 14]Sum: 5 + (-2) + (-4) + 9 + 5 + 14 = 27 ✅Approach 2: ArrayList (Most Readable)The IdeaArrayList gives you index-based access which makes the + operation much cleaner — no need to pop and push back. Just access the last two elements directly using size()-1 and size()-2.public int calPoints(String[] operations) { ArrayList<Integer> record = new ArrayList<>(); for (String op : operations) { int n = record.size(); if (op.equals("C")) { record.remove(n - 1); // remove last element } else if (op.equals("D")) { record.add(record.get(n - 1) * 2); // double last } else if (op.equals("+")) { // sum of last two — no need to remove and re-add! record.add(record.get(n - 1) + record.get(n - 2)); } else { record.add(Integer.parseInt(op)); } } int total = 0; for (int score : record) { total += score; } return total;}See how the + operation becomes a single line with ArrayList? record.get(n-1) + record.get(n-2) directly accesses the last two elements without any pop-push gymnastics.Dry Run — ops = ["5","2","C","D","+"]"5" → add 5. List: [5]"2" → add 2. List: [5, 2]"C" → remove last. List: [5]"D" → 5×2=10, add 10. List: [5, 10]"+" → get(0)+get(1) = 5+10=15, add 15. List: [5, 10, 15]Sum: 30 ✅Time Complexity: O(n) — single pass through operations Space Complexity: O(n) — ArrayList stores at most n scoresThe one tradeoff — remove(n-1) on an ArrayList is O(1) for the last element (no shifting needed). And get() is O(1). So this is fully O(n) overall and arguably the cleanest solution to read and understand.Approach 3: Deque (ArrayDeque — Fastest in Java)The IdeaArrayDeque is faster than Stack in Java because Stack is synchronized (thread-safe overhead) and ArrayDeque is not. For single-threaded LeetCode problems, ArrayDeque is always the better choice over Stack.public int calPoints(String[] operations) { Deque<Integer> deque = new ArrayDeque<>(); for (String op : operations) { if (op.equals("C")) { deque.pollLast(); // remove last } else if (op.equals("D")) { deque.offerLast(deque.peekLast() * 2); // double last } else if (op.equals("+")) { int prev1 = deque.pollLast(); int prev2 = deque.pollLast(); int sum = prev1 + prev2; deque.offerLast(prev2); // restore deque.offerLast(prev1); // restore deque.offerLast(sum); // new score } else { deque.offerLast(Integer.parseInt(op)); } } int total = 0; for (int score : deque) { total += score; } return total;}The logic is identical to the Stack approach. The only difference is the method names — offerLast instead of push, pollLast instead of pop, peekLast instead of peek.Time Complexity: O(n) Space Complexity: O(n)For iterating a Deque to sum, you can use a for-each loop directly — no need to pop everything out like with Stack.Approach ComparisonApproachTimeSpaceBest ForStackO(n)O(n)Classic interview answer, clear LIFO intentArrayListO(n)O(n)Cleanest code, easiest to readArrayDequeO(n)O(n)Best performance, preferred in productionAll three approaches have identical time and space complexity. The difference is purely in code style and readability. In an interview, any of these is perfectly acceptable. Mention that ArrayDeque is preferred over Stack in Java for performance if you want to impress.Why op.equals() Is Better Than op.charAt(0)Your original solution uses operations[i].charAt(0) == 'C' to check operations. This works but has a subtle risk — the + character check with charAt(0) is fine, but imagine if a future test had a number starting with C or D (it will not in this problem but defensive coding is a good habit). More importantly, "-2".charAt(0) is '-' which is fine, but using equals is semantically clearer — you are comparing the whole string, not just the first character. This shows cleaner coding habits in interviews.Edge Cases to KnowNegative numbers like "-2" Integer.parseInt("-2") handles negatives perfectly. The D operation on -2 gives -4. The + operation works correctly with negatives too. No special handling needed."C" after a "+" that added a score The problem guarantees C always has at least one score to remove. So after + adds a score, a C removes just that one new score — the previous two scores that + used remain intact. This is correct behavior and our solution handles it automatically.All scores removed If all operations are numbers followed by C operations removing every score, the stack ends up empty and the sum is 0. Our while loop handles this correctly — it simply never executes and returns 0.Only one operation A single number like ["5"] → push 5, sum is 5. Works fine.Common Mistakes to AvoidIn the + operation, forgetting to push both numbers back When you pop prev1 and prev2 to compute the sum, you must push them back onto the stack before pushing the sum. If you only push the sum without restoring prev1 and prev2, those scores disappear from the record permanently — which is wrong. The + operation only adds a new score, it does not remove the previous ones.Using charAt(0) comparison for detecting numbers Negative numbers start with -, not a digit. If you check charAt(0) >= '0' && charAt(0) <= '9' to detect numbers, you will miss negatives. The safest approach is to check for C, D, and + explicitly using equals, and fall through to the else for everything else (which covers both positive and negative numbers).Calling st.peek() or st.pop() without checking empty The problem guarantees valid operations — C always has something to remove, + always has two previous scores, D always has one. But in real code and defensive interview solutions, adding empty checks shows good habits even when the constraints guarantee safety.FAQs — People Also AskQ1. Why is Stack a good choice for LeetCode 682 Baseball Game? Because all four operations only access the most recently added scores — the last score for C and D, the last two for +. This "most recent first" access pattern is exactly what LIFO (Last In First Out) provides. Stack's push, pop, and peek all run in O(1) making it perfectly efficient.Q2. What is the time complexity of LeetCode 682? O(n) time where n is the number of operations. Each operation performs a constant number of stack operations (at most 3 pushes/pops for the + case). Space complexity is O(n) for storing scores.Q3. Why does the + operation need to pop and push back in the Stack approach? Stack only gives direct access to the top element. To get the second most recent score, you must pop the first one, peek/pop the second, then push the first one back. The ArrayList approach avoids this by using index-based access directly.Q4. What is the difference between Stack and ArrayDeque in Java for this problem? Both work correctly. ArrayDeque is faster because Stack is a legacy class that extends Vector and is synchronized (thread-safe), adding unnecessary overhead for single-threaded use. ArrayDeque has no synchronization overhead. For LeetCode and interviews, either is acceptable but ArrayDeque is technically better.Q5. Is LeetCode 682 asked in coding interviews? It appears occasionally as a warmup or screening problem. Its main value is testing whether you can carefully simulate rules without making logical errors — a skill that matters in systems programming, game development, and any domain with complex state management.Similar LeetCode Problems to Practice Next71. Simplify Path — Medium — stack simulation with path operations1047. Remove All Adjacent Duplicates In String — Easy — stack simulation735. Asteroid Collision — Medium — stack simulation with conditions150. Evaluate Reverse Polish Notation — Medium — stack with arithmetic operations, very similar pattern227. Basic Calculator II — Medium — stack with operator precedenceConclusionLeetCode 682 Baseball Game is a perfect problem to build confidence with stack simulation. The four operations are clearly defined, the rules are unambiguous, and the stack maps naturally to every operation. Once you understand why pop-push-back is needed for + in the stack approach and how ArrayList simplifies that with index access, you have genuinely understood the tradeoffs between these data structures.If you are newer to stacks, start with the ArrayList solution for clarity. Once that clicks, rewrite it with Stack to understand the LIFO mechanics. Then try ArrayDeque to understand why it is preferred in modern Java code.

LeetCodeJavaStackArrayListDequeEasy
Reverse a Stack — GFG Problem Solved (3 Approaches Explained)

Reverse a Stack — GFG Problem Solved (3 Approaches Explained)

What Is This Problem About?This is a classic stack problem from GeeksForGeeks — "Reverse a Stack" (Medium | 4 Points). You can find it on GFG by Reverse a Stack.You are given a stack. Your job is simple — reverse it. The element that was at the bottom should now be at the top, and vice versa.Example:Input: [1, 2, 3, 4] → bottom to top, so 4 is on topOutput: [1, 2, 3, 4] → after reversal, 1 is on topWait — the input and output look the same? That is because GFG displays the result top to bottom after reversal. So after reversing, 1 comes to the top, and printing top to bottom gives [1, 2, 3, 4]. The stack is indeed reversed internally.Approach 1 — Using Two Extra StacksIntuition: Pop everything from the original stack into Stack 1 — this reverses the order once. Then pop everything from Stack 1 into Stack 2 — this reverses it again, back to original order. Now push everything from Stack 2 back into the original stack. The result? The original stack is reversed.Why does this work? Two reversals cancel each other out to give you... wait, that sounds wrong. Let us trace it:Original: [1, 2, 3, 4] → top is 4After → S1: [4, 3, 2, 1] → top is 1After → S2: [1, 2, 3, 4] → top is 4Push S2 back → st: [1, 2, 3, 4] → top is 4Hmm, that brings it back to the same thing. This approach with two stacks actually does NOT work correctly — it ends up restoring the original order. This is why the approach was commented out in the original code. Good observation to catch in an interview.Lesson: Two full reversals = no change. One reversal = what we want. Keep this in mind.Approach 2 — Using an ArrayList (Clean & Simple) ✅Intuition: Pop all elements from the stack into an ArrayList. At this point, the ArrayList holds elements in reverse order (because popping reverses). Then push them back from index 0 to end. This is the clean, working solution.Stack: [1, 2, 3, 4] → top is 4Pop into ArrayList: [4, 3, 2, 1]Push back index 0→end: push 4 → st: [4] push 3 → st: [4, 3] push 2 → st: [4, 3, 2] push 1 → st: [4, 3, 2, 1] → top is now 1 ✓The stack is now reversed. 1 is on top.public static void reverseStack(Stack<Integer> st) { if (st.empty()) return; ArrayList<Integer> list = new ArrayList<>(); // Pop all elements — goes in reverse order into list while (!st.empty()) { list.add(st.pop()); } // Push back from index 0 — restores in reversed order for (int i = 0; i < list.size(); i++) { st.push(list.get(i)); }}Time Complexity: O(n) — one pass to pop, one pass to push.Space Complexity: O(n) — for the ArrayList.Why this works: When you pop all elements into a list, the top element (last inserted) goes to index 0. When you push back from index 0, that element goes in first and ends up at the bottom. The bottom element (first inserted) was popped last, sits at the end of the list, and gets pushed last — ending up on top. That is a perfect reversal.Approach 3 — Using Recursion (No Extra Space) ✅This is the most elegant approach and the one interviewers love to ask about.Intuition: Use two recursive functions:reverseStack — pops the top element, recursively reverses the rest, then inserts the popped element at the bottom.insertAtBottom — holds all elements out while inserting one element at the very bottom, then restores everything.// Insert an item at the bottom of the stackstatic void insertAtBottom(Stack<Integer> st, int item) { if (st.empty()) { st.push(item); return; } int top = st.pop(); insertAtBottom(st, item); st.push(top);}// Reverse the stackpublic static void reverseStack(Stack<Integer> st) { if (st.empty()) return; int top = st.pop(); reverseStack(st); // reverse remaining stack insertAtBottom(st, top); // put popped element at the bottom}```**Dry Run with [1, 2, 3]:**```reverseStack([1,2,3]) → pop 3, reverseStack([1,2]) reverseStack([1,2]) → pop 2, reverseStack([1]) reverseStack([1]) → pop 1, reverseStack([]) base case → return insertAtBottom([], 1) → push 1 → [1] insertAtBottom([1], 2) → 2 < 1? no → pop 1, insert 2, push 1 → [2,1]insertAtBottom([2,1], 3) → pop 1, pop 2, push 3, push 2, push 1 → [3,2,1]Final stack top → 3... wait, let us recheck display.Top is 3, which was originally at bottom. ✓ Reversed!Time Complexity: O(n²) — for each of n elements, insertAtBottom takes O(n).Space Complexity: O(n) — recursive call stack.Which Approach Should You Use?ApproachTimeSpaceSimplicityInterview ValueTwo Extra Stacks❌ Does not workO(n)SimpleLowArrayListO(n)O(n)Very EasyMediumRecursionO(n²)O(n)ModerateHighFor a coding interview, always mention the recursive approach — it shows you understand stack mechanics deeply. For production code, the ArrayList approach is cleaner and faster.Key TakeawayReversing a stack is fundamentally about understanding LIFO. Because a stack only allows access from the top, you need a systematic way to invert the order — whether that is using auxiliary storage like an ArrayList, or using the call stack itself via recursion. Both are valid. Both teach you something different about how stacks behave.The next time you see a problem that involves reversing, reordering, or inserting at the bottom of a stack — your first instinct should be recursion with insertAtBottom. It is a pattern that appears again and again in DSA.And if you want to understand Stack from Scratch?If you are just getting started with stacks or want a complete reference — I have written a detailed in-depth guide on the Stack Data Structure in Java covering everything from what a stack is, how LIFO works, all three implementations (Array, ArrayList, LinkedList), every operation explained with code, time complexity, advantages, disadvantages, real-world use cases, and six practice problems with full solutions.Check it out here → Stack Data Structure in Java: The Complete GuideIt is the perfect companion to this problem walkthrough — start there if you want the full picture, then come back here for the problem-solving side.

StackProblemsJavaMediumGeeksForGeeksReverseStack
Stack Problems Explained: NGR, NGL, NSR, NSL — The Four-Problem Family You Must Master

Stack Problems Explained: NGR, NGL, NSR, NSL — The Four-Problem Family You Must Master

IntroductionAmong all the problems built around the Stack data structure, four stand out as a family — they appear repeatedly in coding interviews, competitive programming, and real-world software systems. These four are the Next Greater to the Right (NGR), Next Greater to the Left (NGL), Next Smaller to the Right (NSR), and Next Smaller to the Left (NSL).What makes them special is not just their individual solutions — it is the fact that all four are solved by a single elegant technique called the Monotonic Stack. Learn the pattern once, and you have all four in your toolkit permanently.This guide breaks down each problem with a full solution, step-by-step dry run, edge cases, and the exact reasoning behind every decision in the code. Whether you are preparing for a technical interview or simply want to deeply understand this pattern — you are in the right place.The Story That Makes This ClickBefore any code, let us understand this family of problems with one real-world story.Imagine you are standing in a queue at a cricket stadium. Everyone in the queue has a different height. You are standing somewhere in the middle. You look to your right and ask — who is the first person taller than me? That is your Next Greater Element to the Right (NGR).Now you look to your left — who is the first person taller than me on this side? That is your Next Greater to the Left (NGL).Now instead of taller, you ask shorter — who is the first shorter person to my right? That is Next Smaller to the Right (NSR).And shorter to your left? That is Next Smaller to the Left (NSL).Same queue. Same people. Four different questions. Four different answers. This is exactly what these four problems are about — and they all share the same solution pattern.What Is a Monotonic Stack?A monotonic stack is just a regular stack with one rule — elements inside it are always maintained in a specific order, either always increasing or always decreasing from bottom to top.You never enforce this rule explicitly. It happens naturally as you pop elements that violate the order before pushing a new one. This popping step is the key insight — the moment you pop an element, you have found its answer for the current element being processed.This one pattern solves all four problems. Only two small details change between them — the direction of traversal and the comparison condition inside the while loop.The Four Problems — Quick ReferenceProblemDirectionWhat You WantProblem LinksNGRTraverse Right to LeftFirst greater on right"Next Greater Element GFG"NGLTraverse Left to RightFirst greater on left"Previous Greater Element GFG"NSRTraverse Right to LeftFirst smaller on right"Next Smaller Element GFG"NSLTraverse Left to RightFirst smaller on left"Previous Smaller Element GFG"Problem 1 — Next Greater Element to Right (NGR)GFG Problem: Search "Next Greater Element" on GeeksForGeeks Difficulty: Medium | Accuracy: 32.95% | Submissions: 515K+The QuestionFor each element in the array, find the first element to its right that is strictly greater than it. If none exists, return -1.Input: [1, 3, 2, 4] Output: [3, 4, 4, -1]Input: [6, 8, 0, 1, 3] Output: [8, -1, 1, 3, -1]Real World ExampleThink of the stock market. You have daily closing prices: [1, 3, 2, 4]. For each day, you want to know — on which future day will the price first exceed today's price? Day 1 has price 1, first exceeded on Day 2 with price 3. Day 2 has price 3, first exceeded on Day 4 with price 4. Day 3 has price 2, also first exceeded on Day 4 with price 4. Day 4 has no future day, so -1. This is exactly NGR — and it is literally used in financial software to detect price breakout points.The IntuitionThe brute force is obvious — for every element, scan everything to its right and find the first greater one. That works but it is O(n²). For an array of 10⁶ elements that becomes 10¹² operations. It will time out on any large input.The stack insight is this — traverse right to left. As you move left, the stack always holds elements you have already seen on the right side. These are the candidates for being the next greater element. Before pushing the current element, pop all stack elements that are smaller than or equal to it. Why? Because the current element is blocking them — for any future element to the left, the current element will always be encountered first, so those smaller popped elements can never be an answer for anything. Whatever remains on top of the stack after popping is the answer for the current element.Step-by-Step Dry RunArray: [1, 3, 2, 4], traversing right to left.i=3, element is 4. Stack is empty. Answer for index 3 is -1. Push 4. Stack: [4]i=2, element is 2. Top of stack is 4, which is greater than 2. Answer for index 2 is 4. Push 2. Stack: [4, 2]i=1, element is 3. Top of stack is 2, which is not greater than 3. Pop 2. Top is now 4, which is greater than 3. Answer for index 1 is 4. Push 3. Stack: [4, 3]i=0, element is 1. Top of stack is 3, which is greater than 1. Answer for index 0 is 3. Push 1. Stack: [4, 3, 1]Answers collected right to left: [-1, 4, 4, 3] After Collections.reverse(): [3, 4, 4, -1] ✓The Code// NGR — Next Greater Element to Rightclass Solution {public ArrayList<Integer> nextLargerElement(int[] arr) {ArrayList<Integer> result = new ArrayList<>();Stack<Integer> st = new Stack<>();// Traverse from RIGHT to LEFTfor (int i = arr.length - 1; i >= 0; i--) {// Pop all elements smaller than or equal to current// They can never be the answer for any element to the leftwhile (!st.empty() && arr[i] >= st.peek()) {st.pop();}// Whatever is on top now is the next greater elementif (st.empty()) {result.add(-1);} else {result.add(st.peek());}// Push current — it is a candidate for elements to the leftst.push(arr[i]);}// Collected answers right to left, so reverse before returningCollections.reverse(result);return result;}}Edge CasesAll elements decreasing — Input: [5, 4, 3, 2, 1] Output: [-1, -1, -1, -1, -1] Every element has no greater element to its right. Traversing right to left, each new element is larger than everything already in the stack, so the stack gets cleared and the answer is always -1.All elements increasing — Input: [1, 2, 3, 4, 5] Output: [2, 3, 4, 5, -1] Each element's next greater is simply the next element in the array. The last element always gets -1 since nothing exists to its right.All elements equal — Input: [3, 3, 3, 3] Output: [-1, -1, -1, -1] Equal elements do not count as greater. The pop condition uses >= so equals get removed from the stack, ensuring duplicates never answer each other.Single element — Input: [7] Output: [-1] Nothing to the right, always -1.Why only 32.95% accuracy on GFG? Most people either forget to reverse the result at the end, use the wrong comparison in the while loop, or submit a brute force O(n²) solution that times out on large inputs.Problem 2 — Next Greater Element to Left / Previous Greater Element (NGL)GFG Problem: Search "Previous Greater Element" on GeeksForGeeks Difficulty: Medium | Accuracy: 68.93% | Submissions: 7K+The QuestionFor each element in the array, find the first element to its left that is strictly greater than it. If none exists, return -1.Input: [10, 4, 2, 20, 40, 12, 30] Output: [-1, 10, 4, -1, -1, 40, 40]Real World ExampleImagine you are a junior employee at a company. For each person in the office, you want to know — who is the first senior person sitting to their left who earns more? This is NGL. It is used in organizational hierarchy systems, salary band analysis tools, and even in database query optimizers to find the nearest dominant record on the left side.The IntuitionThis is the mirror image of NGR. Instead of traversing right to left, we traverse left to right. The stack holds elements we have already seen from the left side — these are candidates for being the previous greater element. For each new element, pop everything from the stack that is smaller than or equal to it. Whatever remains on top is the first greater element to its left. Then push the current element for future use.No reverse is needed here because we are already going left to right and building the result in order.Step-by-Step Dry RunArray: [10, 4, 2, 20, 40, 12, 30], traversing left to right.i=0, element is 10. Stack is empty. Answer is -1. Push 10. Stack: [10]i=1, element is 4. Top is 10, greater than 4. Answer is 10. Push 4. Stack: [10, 4]i=2, element is 2. Top is 4, greater than 2. Answer is 4. Push 2. Stack: [10, 4, 2]i=3, element is 20. Top is 2, not greater than 20. Pop 2. Top is 4, not greater. Pop 4. Top is 10, not greater. Pop 10. Stack is empty. Answer is -1. Push 20. Stack: [20]i=4, element is 40. Top is 20, not greater. Pop 20. Stack empty. Answer is -1. Push 40. Stack: [40]i=5, element is 12. Top is 40, greater than 12. Answer is 40. Push 12. Stack: [40, 12]i=6, element is 30. Top is 12, not greater than 30. Pop 12. Top is 40, greater than 30. Answer is 40. Push 30. Stack: [40, 30]Result: [-1, 10, 4, -1, -1, 40, 40] ✓ No reverse needed.The Code// NGL — Next Greater Element to Left (Previous Greater Element)class Solution {static ArrayList<Integer> preGreaterEle(int[] arr) {Stack<Integer> st = new Stack<>();ArrayList<Integer> result = new ArrayList<>();// Traverse LEFT to RIGHT — no reverse neededfor (int i = 0; i <= arr.length - 1; i++) {// Pop all elements smaller than or equal to currentwhile (!st.empty() && arr[i] >= st.peek()) {st.pop();}// Top of stack is the previous greater elementif (!st.empty() && st.peek() > arr[i]) {result.add(st.peek());} else {result.add(-1);}// Push current for future elementsst.push(arr[i]);}return result;}}Edge CasesStrictly increasing array — Input: [10, 20, 30, 40] Output: [-1, -1, -1, -1] Each new element is larger than everything before it, so the stack always gets fully cleared. No previous greater exists for any element.First element is always -1 — regardless of its value, the first element has nothing to its left. The stack is empty at i=0, so the answer is always -1 for index 0. This is guaranteed by the logic.Duplicate values — Input: [5, 5, 5] Output: [-1, -1, -1] Equal elements do not qualify as greater. The pop condition uses >= so duplicates get removed from the stack and never answer each other.Problem 3 — Next Smaller Element to Right (NSR)GFG Problem: Search "Next Smaller Element" on GeeksForGeeks Difficulty: Medium | Accuracy: 36.26% | Submissions: 225K+The QuestionFor each element in the array, find the first element to its right that is strictly smaller than it. If none exists, return -1.Input: [4, 8, 5, 2, 25] Output: [2, 5, 2, -1, -1]Input: [13, 7, 6, 12] Output: [7, 6, -1, -1]Real World ExampleYou work at a warehouse. Shelves have items of weights: [4, 8, 5, 2, 25] kg. For each item, the system needs to find the first lighter item sitting to its right on the shelf — this is used to optimize load balancing and shelf arrangement algorithms. Item of 4 kg — first lighter to the right is 2 kg. Item of 8 kg — first lighter is 5 kg. Item of 5 kg — first lighter is 2 kg. Items of 2 kg and 25 kg have no lighter item to their right, so -1.The IntuitionNSR is structurally identical to NGR — we traverse right to left and collect answers, then reverse. The only change is the pop condition. In NGR we popped elements smaller than or equal to current because we wanted greater. Here we want smaller, so we pop elements greater than or equal to current. After popping, whatever remains on top is the first smaller element to the right.Step-by-Step Dry RunArray: [4, 8, 5, 2, 25], traversing right to left.i=4, element is 25. Stack is empty. Answer is -1. Push 25. Stack: [25]i=3, element is 2. Top is 25, which is greater than or equal to 2. Pop 25. Stack is empty. Answer is -1. Push 2. Stack: [2]i=2, element is 5. Top is 2, which is less than 5. Answer is 2. Push 5. Stack: [2, 5]i=1, element is 8. Top is 5, which is less than 8. Answer is 5. Push 8. Stack: [2, 5, 8]i=0, element is 4. Top is 8, which is greater than or equal to 4. Pop 8. Top is 5, which is greater than or equal to 4. Pop 5. Top is 2, which is less than 4. Answer is 2. Push 4. Stack: [2, 4]Answers collected right to left: [-1, -1, 2, 5, 2] After Collections.reverse(): [2, 5, 2, -1, -1] ✓The Code// NSR — Next Smaller Element to Rightclass Solution {static ArrayList<Integer> nextSmallerEle(int[] arr) {Stack<Integer> st = new Stack<>();ArrayList<Integer> result = new ArrayList<>();// Traverse RIGHT to LEFTfor (int i = arr.length - 1; i >= 0; i--) {// Pop elements greater than or equal to current// Opposite of NGR — we want smaller, so clear the bigger oneswhile (!st.empty() && arr[i] <= st.peek()) {st.pop();}// Top is now the next smaller elementif (!st.empty() && st.peek() < arr[i]) {result.add(st.peek());} else {result.add(-1);}st.push(arr[i]);}Collections.reverse(result);return result;}}Edge CasesStrictly decreasing array — Input: [5, 4, 3, 2, 1] Output: [4, 3, 2, 1, -1] Each element's next smaller is simply the next element in the array. Last element is always -1.Strictly increasing array — Input: [1, 2, 3, 4, 5] Output: [-1, -1, -1, -1, -1] No element has a smaller element to its right since the array only grows.Last element is always -1 — nothing exists to its right regardless of its value.Single element — Input: [42] Output: [-1]Why 36.26% accuracy on GFG? The most common mistake is keeping the NGR pop condition (arr[i] >= st.peek()) and only changing the problem description in your head. The pop condition must flip to arr[i] <= st.peek() for NSR. Forgetting this gives completely wrong answers that look plausible, which makes the bug hard to spot.Problem 4 — Next Smaller Element to Left / Previous Smaller Element (NSL)GFG Problem: Search "Previous Smaller Element" on GeeksForGeeksThe QuestionFor each element in the array, find the first element to its left that is strictly smaller than it. If none exists, return -1.Input: [4, 8, 5, 2, 25] Output: [-1, 4, 4, -1, 2]Real World ExampleSame warehouse. Now the system looks left instead of right. For the item weighing 8 kg, the first lighter item to its left is 4 kg. For 25 kg, the first lighter to its left is 2 kg. For 4 kg, nothing lighter exists to its left so -1. For 2 kg, nothing lighter to its left so -1. This kind of lookback query appears in time-series analysis, price history tracking, and sensor data processing.The IntuitionNSL is the mirror of NSR, exactly as NGL was the mirror of NGR. We traverse left to right (no reverse needed). We maintain a stack of candidates from the left. For each element, pop all elements greater than or equal to it — they cannot be the answer since they are not smaller. Whatever remains on top is the first smaller element to the left. Push current and move on.Step-by-Step Dry RunArray: [4, 8, 5, 2, 25], traversing left to right.i=0, element is 4. Stack is empty. Answer is -1. Push 4. Stack: [4]i=1, element is 8. Top is 4, which is less than 8. Answer is 4. Push 8. Stack: [4, 8]i=2, element is 5. Top is 8, which is greater than or equal to 5. Pop 8. Top is 4, which is less than 5. Answer is 4. Push 5. Stack: [4, 5]i=3, element is 2. Top is 5, greater than or equal to 2. Pop 5. Top is 4, greater than or equal to 2. Pop 4. Stack is empty. Answer is -1. Push 2. Stack: [2]i=4, element is 25. Top is 2, which is less than 25. Answer is 2. Push 25. Stack: [2, 25]Result: [-1, 4, 4, -1, 2] ✓ No reverse needed.The Code// NSL — Next Smaller Element to Left (Previous Smaller Element)class Solution {static ArrayList<Integer> prevSmallerEle(int[] arr) {Stack<Integer> st = new Stack<>();ArrayList<Integer> result = new ArrayList<>();// Traverse LEFT to RIGHT — no reverse neededfor (int i = 0; i < arr.length; i++) {// Pop elements greater than or equal to currentwhile (!st.empty() && arr[i] <= st.peek()) {st.pop();}// Top is the previous smaller elementif (!st.empty() && st.peek() < arr[i]) {result.add(st.peek());} else {result.add(-1);}st.push(arr[i]);}return result;}}Edge CasesFirst element is always -1 — nothing exists to its left. Stack is empty at i=0 every time.All same elements — Input: [5, 5, 5, 5] Output: [-1, -1, -1, -1] Equal elements do not qualify as smaller. The condition arr[i] <= st.peek() ensures equals are popped and never answer each other.Single element — Input: [9] Output: [-1]The Master Cheat SheetThis is the one table to save and refer to whenever you encounter any of these four problems.VariantTraverse DirectionPop ConditionReverse Result?NGR — Next Greater RightRight to Leftarr[i] >= st.peek()YesNGL — Next Greater LeftLeft to Rightarr[i] >= st.peek()NoNSR — Next Smaller RightRight to Leftarr[i] <= st.peek()YesNSL — Next Smaller LeftLeft to Rightarr[i] <= st.peek()NoTwo rules to remember forever:Rule 1 — Direction. If you are looking to the right, traverse right to left and reverse at the end. If you are looking to the left, traverse left to right and no reverse is needed.Rule 2 — Pop Condition. If you want a greater element, pop when arr[i] >= st.peek() to clear out smaller useless candidates. If you want a smaller element, pop when arr[i] <= st.peek() to clear out bigger useless candidates.Mix these two rules and you derive all four variants instantly without memorizing anything separately.Common Mistakes to AvoidWrong pop condition — Using > instead of >= in the while loop. This causes duplicate values to wrongly answer each other. Always use >= for greater problems and <= for smaller problems inside the while loop.Forgetting to reverse — For right-to-left traversals (NGR and NSR), you collect answers from right to left. You must call Collections.reverse() before returning. Skipping this is the single most common reason for wrong answers on these problems.Not checking empty stack before peek — Always check !st.empty() before calling st.peek(). An empty stack peek throws EmptyStackException at runtime and will crash your solution.Wrong if-condition after the while loop — After the while loop, the if-condition must use strict comparison. For NGR use st.peek() > arr[i]. For NSR use st.peek() < arr[i]. These must be strict — no equals sign here.Confusing traversal direction with answer direction — You traverse right to left for NGR but the answer array is filled left to right. The reverse at the end handles this. Do not try to index directly into the result array to compensate — just use reverse.Time and Space ComplexityAll four problems run in O(n) time and use O(n) space.Even though there is a while loop nested inside the for loop, each element is pushed into the stack exactly once and popped from the stack at most once. So across the entire traversal, the total number of push and pop operations combined is at most 2n — which gives O(n) overall. This is the beauty of the monotonic stack.Why These Four Problems Matter Beyond GFGThese four patterns are not just textbook exercises. They appear as the hidden sub-problem inside some of the hardest stack questions:-Largest Rectangle in Histogram uses NSR and NSL to find the left and right boundaries of each bar.Trapping Rain Water uses NGR and NGL to determine the water level above each position.Stock Span Problem is literally NGL applied directly to stock prices.Sum of Subarray Minimums uses NSR and NSL together to count contributions of each element.Once you master these four patterns deeply, a whole family of hard problems that previously seemed unapproachable suddenly becomes a matter of recognizing the pattern and applying it.Also on This BlogIf you are building your stack foundation from scratch, check out the complete deep-dive here → Stack Data Structure in Java: The Complete Guide — covering everything from what a stack is, LIFO principle, all three implementations, every operation with code, and six practice problems.

MonotonicStackNextGreaterElementStackProblemsJavaGeeksForGeeksStackPattern
Stack Data Structure in Java: The Complete In-Depth Guide

Stack Data Structure in Java: The Complete In-Depth Guide

1. What Is a Stack?A Stack is a linear data structure that stores elements in a sequential order, but with one strict rule — you can only insert or remove elements from one end, called the top.It is one of the simplest yet most powerful data structures in computer science. Its strength comes from its constraint. Because everything happens at one end, the behavior of a stack is completely predictable.The formal definition: A Stack is a linear data structure that follows the Last In, First Out (LIFO) principle — the element inserted last is the first one to be removed.Here is what a stack looks like visually: ┌──────────┐ │ 50 │ ← TOP (last inserted, first removed) ├──────────┤ │ 40 │ ├──────────┤ │ 30 │ ├──────────┤ │ 20 │ ├──────────┤ │ 10 │ ← BOTTOM (first inserted, last removed) └──────────┘When you push 60 onto this stack, it goes on top. When you pop, 60 comes out first. That is LIFO.2. Real-World AnalogiesBefore writing a single line of code, it helps to see stacks in the real world. These analogies will make the concept permanently stick.A Pile of Plates In a cafeteria, clean plates are stacked on top of each other. You always pick the top plate. You always place a new plate on top. You never reach into the middle. This is a stack.Browser Back Button Every time you visit a new webpage, it gets pushed onto a history stack. When you press the Back button, the browser pops the most recent page off the stack and takes you there. The page you visited first is at the bottom — you only reach it after going back through everything else.Undo Feature in Text Editors When you type in a document and press Ctrl+Z, the most recent action is undone first. That is because every action you perform is pushed onto a stack. Undo simply pops from that stack.Call Stack in Programming When a function calls another function, the current function's state is pushed onto the call stack. When the inner function finishes, it is popped off and execution returns to the outer function. This is the literal stack your programs run on.A Stack of Books Put five books on a table, one on top of another. You can only take the top book without knocking the pile over. That is a stack.3. The LIFO Principle ExplainedLIFO stands for Last In, First Out.It means whatever you put in last is the first thing to come out. This is the exact opposite of a Queue (which is FIFO — First In, First Out).Let us trace through an example step by step:Start: Stack is empty → []Push 10 → [10] (10 is at the top)Push 20 → [10, 20] (20 is at the top)Push 30 → [10, 20, 30] (30 is at the top)Pop → returns 30 (30 was last in, first out) Stack: [10, 20]Pop → returns 20 Stack: [10]Peek → returns 10 (just looks, does not remove) Stack: [10]Pop → returns 10 Stack: [] (stack is now empty)Every single operation happens only at the top. The bottom of the stack is never directly accessible.4. Stack Operations & Time ComplexityA stack supports the following core operations:OperationDescriptionTime Complexitypush(x)Insert element x onto the top of the stackO(1)pop()Remove and return the top elementO(1)peek() / top()Return the top element without removing itO(1)isEmpty()Check if the stack has no elementsO(1)isFull()Check if the stack has reached its capacity (Array only)O(1)size()Return the number of elements in the stackO(1)search(x)Find position of element from top (Java built-in only)O(n)All primary stack operations — push, pop, peek, isEmpty — run in O(1) constant time. This is what makes the stack so efficient. It does not matter whether the stack has 10 elements or 10 million — these operations are always instant.Space complexity for a stack holding n elements is O(n).5. Implementation 1 — Using a Static ArrayThis is the most fundamental way to implement a stack. We use a fixed-size array and a variable called top to track where the top of the stack currently is.How it works:top starts at -1 (stack is empty)On push: increment top, then place the element at arr[top]On pop: return arr[top], then decrement topOn peek: return arr[top] without changing it// StackUsingArray.javapublic class StackUsingArray { private int[] arr; private int top; private int capacity; // Constructor — initialize with a fixed capacity public StackUsingArray(int capacity) { this.capacity = capacity; arr = new int[capacity]; top = -1; } // Push: add element to the top public void push(int value) { if (isFull()) { System.out.println("Stack Overflow! Cannot push " + value); return; } arr[++top] = value; System.out.println("Pushed: " + value); } // Pop: remove and return top element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } return arr[top--]; } // Peek: view the top element without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return arr[top]; } // Check if stack is empty public boolean isEmpty() { return top == -1; } // Check if stack is full public boolean isFull() { return top == capacity - 1; } // Return current size public int size() { return top + 1; } // Display all elements public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = top; i >= 0; i--) { System.out.print(arr[i] + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArray stack = new StackUsingArray(5); stack.push(10); stack.push(20); stack.push(30); stack.push(40); stack.push(50); stack.push(60); // This will trigger Stack Overflow stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 10Pushed: 20Pushed: 30Pushed: 40Pushed: 50Stack Overflow! Cannot push 60Stack (top → bottom): 50 40 30 20 10Peek: 50Pop: 50Pop: 40Stack (top → bottom): 30 20 10Size: 3Key Points about Array Implementation:Fixed size — you must declare capacity upfrontVery fast — direct array index accessStack Overflow is possible if capacity is exceededMemory is pre-allocated even if stack is not full6. Implementation 2 — Using an ArrayListAn ArrayList-based stack removes the fixed-size limitation. The ArrayList grows dynamically, so you never have to worry about stack overflow due to capacity.How it works:The end of the ArrayList acts as the topadd() is used for pushremove(size - 1) is used for popget(size - 1) is used for peek// StackUsingArrayList.javaimport java.util.ArrayList;public class StackUsingArrayList { private ArrayList<Integer> list; // Constructor public StackUsingArrayList() { list = new ArrayList<>(); } // Push: add to the end (which is our top) public void push(int value) { list.add(value); System.out.println("Pushed: " + value); } // Pop: remove and return the last element public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int top = list.get(list.size() - 1); list.remove(list.size() - 1); return top; } // Peek: view the last element public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return list.get(list.size() - 1); } // Check if stack is empty public boolean isEmpty() { return list.isEmpty(); } // Return size public int size() { return list.size(); } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); for (int i = list.size() - 1; i >= 0; i--) { System.out.print(list.get(i) + " "); } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingArrayList stack = new StackUsingArrayList(); stack.push(5); stack.push(15); stack.push(25); stack.push(35); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Is Empty: " + stack.isEmpty()); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 5Pushed: 15Pushed: 25Pushed: 35Stack (top → bottom): 35 25 15 5Peek: 35Pop: 35Pop: 25Stack (top → bottom): 15 5Is Empty: falseSize: 2Key Points about ArrayList Implementation:Dynamic size — grows automatically as neededNo overflow riskSlight overhead compared to raw array due to ArrayList internalsExcellent for most practical use cases7. Implementation 3 — Using a LinkedListA LinkedList-based stack is the most memory-efficient approach when you do not know the stack size in advance. Each element (node) holds data and a pointer to the next node. The head of the LinkedList acts as the top of the stack.How it works:Each node stores a value and a reference to the node below itPush creates a new node and makes it the new headPop removes the head node and returns its valuePeek returns the head node's value without removing it// StackUsingLinkedList.javapublic class StackUsingLinkedList { // Inner Node class private static class Node { int data; Node next; Node(int data) { this.data = data; this.next = null; } } private Node top; // Head of the linked list = top of stack private int size; // Constructor public StackUsingLinkedList() { top = null; size = 0; } // Push: create new node and link it to top public void push(int value) { Node newNode = new Node(value); newNode.next = top; // new node points to current top top = newNode; // new node becomes the new top size++; System.out.println("Pushed: " + value); } // Pop: remove and return top node's data public int pop() { if (isEmpty()) { System.out.println("Stack Underflow! Stack is empty."); return -1; } int value = top.data; top = top.next; // move top pointer to next node size--; return value; } // Peek: return top node's data without removing public int peek() { if (isEmpty()) { System.out.println("Stack is empty."); return -1; } return top.data; } // Check if empty public boolean isEmpty() { return top == null; } // Return size public int size() { return size; } // Display elements from top to bottom public void display() { if (isEmpty()) { System.out.println("Stack is empty."); return; } System.out.print("Stack (top → bottom): "); Node current = top; while (current != null) { System.out.print(current.data + " "); current = current.next; } System.out.println(); } // Main method to test public static void main(String[] args) { StackUsingLinkedList stack = new StackUsingLinkedList(); stack.push(100); stack.push(200); stack.push(300); stack.push(400); stack.display(); System.out.println("Peek: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Pop: " + stack.pop()); stack.display(); System.out.println("Size: " + stack.size()); }}```**Output:**```Pushed: 100Pushed: 200Pushed: 300Pushed: 400Stack (top → bottom): 400 300 200 100Peek: 400Pop: 400Pop: 300Stack (top → bottom): 200 100Size: 2Key Points about LinkedList Implementation:Truly dynamic — each node allocated only when neededNo wasted memory from pre-allocationSlightly more memory per element (each node carries a pointer)Ideal for stacks where size is completely unknown8. Java's Built-in Stack ClassJava provides a ready-made Stack class inside java.util. It extends Vector and is thread-safe by default.// JavaBuiltinStack.javaimport java.util.Stack;public class JavaBuiltinStack { public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); // Push elements stack.push(10); stack.push(20); stack.push(30); stack.push(40); System.out.println("Stack: " + stack); // Peek — look at top without removing System.out.println("Peek: " + stack.peek()); // Pop — remove top System.out.println("Pop: " + stack.pop()); System.out.println("After pop: " + stack); // Search — returns 1-based position from top System.out.println("Search 20: position " + stack.search(20)); // isEmpty System.out.println("Is Empty: " + stack.isEmpty()); // Size System.out.println("Size: " + stack.size()); }}```**Output:**```Stack: [10, 20, 30, 40]Peek: 40Pop: 40After pop: [10, 20, 30]Search 20: position 2Is Empty: falseSize: 3Important Note: In modern Java development, it is often recommended to use Deque (specifically ArrayDeque) instead of Stack for better performance, since Stack is synchronized and carries the overhead of Vector.// Using ArrayDeque as a stack (modern preferred approach)import java.util.ArrayDeque;import java.util.Deque;public class ModernStack { public static void main(String[] args) { Deque<Integer> stack = new ArrayDeque<>(); stack.push(10); // pushes to front stack.push(20); stack.push(30); System.out.println("Top: " + stack.peek()); System.out.println("Pop: " + stack.pop()); System.out.println("Stack: " + stack); }}9. Comparison of All ImplementationsFeatureArrayArrayListLinkedListJava StackArrayDequeSizeFixedDynamicDynamicDynamicDynamicStack Overflow RiskYesNoNoNoNoMemory UsagePre-allocatedAuto-growsPer-node overheadAuto-growsAuto-growsPush TimeO(1)O(1) amortizedO(1)O(1)O(1)Pop TimeO(1)O(1)O(1)O(1)O(1)Peek TimeO(1)O(1)O(1)O(1)O(1)Thread SafeNoNoNoYesNoBest ForKnown size, max speedGeneral useUnknown/huge sizeLegacy codeModern Java10. Advantages & DisadvantagesAdvantagesAdvantageExplanationSimple to implementVery few rules and operations to worry aboutO(1) operationsPush, pop, and peek are all constant timeMemory efficientNo extra pointers needed (array-based)Supports recursionThe call stack is itself a stackEasy undo/redoNatural fit for reversible action trackingBacktrackingPerfectly suited for maze, puzzle, and game solvingExpression evaluationPowers compilers and calculatorsDisadvantagesDisadvantageExplanationLimited accessCannot access elements in the middle directlyFixed size (array)Array-based stacks overflow if size is exceededNo random accessYou cannot do stack[2] — only top is accessibleMemory waste (array)Pre-allocated array wastes space if underusedNot suitable for all problemsMany problems need queues, trees, or graphs insteadStack overflow in recursionVery deep recursion can overflow the JVM call stack11. Real-World Use Cases of StackUnderstanding when to use a stack is just as important as knowing how to implement one. Here is where stacks show up in real software:Function Call Management (Call Stack) Every time your Java program calls a method, the JVM pushes that method's frame onto the call stack. When the method returns, the frame is popped. This is why you see "StackOverflowError" when you write infinite recursion.Undo and Redo Operations Text editors, image editors (Photoshop), and IDEs use two stacks — one for undo history and one for redo history. Every action pushes onto the undo stack. Ctrl+Z pops from it and pushes to the redo stack.Browser Navigation Your browser maintains a back-stack and a forward-stack. Visiting a new page pushes to the back-stack. Pressing Back pops from it and pushes to the forward-stack.Expression Evaluation and Conversion Compilers use stacks to evaluate arithmetic expressions and convert between infix, prefix, and postfix notations. For example: 3 + 4 * 2 must be evaluated considering operator precedence — this is done with a stack.Balanced Parentheses Checking Linters, compilers, and IDEs use stacks to check if brackets are balanced: {[()]} is valid, {[(])} is not.Backtracking Algorithms Maze solving, N-Queens, Sudoku solvers, and depth-first search all use stacks (explicitly or via recursion) to backtrack to previous states when a path fails.Syntax Parsing Compilers parse source code using stacks to match opening and closing constructs like if/else, try/catch, { and }.12. Practice Problems with Full SolutionsHere is where things get really interesting. These problems will sharpen your stack intuition and prepare you for coding interviews.Problem 1 — Reverse a String Using a StackDifficulty: EasyProblem: Write a Java program to reverse a string using a Stack.Approach: Push every character of the string onto a stack, then pop them all. Since LIFO reverses the order, the characters come out reversed.// ReverseString.javaimport java.util.Stack;public class ReverseString { public static String reverse(String str) { Stack<Character> stack = new Stack<>(); // Push all characters for (char c : str.toCharArray()) { stack.push(c); } // Pop all characters to build reversed string StringBuilder reversed = new StringBuilder(); while (!stack.isEmpty()) { reversed.append(stack.pop()); } return reversed.toString(); } public static void main(String[] args) { System.out.println(reverse("hello")); // olleh System.out.println(reverse("java")); // avaj System.out.println(reverse("racecar")); // racecar (palindrome) System.out.println(reverse("datastructure")); // erutcurtasatad }}Problem 2 — Check Balanced ParenthesesDifficulty: Easy–MediumProblem: Given a string containing (, ), {, }, [, ], determine if the brackets are balanced.Approach: Push every opening bracket onto the stack. When you see a closing bracket, check if it matches the top of the stack. If it does, pop. If it does not, the string is unbalanced.// BalancedParentheses.javaimport java.util.Stack;public class BalancedParentheses { public static boolean isBalanced(String expr) { Stack<Character> stack = new Stack<>(); for (char c : expr.toCharArray()) { // Push all opening brackets if (c == '(' || c == '{' || c == '[') { stack.push(c); } // For closing brackets, check the top of stack else if (c == ')' || c == '}' || c == ']') { if (stack.isEmpty()) return false; char top = stack.pop(); if (c == ')' && top != '(') return false; if (c == '}' && top != '{') return false; if (c == ']' && top != '[') return false; } } // Stack must be empty at the end for a balanced expression return stack.isEmpty(); } public static void main(String[] args) { System.out.println(isBalanced("{[()]}")); // true System.out.println(isBalanced("{[(])}")); // false System.out.println(isBalanced("((()))")); // true System.out.println(isBalanced("{]")); // false System.out.println(isBalanced("")); // true (empty is balanced) }}Problem 3 — Reverse a Stack (Without Extra Data Structure)Difficulty: Medium–HardProblem: Reverse all elements of a stack using only recursion — no array or extra stack allowed.Approach: This is a classic recursion problem. You need two recursive functions:insertAtBottom(stack, item) — inserts an element at the very bottom of the stackreverseStack(stack) — pops all elements, reverses, and uses insertAtBottom to rebuild// ReverseStack.javaimport java.util.Stack;public class ReverseStack { // Insert an element at the bottom of the stack public static void insertAtBottom(Stack<Integer> stack, int item) { if (stack.isEmpty()) { stack.push(item); return; } int top = stack.pop(); insertAtBottom(stack, item); stack.push(top); } // Reverse the stack using insertAtBottom public static void reverseStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); reverseStack(stack); // reverse the remaining stack insertAtBottom(stack, top); // insert popped element at bottom } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(1); stack.push(2); stack.push(3); stack.push(4); stack.push(5); System.out.println("Before: " + stack); // [1, 2, 3, 4, 5] reverseStack(stack); System.out.println("After: " + stack); // [5, 4, 3, 2, 1] }}Problem 4 — Evaluate a Postfix ExpressionDifficulty: MediumProblem: Evaluate a postfix (Reverse Polish Notation) expression. Example: "2 3 4 * +" should return 14 because it is 2 + (3 * 4).Approach: Scan left to right. If you see a number, push it. If you see an operator, pop two numbers, apply the operator, and push the result.// PostfixEvaluation.javaimport java.util.Stack;public class PostfixEvaluation { public static int evaluate(String expression) { Stack<Integer> stack = new Stack<>(); String[] tokens = expression.split(" "); for (String token : tokens) { // If it's a number, push it if (token.matches("-?\\d+")) { stack.push(Integer.parseInt(token)); } // If it's an operator, pop two and apply else { int b = stack.pop(); // second operand int a = stack.pop(); // first operand switch (token) { case "+": stack.push(a + b); break; case "-": stack.push(a - b); break; case "*": stack.push(a * b); break; case "/": stack.push(a / b); break; } } } return stack.pop(); } public static void main(String[] args) { System.out.println(evaluate("2 3 4 * +")); // 14 → 2 + (3*4) System.out.println(evaluate("5 1 2 + 4 * + 3 -")); // 14 → 5+((1+2)*4)-3 System.out.println(evaluate("3 4 +")); // 7 }}Problem 5 — Next Greater ElementDifficulty: MediumProblem: For each element in an array, find the next greater element to its right. If none exists, output -1.Example: Input: [4, 5, 2, 10, 8] → Output: [5, 10, 10, -1, -1]Approach: Iterate right to left. Maintain a stack of candidates. For each element, pop all stack elements that are smaller than or equal to it — they can never be the answer for any element to the left. The top of the stack (if not empty) is the next greater element.// NextGreaterElement.javaimport java.util.Stack;import java.util.Arrays;public class NextGreaterElement { public static int[] nextGreater(int[] arr) { int n = arr.length; int[] result = new int[n]; Stack<Integer> stack = new Stack<>(); // stores elements, not indices // Traverse from right to left for (int i = n - 1; i >= 0; i--) { // Pop elements smaller than or equal to current while (!stack.isEmpty() && stack.peek() <= arr[i]) { stack.pop(); } // Next greater element result[i] = stack.isEmpty() ? -1 : stack.peek(); // Push current element for future comparisons stack.push(arr[i]); } return result; } public static void main(String[] args) { int[] arr1 = {4, 5, 2, 10, 8}; System.out.println(Arrays.toString(nextGreater(arr1))); // [5, 10, 10, -1, -1] int[] arr2 = {1, 3, 2, 4}; System.out.println(Arrays.toString(nextGreater(arr2))); // [3, 4, 4, -1] int[] arr3 = {5, 4, 3, 2, 1}; System.out.println(Arrays.toString(nextGreater(arr3))); // [-1, -1, -1, -1, -1] }}Problem 6 — Sort a Stack Using RecursionDifficulty: HardProblem: Sort a stack in ascending order (smallest on top) using only recursion — no loops, no extra data structure.// SortStack.javaimport java.util.Stack;public class SortStack { // Insert element in correct sorted position public static void sortedInsert(Stack<Integer> stack, int item) { if (stack.isEmpty() || item > stack.peek()) { stack.push(item); return; } int top = stack.pop(); sortedInsert(stack, item); stack.push(top); } // Sort the stack public static void sortStack(Stack<Integer> stack) { if (stack.isEmpty()) return; int top = stack.pop(); sortStack(stack); // sort remaining sortedInsert(stack, top); // insert top in sorted position } public static void main(String[] args) { Stack<Integer> stack = new Stack<>(); stack.push(34); stack.push(3); stack.push(31); stack.push(98); stack.push(92); stack.push(23); System.out.println("Before sort: " + stack); sortStack(stack); System.out.println("After sort: " + stack); // smallest on top }}13. Summary & Key TakeawaysA stack is a simple, elegant, and powerful data structure. Here is everything in one place:What it is: A linear data structure that follows LIFO — Last In, First Out.Core operations: push (add to top), pop (remove from top), peek (view top), isEmpty — all in O(1) time.Three ways to implement it in Java:Array-based: fast, fixed size, risk of overflowArrayList-based: dynamic, easy, slightly more overheadLinkedList-based: truly dynamic, memory-efficient per-element, best for unknown sizesWhen to use it:Undo/redo systemsBrowser navigationBalancing brackets and parenthesesEvaluating mathematical expressionsBacktracking problemsManaging recursive function callsDepth-first searchWhen NOT to use it:When you need random access to elementsWhen insertion/deletion is needed from both ends (use Deque)When you need to search efficiently (use HashMap or BST)Modern Java recommendation: Prefer ArrayDeque over the legacy Stack class for non-thread-safe scenarios. Use Stack only when you need synchronized access.The stack is one of those data structures that once you truly understand, you start seeing it everywhere — in your browser, in your IDE, in recursive algorithms, and deep within the operating system itself.This article covered everything from the fundamentals of the Stack data structure to multiple Java implementations, time complexity analysis, real-world applications, and six practice problems of increasing difficulty. Bookmark it as a reference and revisit the practice problems regularly — they are the real test of your understanding.

DataStructuresJavaStackDataStructureLIFO
LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

LeetCode 2553: Separate the Digits in an Array – Java Solution Explained (2 Easy Approaches)

IntroductionIn coding interviews and competitive programming, many problems test how well you can manipulate numbers and arrays together. One such beginner-friendly problem is LeetCode 2553 – Separate the Digits in an Array.In this problem, we are given an integer array, and we need to separate every digit of every number while maintaining the original order.This problem is excellent for practicing:Array traversalDigit extractionReverse processingArrayList usage in JavaThinking about order preservationProblem Link🔗 ProblemLeetCode 2553: Separate the Digits in an ArrayProblem StatementGiven an array of positive integers nums, return an array containing all digits of each integer in the same order they appear.ExampleInput:nums = [13,25,83,77]Output:[1,3,2,5,8,3,7,7]IntuitionThe main challenge is:Extract digits from each numberPreserve the original left-to-right orderNormally, extracting digits using % 10 gives digits in reverse order.Example:83 → 3 → 8So we need a way to restore the correct order.Approach 1 – Using String ConversionIdeaConvert every number into a string and then traverse each character.This is the simplest and most beginner-friendly approach.AlgorithmTraverse every number in the array.Convert the number into a string.Traverse each character of the string.Convert character back to integer.Store digits into ArrayList.Convert ArrayList to array.Java Code – String Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int num : nums) { String str = String.valueOf(num); for (char ch : str.toCharArray()) { list.add(ch - '0'); } } int[] ans = new int[list.size()]; for (int i = 0; i < list.size(); i++) { ans[i] = list.get(i); } return ans; }}Dry Run (String Approach)Input:nums = [13,25]Step 113 → "13"Digits added:1, 3Step 225 → "25"Digits added:2, 5Final Array:[1,3,2,5]Time Complexity & Space ComplexityTime ComplexityO(N × D)Where:N = number of elementsD = number of digitsSpace ComplexityO(N × D)For storing digits.Approach 2 – Mathematical Digit Extraction (Optimal Without String)This is the approach you implemented in your code.Instead of converting numbers into strings, we extract digits mathematically using:digit = num % 10num = num / 10But digits come in reverse order.To fix this:Traverse the original array from back to frontStore extracted digitsReverse the final resultThis avoids string conversion completely.Intuition Behind Reverse TraversalSuppose:nums = [13,25]If we traverse from the end:25 → 5,213 → 3,1Stored list:[5,2,3,1]Now reverse the list:[1,3,2,5]Correct answer achieved.Java Code – Mathematical Approachclass Solution { public int[] separateDigits(int[] nums) { ArrayList<Integer> list = new ArrayList<>(); for (int i = nums.length - 1; i >= 0; i--) { if (nums[i] < 10) { list.add(nums[i]); } else { int val = nums[i]; while (val != 0) { int digit = val % 10; val = val / 10; list.add(digit); } } } int[] ans = new int[list.size()]; int k = 0; for (int i = list.size() - 1; i >= 0; i--) { ans[k++] = list.get(i); } return ans; }}Dry Run (Mathematical Approach)Input:nums = [13,25,83]Traverse from Back83Digits extracted:3, 8List:[3,8]25Digits extracted:5,2List:[3,8,5,2]13Digits extracted:3,1List:[3,8,5,2,3,1]Reverse Final List[1,3,2,5,8,3]Correct answer.Time Complexity Analysis & Space ComplexityTime ComplexityO(N × D)Because every digit is processed once.Space ComplexityO(N × D)For storing final digits.Which Approach is Better?ApproachAdvantagesDisadvantagesString ConversionEasy to understandUses extra string conversionMathematical ExtractionBetter DSA practiceSlightly harder logicInterview PerspectiveIn interviews:Beginners should first explain the string approach.Then discuss optimization using mathematical extraction.Interviewers like when candidates:Understand digit manipulationThink about order preservationCompare multiple approachesCommon Mistakes1. Forgetting Reverse OrderUsing % 10 extracts digits backward.Example:123 → 3,2,1You must reverse later.2. Not Handling Single Digit NumbersSingle digit numbers should directly be added.3. Character Conversion MistakeWrong:list.add(ch);Correct:list.add(ch - '0');Frequently Asked Questions (FAQs)Q1. Why do digits come in reverse order?Because % 10 always extracts the last digit first.Example:123 % 10 = 3Q2. Can we solve this without ArrayList?Yes, but ArrayList makes dynamic storage easier.Q3. Which approach is more optimal?Both have similar complexity.Mathematical extraction avoids string conversion and is preferred in interviews.Q4. Is this problem important for interviews?Yes. It teaches:Number manipulationOrder handlingArray traversalBasic optimization thinkingConclusionLeetCode 2553 is a simple yet valuable beginner problem for understanding:Digit extractionArray handlingReverse traversalOrder preservationYou learned two approaches:String Conversion ApproachMathematical Digit Extraction ApproachThe mathematical solution is especially useful because it strengthens core DSA concepts and improves problem-solving skills for interviews.If you're preparing for coding interviews in Java, this is a great problem to master before moving to harder digit manipulation questions.

ArrayEasyLeetcodeDigit ExtractionJava
LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

LeetCode 39: Combination Sum – Java Backtracking Solution with Dry Run & Complexity

IntroductionIf you are preparing for coding interviews or improving your Data Structures and Algorithms skills, LeetCode 39 Combination Sum is one of the most important backtracking problems to learn. This problem helps you understand how recursion explores multiple possibilities and how combinations are generated efficiently. It is a foundational problem that builds strong problem-solving skills and prepares you for many advanced recursion and backtracking questions.Why Should You Solve This Problem?Combination Sum is not just another coding question — it teaches you how to think recursively and break a complex problem into smaller decisions. By solving it, you learn how to manage recursive paths, avoid duplicate combinations, and build interview-level backtracking intuition. Once you understand this pattern, problems like subsets, permutations, N-Queens, and Sudoku Solver become much easier to approach.LeetCode Problem LinkProblem Name: Combination SumProblem Link: Combination SumProblem StatementGiven an array of distinct integers called candidates and a target integer target, you need to return all unique combinations where the chosen numbers sum to the target.Important rules:You can use the same number unlimited times.Only unique combinations should be returned.Order of combinations does not matter.ExampleExample 1Input:candidates = [2,3,6,7]target = 7Output:[[2,2,3],[7]]Explanation2 + 2 + 3 = 77 itself equals targetUnderstanding the Problem in Simple WordsWe are given some numbers.We need to:Pick numbers from the arrayAdd them togetherReach the target sumUse numbers multiple times if neededAvoid duplicate combinationsThis problem belongs to the Backtracking + Recursion category.Real-Life AnalogyImagine you have coins of different values.You want to make an exact payment.You can reuse coins multiple times.You need to find every possible valid coin combination.This is exactly what Combination Sum does.Intuition Behind the SolutionAt every index, we have two choices:Pick the current numberSkip the current numberSince numbers can be reused unlimited times, when we pick a number, we stay at the same index.This creates a recursion tree.We continue until:Target becomes 0 → valid answerTarget becomes negative → invalid pathArray ends → stop recursionWhy Backtracking Works HereBacktracking helps us:Explore all possible combinationsUndo previous decisionsTry another pathIt is useful whenever we need:All combinationsAll subsetsPath explorationRecursive searchingApproach 1: Backtracking Using Pick and SkipCore IdeaAt every element:Either take itOr move to next elementJava Code (Pick and Skip Method)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] candidates, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == candidates.length) {return;}if (candidates[index] <= target) {current.add(candidates[index]);solve(candidates, index, target - candidates[index], current);current.remove(current.size() - 1);}solve(candidates, index + 1, target, current);}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Approach 2: Backtracking Using Loop (Optimized)This is the cleaner and more optimized version.Your code belongs to this category.Java Code (Loop-Based Backtracking)class Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}if (index == arr.length) {return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Dry Run of the AlgorithmInputcandidates = [2,3,6,7]target = 7Step-by-Step ExecutionStart:solve([2,3,6,7], index=0, target=7, [])Pick 2[2]target = 5Pick 2 again:[2,2]target = 3Pick 2 again:[2,2,2]target = 1No valid choice possible.Backtrack.Try 3[2,2,3]target = 0Valid answer found.Add:[2,2,3]Try 7[7]target = 0Valid answer found.Add:[7]Final Output[[2,2,3],[7]]Recursion Tree Visualization[]/ | | \2 3 6 7/2/2/3Every branch explores a different combination.Time Complexity AnalysisTime ComplexityO(2^Target)More accurately:O(N^(Target/minValue))Where:N = Number of candidatesTarget = Required sumReason:Every number can be picked multiple times.This creates many recursive branches.Space ComplexityO(Target)Reason:Recursion stack stores elements.Maximum recursion depth depends on target.Why We Pass Same Index AgainNotice this line:solve(arr, i, target - arr[i], current);We pass i, not i+1.Why?Because we can reuse the same number unlimited times.If we used i+1, we would move forward and lose repetition.Why Duplicate Combinations Are Not CreatedWe start loop from current index.This guarantees:[2,3]and[3,2]are not both generated.Order remains controlled.Common Mistakes Beginners Make1. Using i+1 Instead of iWrong:solve(arr, i+1, target-arr[i], current)This prevents reuse.2. Forgetting Backtracking StepWrong:current.remove(current.size()-1)Without removing, recursion keeps incorrect values.3. Missing Target == 0 Base CaseThis is where valid answer is stored.Important Interview InsightCombination Sum is a foundational problem.It helps build understanding for:Combination Sum IISubsetsPermutationsN-QueensWord SearchSudoku SolverThis question is frequently asked in coding interviews.Pattern RecognitionUse Backtracking when problem says:Find all combinationsGenerate all subsetsFind all pathsUse recursionExplore possibilitiesOptimized Thinking StrategyWhenever you see:Target sumRepeated selectionMultiple combinationsThink:Backtracking + DFSEdge CasesCase 1candidates = [2]target = 1Output:[]No possible answer.Case 2candidates = [1]target = 3Output:[[1,1,1]]Interview Answer in One Line“We use backtracking to recursively try all candidate numbers while reducing the target and backtrack whenever a path becomes invalid.”Final Java Codeclass Solution {List<List<Integer>> result = new ArrayList<>();public void solve(int[] arr, int index, int target, List<Integer> current) {if (target == 0) {result.add(new ArrayList<>(current));return;}for (int i = index; i < arr.length; i++) {if (arr[i] > target) {continue;}current.add(arr[i]);solve(arr, i, target - arr[i], current);current.remove(current.size() - 1);}}public List<List<Integer>> combinationSum(int[] candidates, int target) {solve(candidates, 0, target, new ArrayList<>());return result;}}Key TakeawaysCombination Sum uses Backtracking.Reuse same element by passing same index.Target becomes smaller in recursion.Backtracking removes last element.Very important for interview preparation.Frequently Asked QuestionsIs Combination Sum DP or Backtracking?It is primarily solved using Backtracking.Dynamic Programming can also solve it but recursion is more common.Why is this Medium difficulty?Because:Requires recursion understandingRequires backtracking logicRequires duplicate preventionCan we sort the array?Yes.Sorting can help with pruning.ConclusionLeetCode 39 Combination Sum is one of the best problems to learn recursion and backtracking.Once you understand this pattern, many interview problems become easier.The loop-based recursive solution is clean, optimized, and interview-friendly.If you master this question, you gain strong understanding of recursive decision trees and combination generation.

LeetcodeMediumRecursionBacktrackingJava
Subsets Problem (LeetCode 78) Explained | Recursion, Iterative & Bit Manipulation

Subsets Problem (LeetCode 78) Explained | Recursion, Iterative & Bit Manipulation

IntroductionThe Subsets problem (LeetCode 78) is one of the most fundamental and frequently asked questions in coding interviews. It introduces the concept of generating a power set, which is a core idea in recursion, backtracking, and combinatorics.Mastering this problem helps in solving a wide range of advanced problems like combinations, permutations, and decision-based recursion.In this article, we will explore:Intuition behind subsetsRecursive (backtracking) approachIterative (loop-based) approachBit manipulation approachTime and space complexity analysisProblem StatementGiven an integer array nums of unique elements, return all possible subsets (the power set).Key PointsEach element can either be included or excludedNo duplicate subsetsReturn subsets in any orderExamplesExample 1Input:nums = [1, 2, 3]Output:[[], [1], [2], [1,2], [3], [1,3], [2,3], [1,2,3]]Example 2Input:nums = [0]Output:[[], [0]]Key InsightFor each element, there are two choices:Include it OR Exclude itSo total subsets:2^nThis makes it a binary decision tree problem, very similar to:Permutation with SpacesBinary choices recursionBacktracking problemsApproach 1: Recursion + Backtracking (Most Important)IntuitionAt each index:Skip the elementInclude the elementBuild subsets step by step and backtrack.Java Code (With Explanation)import java.util.*;class Solution { List<List<Integer>> liss = new ArrayList<>(); void solve(int[] an, int ind, List<Integer> lis) { // Base case: reached end → one subset formed if (ind == an.length) { liss.add(new ArrayList<>(lis)); // store copy return; } // Choice 1: Do NOT include current element solve(an, ind + 1, lis); // Choice 2: Include current element lis.add(an[ind]); solve(an, ind + 1, lis); // Backtrack: remove last added element lis.remove(lis.size() - 1); } public List<List<Integer>> subsets(int[] nums) { List<Integer> lis = new ArrayList<>(); solve(nums, 0, lis); return liss; }}Dry Run (nums = [1,2])Start: [] → skip 1 → [] → skip 2 → [] → take 2 → [2] → take 1 → [1] → skip 2 → [1] → take 2 → [1,2]Final Output:[], [2], [1], [1,2]Approach 2: Iterative (Loop-Based)IntuitionStart with an empty subset:[ [] ]For each element:Add it to all existing subsetsCodeimport java.util.*;class Solution { public List<List<Integer>> subsets(int[] nums) { List<List<Integer>> result = new ArrayList<>(); result.add(new ArrayList<>()); for (int num : nums) { int size = result.size(); for (int i = 0; i < size; i++) { List<Integer> temp = new ArrayList<>(result.get(i)); temp.add(num); result.add(temp); } } return result; }}How It WorksFor [1,2,3]:Start: [[]]Add 1 → [[], [1]]Add 2 → [[], [1], [2], [1,2]]Add 3 → [[], [1], [2], [1,2], [3], [1,3], [2,3], [1,2,3]]Approach 3: Bit ManipulationIntuitionEach subset can be represented using a binary number:For n = 3:000 → []001 → [1]010 → [2]011 → [1,2]...Codeimport java.util.*;class Solution { public List<List<Integer>> subsets(int[] nums) { List<List<Integer>> result = new ArrayList<>(); int n = nums.length; int total = 1 << n; // 2^n for (int i = 0; i < total; i++) { List<Integer> subset = new ArrayList<>(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { subset.add(nums[j]); } } result.add(subset); } return result; }}Complexity AnalysisApproachTime ComplexitySpace ComplexityRecursionO(2^n)O(n) stackIterativeO(2^n)O(2^n)Bit ManipulationO(2^n)O(2^n)Why All Approaches Are O(2ⁿ)Because:Total subsets = 2ⁿEach subset takes up to O(n) to constructWhen to Use Which ApproachRecursion / Backtracking → Best for interviews (easy to explain)Iterative → Clean and beginner-friendlyBit Manipulation → Best for optimization & advanced understandingKey TakeawaysSubsets = power set problemEvery element → 2 choicesThink in terms of decision treesBacktracking = build + undo (add/remove)Common Interview VariationsSubsets with duplicatesCombination sumPermutationsK-sized subsetsConclusionThe Subsets problem is a foundational DSA concept that appears across many interview questions. Understanding all approaches—especially recursion and iterative expansion—gives a strong base for solving complex backtracking problems.If you master this pattern, you unlock a whole category of problems in recursion and combinatorics.Frequently Asked Questions (FAQs)1. Why are there 2ⁿ subsets?Because each element has 2 choices: include or exclude.2. Which approach is best for interviews?Recursion + backtracking is the most preferred.3. Is bit manipulation important?Yes, it helps in optimizing and understanding binary patterns.

LeetCodeMediumJavaRecursionBacktracking
LeetCode 143 Reorder List - Java Solution Explained

LeetCode 143 Reorder List - Java Solution Explained

IntroductionLeetCode 143 Reorder List is one of those problems that looks simple when you read it but immediately makes you wonder — where do I even start? There is no single trick that solves it. Instead it combines three separate linked list techniques into one clean solution. Mastering this problem means you have genuinely understood linked lists at an intermediate level.You can find the problem here — LeetCode 143 Reorder List.This article walks through everything — what the problem wants, the intuition behind each step, all three techniques used, a detailed dry run, complexity analysis, and common mistakes beginners make.What Is the Problem Really Asking?You have a linked list: L0 → L1 → L2 → ... → LnYou need to reorder it to: L0 → Ln → L1 → Ln-1 → L2 → Ln-2 → ...In plain English — take one node from the front, then one from the back, then one from the front, then one from the back, and keep alternating until all nodes are used.Example:Input: 1 → 2 → 3 → 4 → 5Output: 1 → 5 → 2 → 4 → 3Node 1 from front, Node 5 from back, Node 2 from front, Node 4 from back, Node 3 stays in middle.Real Life Analogy — Dealing Cards From Both EndsImagine you have a deck of cards laid out in a line face up: 1, 2, 3, 4, 5. Now you deal them by alternately picking from the left end and the right end of the line:Pick 1 from left → placePick 5 from right → place after 1Pick 2 from left → place after 5Pick 4 from right → place after 2Pick 3 (only one left) → place after 4Result: 1, 5, 2, 4, 3That is exactly what the problem wants. The challenge is doing this efficiently on a singly linked list where you cannot just index from the back.Why This Problem Is Hard for BeginnersIn an array you can just use two pointers — one at the start and one at the end — and swap/interleave easily. But a singly linked list only goes forward. You cannot go backwards. You cannot easily access the last element.This is why the problem requires a three-step approach that cleverly works around the limitations of a singly linked list.The Three Step ApproachEvery experienced developer solves this problem in exactly three steps:Step 1 — Find the middle of the linked list using the Fast & Slow Pointer techniqueStep 2 — Reverse the second half of the linked listStep 3 — Merge the two halves by alternating nodes from eachLet us understand each step deeply before looking at code.Step 1: Finding the Middle — Fast & Slow PointerThe Fast & Slow Pointer technique (also called Floyd's algorithm) uses two pointers moving at different speeds through the list:slow moves one step at a timefast moves two steps at a timeWhen fast reaches the end, slow is exactly at the middle. This works because fast covers twice the distance of slow in the same number of steps.ListNode fast = head;ListNode slow = head;while (fast.next != null && fast.next.next != null) { fast = fast.next.next; slow = slow.next;}// slow is now at the middleFor 1 → 2 → 3 → 4 → 5:Start: slow=1, fast=1Step 1: slow=2, fast=3Step 2: slow=3, fast=5 (fast.next is null, stop)Middle is node 3For 1 → 2 → 3 → 4:Start: slow=1, fast=1Step 1: slow=2, fast=3Step 2: fast.next.next is null, stopslow=2, middle is node 2After finding the middle, we cut the list in two by setting slow.next = null. This disconnects the first half from the second half.Step 2: Reversing the Second HalfOnce we have the second half starting from slow.next, we reverse it. After reversal, what was the last node becomes the first — giving us easy access to the back elements of the original list.public ListNode reverse(ListNode head) { ListNode curr = head; ListNode prev = null; while (curr != null) { ListNode next = curr.next; // save next curr.next = prev; // reverse the link prev = curr; // move prev forward curr = next; // move curr forward } return prev; // prev is the new head}For second half 3 → 4 → 5 (from the first example):Reverse → 5 → 4 → 3Now we have:First half: 1 → 2 → 3 (but 3 is the end since we cut at slow)Wait — actually after cutting at slow=3: first half is 1 → 2 → 3, second half reversed is 5 → 4Let us be precise. For 1 → 2 → 3 → 4 → 5, slow stops at 3. slow.next = null cuts to give:First half: 1 → 2 → 3 → nullSecond half before reverse: 4 → 5Second half after reverse: 5 → 4Step 3: Merging Two HalvesNow we have two lists and we merge them by alternately taking one node from each:Take from first half, take from second half, take from first half, take from second half...ListNode orig = head; // pointer for first halfListNode newhead = second; // pointer for reversed second halfwhile (newhead != null) { ListNode temp1 = orig.next; // save next of first half ListNode temp2 = newhead.next; // save next of second half orig.next = newhead; // first → second newhead.next = temp1; // second → next of first orig = temp1; // advance first half pointer newhead = temp2; // advance second half pointer}Why do we loop on newhead != null and not orig != null? Because the second half is always equal to or shorter than the first half (we cut at middle). Once the second half is exhausted, the remaining first half nodes are already in the correct position.Complete Solutionclass Solution { public ListNode reverse(ListNode head) { ListNode curr = head; ListNode prev = null; while (curr != null) { ListNode next = curr.next; curr.next = prev; prev = curr; curr = next; } return prev; } public void reorderList(ListNode head) { // Step 1: Find middle using fast & slow pointer ListNode fast = head; ListNode slow = head; while (fast.next != null && fast.next.next != null) { fast = fast.next.next; slow = slow.next; } // Step 2: Reverse second half ListNode newhead = reverse(slow.next); slow.next = null; // cut the list into two halves // Step 3: Merge two halves alternately ListNode orig = head; while (newhead != null) { ListNode temp1 = orig.next; ListNode temp2 = newhead.next; orig.next = newhead; newhead.next = temp1; orig = temp1; newhead = temp2; } }}Complete Dry Run — head = [1, 2, 3, 4, 5]Step 1: Find MiddleList: 1 → 2 → 3 → 4 → 5Initial: slow=1, fast=1Iteration 1: slow=2, fast=3Iteration 2: fast.next=4, fast.next.next=5 → slow=3, fast=5fast.next is null → stopslow is at node 3Step 2: Cut and ReverseCut: slow.next = nullFirst half: 1 → 2 → 3 → nullSecond half: 4 → 5Reverse second half 4 → 5:prev=null, curr=4 → next=5, 4.next=null, prev=4, curr=5prev=4, curr=5 → next=null, 5.next=4, prev=5, curr=nullReturn prev=5Reversed second half: 5 → 4 → nullStep 3: Mergeorig=1, newhead=5Iteration 1:temp1 = orig.next = 2temp2 = newhead.next = 4orig.next = newhead → 1.next = 5newhead.next = temp1 → 5.next = 2orig = temp1 = 2newhead = temp2 = 4List so far: 1 → 5 → 2 → 3Iteration 2:temp1 = orig.next = 3temp2 = newhead.next = nullorig.next = newhead → 2.next = 4newhead.next = temp1 → 4.next = 3orig = temp1 = 3newhead = temp2 = nullList so far: 1 → 5 → 2 → 4 → 3newhead is null → loop endsFinal result: 1 → 5 → 2 → 4 → 3 ✅Dry Run — head = [1, 2, 3, 4]Step 1: Find MiddleInitial: slow=1, fast=1Iteration 1: slow=2, fast=3fast.next=4, fast.next.next=null → stopslow is at node 2Step 2: Cut and ReverseFirst half: 1 → 2 → nullSecond half: 3 → 4Reversed: 4 → 3 → nullStep 3: Mergeorig=1, newhead=4Iteration 1:temp1=2, temp2=31.next=4, 4.next=2orig=2, newhead=3List: 1 → 4 → 2 → 3Iteration 2:temp1=null (2.next was originally 3 but we cut at slow=2, so 2.next = null... wait)Actually after cutting at slow=2, first half is 1 → 2 → null, so orig when it becomes 2, orig.next = null.temp1 = orig.next = nulltemp2 = newhead.next = null2.next = 3, 3.next = nullorig = null, newhead = nullnewhead is null → stopFinal result: 1 → 4 → 2 → 3 ✅Why slow.next = null Must Come After Saving newheadThis is a subtle but critical ordering detail in the code. Look at this sequence:ListNode newhead = reverse(slow.next); // save reversed second half FIRSTslow.next = null; // THEN cut the listIf you cut first (slow.next = null) and then try to reverse, you lose the reference to the second half entirely because slow.next is already null. Always save the second half reference before cutting.Time and Space ComplexityTime Complexity: O(n) — each of the three steps (find middle, reverse, merge) makes a single pass through the list. Total is 3 passes = O(3n) = O(n).Space Complexity: O(1) — everything is done by rearranging pointers in place. No extra arrays, no recursion stack, no additional data structures. Just a handful of pointer variables.This is the optimal solution — linear time and constant space.Alternative Approach — Using ArrayList (Simpler but O(n) Space)If you find the three-step approach hard to implement under interview pressure, here is a simpler approach using extra space:public void reorderList(ListNode head) { // store all nodes in ArrayList for random access List<ListNode> nodes = new ArrayList<>(); ListNode curr = head; while (curr != null) { nodes.add(curr); curr = curr.next; } int left = 0; int right = nodes.size() - 1; while (left < right) { nodes.get(left).next = nodes.get(right); left++; if (left == right) break; // odd number of nodes nodes.get(right).next = nodes.get(left); right--; } nodes.get(left).next = null; // terminate the list}This is much easier to understand and code. Store all nodes in an ArrayList, use two pointers from both ends, and wire up the next pointers.Time Complexity: O(n) Space Complexity: O(n) — ArrayList stores all nodesThis is acceptable in most interviews. Mention the O(1) space approach as the optimal solution if asked.Common Mistakes to AvoidNot cutting the list before merging If you do not set slow.next = null after finding the middle, the first half still points into the second half. During merging, this creates cycles and infinite loops. Always cut before merging.Wrong loop condition for finding the middle The condition fast.next != null && fast.next.next != null ensures fast does not go out of bounds when jumping two steps. Using just fast != null && fast.next != null moves slow one step too far for even-length lists.Looping on orig instead of newhead The merge loop should run while newhead != null, not while orig != null. The second half is always shorter or equal to the first half. Once the second half is done, the remaining first half is already correctly placed.Forgetting to save both temp pointers before rewiring In the merge step, you must save both orig.next and newhead.next before changing any pointers. Changing orig.next first and then trying to access orig.next to save it gives you the wrong node.How This Problem Combines Multiple PatternsThis problem is special because it does not rely on a single technique. It is a combination of three fundamental linked list operations:Fast & Slow Pointer — you saw this concept in problems like finding the middle of a list and detecting cycles (LeetCode 141, 142).Reverse a Linked List — the most fundamental linked list operation, appears in LeetCode 206 and as a subtask in dozens of problems.Merge Two Lists — similar to merging two sorted lists (LeetCode 21) but here order is not sorted, it is alternating.Solving this problem proves you are comfortable with all three patterns individually and can combine them when needed.FAQs — People Also AskQ1. What is the most efficient approach for LeetCode 143 Reorder List? The three-step approach — find middle with fast/slow pointer, reverse second half, merge alternately — runs in O(n) time and O(1) space. It is the optimal solution. The ArrayList approach is O(n) time and O(n) space but simpler to code.Q2. Why use fast and slow pointer to find the middle? Because a singly linked list has no way to access elements by index. You cannot just do list[length/2]. The fast and slow pointer technique finds the middle in a single pass without knowing the length beforehand.Q3. Why reverse the second half instead of the first half? The problem wants front-to-back alternation. If you reverse the second half, its first node is the original last node — exactly what you need to interleave with the front of the first half. Reversing the first half would give the wrong order.Q4. What is the time complexity of LeetCode 143? O(n) time for three linear passes (find middle, reverse, merge). O(1) space since all operations are in-place pointer manipulations with no extra data structures.Q5. Is LeetCode 143 asked in coding interviews? Yes, frequently at companies like Amazon, Google, Facebook, and Microsoft. It is considered a benchmark problem for linked list mastery because it requires combining three separate techniques cleanly under pressure.Similar LeetCode Problems to Practice Next206. Reverse Linked List — Easy — foundation for step 2 of this problem876. Middle of the Linked List — Easy — fast & slow pointer isolated21. Merge Two Sorted Lists — Easy — merging technique foundation234. Palindrome Linked List — Easy — also uses find middle + reverse second half148. Sort List — Medium — merge sort on linked list, uses same split techniqueConclusionLeetCode 143 Reorder List is one of the best Medium linked list problems because it forces you to think in multiple steps and combine techniques rather than apply a single pattern. The fast/slow pointer finds the middle efficiently without knowing the length. Reversing the second half turns the "cannot go backwards" limitation of singly linked lists into a non-issue. And the alternating merge weaves everything together cleanly.Work through the dry runs carefully — especially the pointer saving step in the merge. Once you see why each step is necessary and how they connect, this problem will always feel approachable no matter when it shows up in an interview.

LeetCodeJavaLinked ListTwo PointerFast Slow PointerMedium
Intersection of Two Arrays II

Intersection of Two Arrays II

LeetCode Problem 350Link of the Problem to try -: LinkGiven two integer arrays nums1 and nums2, return an array of their intersection. Each element in the result must appear as many times as it shows in both arrays and you may return the result in any order. Example 1:Input: nums1 = [1,2,2,1], nums2 = [2,2]Output: [2,2]Example 2:Input: nums1 = [4,9,5], nums2 = [9,4,9,8,4]Output: [4,9]Explanation: [9,4] is also accepted. Constraints:1 <= nums1.length, nums2.length <= 10000 <= nums1[i], nums2[i] <= 1000Solution:In this question we can build a frequency HashMap of each element and then add into the array as per it's frequency is that is a very important thing in this question to do.For creating frequency we will use getOrDefault() method in HashMap that is very useful for creating frequency as this method returns the value of that key if that key is not exist then whatever value we give that value is considered as default value for us.So, back to question here we simply create a map creating frequency of each element and if the element came again we simply increase the frequency of it then we create a ArrayList because we don't know about the size of array here so we use ArrayList after this we will iterate again on the second array and try to find that element in the map also we check it's frequency should be more than 0 and we add in the List also we decreasing the frequency of the element in the loop.At last we simply take all the elements of ArrayList and put into a array of size of that ArrayList because our questions want's ans in array that's why we have to do this step otherwise our ans is in the ArrayList and this is how we find duplicates of the number of times that element appears in both array.Code: public int[] intersect(int[] nums1, int[] nums2) { HashMap<Integer, Integer> mp = new HashMap<>(); for (int i = 0; i < nums1.length; i++) { // If you are not interested in writing getOrDefault then you can write via if statement as well // int cou =1; // if(mp.containsKey(nums1[i])){ // // int nu = mp.get(nums1[i]); // mp.put(nums1[i],mp.get(nums1[i])+1); // continue; // } // mp.put(nums1[i],cou); // Another way mp.put(nums1[i], mp.getOrDefault(nums1[i], 0) + 1); } List<Integer> lis = new ArrayList<>(); for (int i = 0; i < nums2.length; i++) { if (mp.containsKey(nums2[i]) && mp.get(nums2[i]) > 0) { lis.add(nums2[i]); } mp.put(nums2[i], mp.getOrDefault(nums2[i], 0) - 1); } int[] ans = new int[lis.size()]; for (int i = 0; i < ans.length; i++) { ans[i] = lis.get(i); } return ans; }

LeetcodeEasyHashMapHashSet
LeetCode 102: Binary Tree Level Order Traversal – Java BFS Solution Explained

LeetCode 102: Binary Tree Level Order Traversal – Java BFS Solution Explained

IntroductionLeetCode 102 – Binary Tree Level Order Traversal is one of the most important Binary Tree traversal problems for coding interviews.This problem introduces:Breadth First Search (BFS)Queue data structureLevel-by-level traversalTree traversal patternsInterview-level BFS thinkingUnlike DFS traversals like preorder, inorder, and postorder, this problem explores the tree level by level.This traversal is widely used in:Graph traversalShortest path problemsTree serializationZigzag traversalBFS-based interview questionsProblem Link🔗 https://leetcode.com/problems/binary-tree-level-order-traversal/Problem StatementGiven the root of a binary tree, return the level order traversal of its nodes' values.Traversal should happen:Level by levelLeft to rightExampleInputroot = [3,9,20,null,null,15,7]Tree Structure: 3 / \ 9 20 / \ 15 7Level Order TraversalLevel 1:[3]Level 2:[9,20]Level 3:[15,7]Final Output:[[3],[9,20],[15,7]]Understanding the ProblemThe main challenge is:Process nodes level by level.This is exactly what:Breadth First Search (BFS)is designed for.Why Queue is Used?A queue follows:First In First Out (FIFO)This ensures:Nodes are processed in insertion orderParent nodes are processed before child nodesLevels are traversed correctlyBrute Force IntuitionOne brute force idea is:Calculate height of treeTraverse each level separatelyStore nodes level by levelBrute Force ComplexityThis approach becomes inefficient because:Each level traversal may revisit nodesComplexity may become:O(N²)for skewed trees.Optimal BFS IntuitionInstead of traversing each level separately:Use a queueProcess nodes level by level naturallyAt every level:Store queue sizeProcess exactly those many nodesAdd children into queueMove to next levelKey BFS ObservationBefore processing a level:int size = queue.size();This tells us:How many nodes belong to the current level.BFS AlgorithmSteps1. Initialize QueueInsert root node.2. Process Until Queue Becomes EmptyWhile queue is not empty:Find current level sizeTraverse current levelStore valuesPush child nodes3. Store Current LevelAfter processing one level:ans.add(levelList);Java BFS Solution/** * Definition for a binary tree node. * public class TreeNode { * int val; * TreeNode left; * TreeNode right; * } */class Solution { public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> ans = new ArrayList<>(); Queue<TreeNode> queue = new LinkedList<>(); if(root == null) return ans; queue.offer(root); while(!queue.isEmpty()) { int size = queue.size(); List<Integer> level = new ArrayList<>(); for(int i = 0; i < size; i++) { root = queue.poll(); level.add(root.val); if(root.left != null) queue.offer(root.left); if(root.right != null) queue.offer(root.right); } ans.add(level); } return ans; }}Dry RunInputroot = [3,9,20,null,null,15,7]Tree: 3 / \ 9 20 / \ 15 7Initial Queue[3]Level 1Queue size:1Process:3Add children:9, 20Level result:[3]Queue now:[9,20]Level 2Queue size:2Process:9, 20Add children:15, 7Level result:[9,20]Queue now:[15,7]Level 3Queue size:2Process:15, 7Level result:[15,7]Queue becomes empty.Final Answer[[3],[9,20],[15,7]]Time Complexity AnalysisTime ComplexityO(N)Every node is visited exactly once.Space ComplexityO(N)Queue may store an entire level of nodes.DFS Alternative ApproachThis problem can also be solved using DFS recursion.Idea:Pass current level during recursionCreate new list when level appears first timeAdd node into correct level listJava DFS Solutionclass Solution { public void dfs(TreeNode root, int level, List<List<Integer>> ans) { if(root == null) return; if(level == ans.size()) { ans.add(new ArrayList<>()); } ans.get(level).add(root.val); dfs(root.left, level + 1, ans); dfs(root.right, level + 1, ans); } public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> ans = new ArrayList<>(); dfs(root, 0, ans); return ans; }}BFS vs DFS for Level Order TraversalApproachAdvantagesDisadvantagesBFSNatural level traversalUses queueDFSRecursive solutionSlightly harder intuitionInterview ExplanationIn interviews, explain:Level order traversal is a BFS problem because we process nodes level by level. A queue naturally supports this traversal order.This demonstrates strong BFS understanding.Common Mistakes1. Forgetting Queue SizeWithout storing:int size = queue.size();levels cannot be separated correctly.2. Using DFS IncorrectlySimple DFS alone does not guarantee level ordering.3. Forgetting Null CheckAlways handle:if(root == null)FAQsQ1. Why is BFS preferred here?Because BFS naturally processes nodes level by level.Q2. Can this problem be solved recursively?Yes.Using DFS with level tracking.Q3. What data structure is mainly used?Queue.Q4. Is Level Order Traversal important?Yes.It is one of the most frequently asked BFS tree problems.Related ProblemsAfter mastering this problem, practice:Binary Tree Zigzag Level Order TraversalAverage of Levels in Binary TreeRight Side View of Binary TreeBinary Tree Vertical Order TraversalMaximum Depth of Binary TreeConclusionLeetCode 102 is one of the most important BFS tree traversal problems.It teaches:BFS traversalQueue usageLevel-by-level processingTree traversal fundamentalsThe key idea is:Use queue size to separate levels.Once this intuition becomes clear, many BFS-based tree interview problems become much easier.

LeetCodeBinary Tree Level Order TraversalBFSQueueBinary TreeJavaTree TraversalMedium
Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

Permutation with Spaces Explained Using Recursion & Decision Tree | Java Solution GFG

IntroductionThe Permutation with Spaces problem is a classic recursion question that helps build a strong understanding of decision-making and backtracking patterns.Instead of generating permutations by rearranging characters, this problem focuses on inserting spaces between characters in all possible ways.What makes this problem powerful is its decision tree structure, which you’ve already visualized perfectly. In this article, we will directly connect that intuition with code.Link of Problem: GeeksforGeeks – Permutation with SpacesProblem StatementGiven a string s, generate all possible strings by placing:Either a spaceOr no spacebetween every pair of characters.Return all results in sorted order.ExampleInput:s = "ABC"Output:A B CA BCAB CABCUnderstanding Your Decision Tree (Very Important)Two Choices at Each Step:❌ Do NOT add space before the character✔️ Add space before the characterMapping TreeFrom diagram:At B:"AB" → no space"A B" → spaceAt C:From "AB":"ABC""AB C"From "A B":"A BC""A B C"Final Output (Leaf Nodes)As shown in your diagram:ABC, AB C, A BC, A B C📌 This is exactly what recursion generates.Key InsightAt every index (except first), we have:2 choices → space OR no spaceSo total combinations:2^(n-1)Approach: Recursion + Decision MakingIdeaFix the first characterFor every next character:Add space + characterAdd character directlyContinue recursivelyJava Code with Detailed Commentsimport java.util.*;class Solution { // List to store all results ArrayList<String> lis = new ArrayList<>(); void solve(String s, int ind, String curr) { // Base case: // If index reaches end of string, // we have formed one valid permutation if (ind == s.length()) { lis.add(curr); // store the result return; } // Choice 1: Add SPACE before current character // Example: "A" → "A B" solve(s, ind + 1, curr + " " + s.charAt(ind)); // Choice 2: Do NOT add space // Example: "A" → "AB" solve(s, ind + 1, curr + s.charAt(ind)); } ArrayList<String> permutation(String s) { // Start with first character (no space before it) String curr = "" + s.charAt(0); // Start recursion from index 1 solve(s, 1, curr); // Sort results as required in problem Collections.sort(lis); return lis; }}Step-by-Step Execution (Using Your Tree)For "ABC":Start → "A"At "B":"AB""A B"At "C":"ABC", "AB C""A BC", "A B C"Exactly matches your decision tree leaf nodes ✅Complexity AnalysisTime Complexity: O(2ⁿ)Space Complexity: O(2ⁿ)Why This Approach WorksRecursion explores every possible choiceEach level = one characterEach branch = decision (space / no space)Leaf nodes = final answersKey TakeawaysThis is a binary decision recursion problemAlways identify:ChoicesBase conditionYour decision tree = direct blueprint of recursionSame pattern applies to:SubsetsBinary choices problemsConclusionThe Permutation with Spaces problem becomes extremely simple once the decision tree is understood—and your diagram already captures that perfectly.The recursion directly follows the same structure:Every branch = one decisionEvery leaf = one answerMaster this pattern, and you’ll find many recursion problems much easier to solve.

MediumGeeksforGeeksRecursionJava
All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

All Subsequences of a String (Power Set) | Recursion & Backtracking Java Solution

IntroductionThe Power Set problem for strings is a classic question in recursion and backtracking, frequently asked in coding interviews and platforms like GeeksforGeeks.In this problem, instead of numbers, we deal with strings and generate all possible subsequences (not substrings). This makes it slightly more interesting and practical for real-world applications like pattern matching, text processing, and combinatorics.In this article, we will cover:Intuition behind subsequencesRecursive (backtracking) approachSorting for lexicographical orderAlternative approachesComplexity analysisProblem StatementGiven a string s of length n, generate all non-empty subsequences of the string.RequirementsReturn only non-empty subsequencesOutput must be in lexicographically sorted orderExamplesExample 1Input:s = "abc"Output:a ab abc ac b bc cExample 2Input:s = "aa"Output:a a aaSubsequence vs Substring (Important)Substring: Continuous charactersSubsequence: Characters can be skippedExample for "abc":Subsequences → a, b, c, ab, ac, bc, abcKey InsightFor every character, we have two choices:Include it OR Exclude itSo total subsequences:2^nWe generate all and then remove the empty string.Approach 1: Recursion (Backtracking)IntuitionAt each index:Skip the characterInclude the characterBuild all combinations recursivelyJava Code (With Explanation)import java.util.*;class Solution { // List to store all subsequences List<String> a = new ArrayList<>(); void sub(String s, int ind, String curr) { // Base case: reached end of string if (ind == s.length()) { a.add(curr); // add current subsequence return; } // Choice 1: Exclude current character sub(s, ind + 1, curr); // Choice 2: Include current character sub(s, ind + 1, curr + s.charAt(ind)); } public List<String> AllPossibleStrings(String s) { // Start recursion sub(s, 0, ""); // Remove empty string (not allowed) a.remove(""); // Sort lexicographically Collections.sort(a); return a; }}Step-by-Step Dry Run (s = "abc")Start: ""→ Exclude 'a' → "" → Exclude 'b' → "" → Exclude 'c' → "" → Include 'c' → "c" → Include 'b' → "b" → Exclude 'c' → "b" → Include 'c' → "bc"→ Include 'a' → "a" → Exclude 'b' → "a" → Exclude 'c' → "a" → Include 'c' → "ac" → Include 'b' → "ab" → Exclude 'c' → "ab" → Include 'c' → "abc"Final Output (After Sorting)a ab abc ac b bc cApproach 2: Bit ManipulationIntuitionEach subsequence can be represented using binary numbers:0 → exclude1 → includeCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); int n = s.length(); int total = 1 << n; // 2^n for (int i = 1; i < total; i++) { // start from 1 to avoid empty StringBuilder sb = new StringBuilder(); for (int j = 0; j < n; j++) { if ((i & (1 << j)) != 0) { sb.append(s.charAt(j)); } } result.add(sb.toString()); } Collections.sort(result); return result; }}Approach 3: Iterative (Expanding List)IdeaStart with empty listFor each character:Add it to all existing subsequencesCodeimport java.util.*;class Solution { public List<String> AllPossibleStrings(String s) { List<String> result = new ArrayList<>(); result.add(""); for (char ch : s.toCharArray()) { int size = result.size(); for (int i = 0; i < size; i++) { result.add(result.get(i) + ch); } } result.remove(""); Collections.sort(result); return result; }}Complexity AnalysisTime Complexity: O(n × 2ⁿ)Space Complexity: O(n × 2ⁿ)Why?Total subsequences = 2ⁿEach subsequence takes O(n) to buildWhy Sorting is RequiredThe recursion generates subsequences in random order, so we sort them:Collections.sort(result);This ensures lexicographical order as required.Key TakeawaysThis is a power set problem for stringsEach character → 2 choicesRecursion = most intuitive approachBit manipulation = most optimized thinkingAlways remove empty string if requiredCommon Interview VariationsSubsets of arrayPermutations of stringCombination sumSubsequence with conditionsConclusionThe Power Set problem is a fundamental building block in recursion and combinatorics. Once you understand the include/exclude pattern, you can solve a wide range of problems efficiently.Mastering this will significantly improve your ability to tackle backtracking and decision tree problems.Frequently Asked Questions (FAQs)1. Why is the empty string removed?Because the problem requires only non-empty subsequences.2. Why is time complexity O(n × 2ⁿ)?Because there are 2ⁿ subsequences and each takes O(n) time to construct.3. Which approach is best?Recursion → best for understandingBit manipulation → best for optimization

GeeksforGeeksRecursionJavaBacktrackingMedium
Majority Element II

Majority Element II

LeetCode Problem 229Link of the Problem to try -: LinkGiven an integer array of size n, find all elements that appear more than ⌊ n/3 ⌋ times. Example 1:Input: nums = [3,2,3]Output: [3]Example 2:Input: nums = [1]Output: [1]Example 3:Input: nums = [1,2]Output: [1,2] Constraints:1 <= nums.length <= 5 * 104-109 <= nums[i] <= 109Solution:According to question says we have to create ArrayList in which we have to return those elements whose frequency count is more than array's length divided by 3 and we have to return it simply this is it.And personally if I say this is a very easy question as there you don't need to think very much you can simply create a HashMap in which you maintain frequency of each element and then simply run a for each loop and iterate over the keys by keySet method of HashMap and then get value of each key and check is it greater than array.length/3 or not if it is then simply add in the ArrayList and here you got your ans.Code: public List<Integer> majorityElement(int[] nums) { HashMap<Integer, Integer> mp = new HashMap<>(); List<Integer> lis = new ArrayList<>(); for (int i = 0; i < nums.length; i++) { mp.put(nums[i], mp.getOrDefault(nums[i], 0) + 1); } for (int i : mp.keySet()) { if (mp.get(i) > nums.length / 3) { lis.add(i); } } return lis; }

LeetCodeMediumHashMap
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
LeetCode 3488 — Closest Equal Element Queries: A Complete Walkthrough from Brute Force to Optimal

LeetCode 3488 — Closest Equal Element Queries: A Complete Walkthrough from Brute Force to Optimal

If you have been grinding LeetCode lately, you have probably run into problems where your first clean-looking solution times out and forces you to rethink from scratch. LeetCode 3488 is exactly that kind of problem. This article walks through the complete thought process — from the naive approach that got me TLE, to the intuition shift, to the final optimized solution in Java.You can find the original problem here: LeetCode 3488 — Closest Equal Element Queries at Problem LinkUnderstanding the ProblemYou are given a circular array nums and an array of queries. For each query queries[i], you must find the minimum distance between the element at index queries[i] and any other index j such that nums[j] == nums[queries[i]]. If no such other index exists, the answer is -1.The critical detail here is the word circular. The array wraps around, which means the distance between two indices i and j in an array of length n is not simply |i - j|. It is:min( |i - j| , n - |i - j| )You can travel either clockwise or counterclockwise, and you take whichever path is shorter.Breaking Down the ExamplesExample 1nums = [1, 3, 1, 4, 1, 3, 2], queries = [0, 3, 5]For query index 0, the value is 1. Other indices holding 1 are 2 and 4. Circular distances are min(2, 5) = 2 and min(4, 3) = 3. The minimum is 2.For query index 3, the value is 4. It appears nowhere else in the array. Answer is -1.For query index 5, the value is 3. The other 3 sits at index 1. Circular distance is min(4, 3) = 3. Answer is 3.Output: [2, -1, 3]Example 2nums = [1, 2, 3, 4], queries = [0, 1, 2, 3]Every element is unique. Every query returns -1.Output: [-1, -1, -1, -1]First Attempt — Brute ForceMy first instinct was straightforward. For each query, scan the entire array, collect every index that matches the queried value, compute the circular distance to each, and return the minimum. Clean logic, easy to reason about, and dead simple to implement.while (i != queries.length) { int max = Integer.MAX_VALUE; for (int j = 0; j < nums.length; j++) { int target = nums[queries[i]]; if (nums[j] == target && j != queries[i]) { // Linear distance between the two indices int right = Math.abs(j - queries[i]); // Distance going the other direction around the ring int left = nums.length - right; // True circular distance is the shorter of the two int dist = Math.min(right, left); max = Math.min(max, dist); } } lis.add(max == Integer.MAX_VALUE ? -1 : max); i++;}This got TLE immediately, and once you look at the constraints it is obvious why. Both nums.length and queries.length can be up to 10^5. For every query you are scanning every element, giving you O(n × q) time — which in the worst case is 10 billion operations. No judge is going to wait for that.Rethinking the Approach — Where Is the Waste?After the TLE, the question I asked myself was: what work is being repeated unnecessarily?The answer was obvious in hindsight. Every time a query asks about a value like 3, the brute force scans the entire array again looking for every index that holds 3. If ten different queries all ask about value 3, you are doing that scan ten times. You are finding the same indices over and over.The fix is to do that work exactly once, before any query is processed. You precompute a map from each value to all the indices where it appears. Then for every query you simply look up the relevant list and work within it.That observation reduces the precomputation to O(n) — one pass through the array. The question then becomes: once you have that sorted list of indices for a given value, how do you find the closest one to your query index efficiently?The Key Insight — You Only Need Two NeighboursHere is the insight that makes this problem elegant. The index list for any value is sorted in ascending order because you build it by iterating left to right through the array. If your query index sits at position mid inside that sorted list, then by definition every index to the left of mid - 1 is farther away than arr[mid - 1], and every index to the right of mid + 1 is farther away than arr[mid + 1].This means you never need to compare against all duplicates. You only ever need to check the immediate left and right neighbours of your query index within the sorted list.The one subtlety is the circular wrap. Because the array itself is circular, the left neighbour of the very first element in the list is actually the last element in the list, since you can wrap around the ring. This is handled cleanly with modular arithmetic: (mid - 1 + n) % n for the left neighbour and (mid + 1) % n for the right.The Optimized Solution — HashMap + Binary SearchStep 1 — Precompute the index mapIterate through nums once and build a HashMap mapping each value to a list of all indices where it appears. The lists are sorted by construction since you insert indices in order.Step 2 — Binary search to locate the query indexFor a given query at index q, look up the index list for nums[q]. Binary search the list to find the position of q within it. This runs in O(log n) rather than O(n).Step 3 — Check immediate neighbours and compute circular distancesOnce you have the position mid, fetch arr[(mid + 1) % n] and arr[(mid - 1 + n) % n]. For each, compute the circular distance using min(|diff|, totalLength - |diff|). Return the smaller of the two.Full Annotated Java Solutionclass Solution { public List<Integer> solveQueries(int[] nums, int[] queries) { int c = 0; // Precompute: map each value to the sorted list of indices where it appears. // Since we iterate left to right, the list is sorted by construction. HashMap<Integer, List<Integer>> mp = new HashMap<>(); for (int i = 0; i < nums.length; i++) { mp.computeIfAbsent(nums[i], k -> new ArrayList<>()).add(i); } List<Integer> lis = new ArrayList<>(); while (c != queries.length) { // Retrieve the sorted index list for the value at the queried position List<Integer> arr = mp.get(nums[queries[c]]); int n = arr.size(); int i = 0; int j = n - 1; int min = -1; while (i <= j) { int mid = i + (j - i) / 2; if (arr.get(mid) == queries[c]) { // Only one occurrence in the entire array — no duplicate exists if (n == 1) { min = -1; } else { // Circular neighbour to the right within the index list int right = arr.get((mid + 1) % n); // Circular neighbour to the left within the index list int left = arr.get((mid - 1 + n) % n); // Compute circular distance to the right neighbour int d1 = Math.abs(right - queries[c]); int distRight = Math.min(d1, nums.length - d1); // Compute circular distance to the left neighbour int d2 = Math.abs(left - queries[c]); int distLeft = Math.min(d2, nums.length - d2); // The answer is the closer of the two neighbours min = Math.min(distLeft, distRight); } break; } else if (arr.get(mid) > queries[c]) { // Query index is smaller — search the left half j = mid - 1; } else { // Query index is larger — search the right half i = mid + 1; } } lis.add(min); c++; } return lis; }}Complexity AnalysisTime Complexity: O(n log n)Building the HashMap takes O(n). For each of the q queries, binary search over the index list takes O(log n) in the worst case. Total: O(n + q log n), which simplifies to O(n log n) given the constraint that q ≤ n.Space Complexity: O(n)The HashMap stores every index exactly once across all its lists, so total space used is O(n).Compared to the brute force O(n × q), this is the difference between ~1.7 million operations and ~10 billion operations at the constraint limits.Common PitfallsMixing up the two values of n. Inside the solution, n refers to arr.size() — the number of occurrences of a particular value. But when computing circular distance, you need nums.length — the full array length. These are different numbers and swapping them silently produces wrong answers.Forgetting the + n in the left neighbour formula. Writing (mid - 1) % n when mid is 0 produces -1 in Java, since Java's modulo preserves the sign of the dividend. Always write (mid - 1 + n) % n.Not handling the single-occurrence case. If a value appears only once, n == 1, and the neighbour formula wraps around to the element itself, giving a distance of zero — which is completely wrong. Guard against this explicitly before running the neighbour logic.What This Problem Teaches YouThe journey from brute force to optimal here follows a pattern worth internalizing.The brute force was correct but repeated work. Recognizing that repeated work and lifting it into a precomputation step is the single move that makes this problem tractable. The HashMap does that.Once you have a sorted structure, binary search is almost always the right tool to find a position within it. And once you have a position in a sorted structure, you only ever need to look at adjacent elements to find the nearest one — checking anything further is redundant by definition.These are not tricks specific to this problem. They are transferable patterns that appear across dozens of medium and hard problems on the platform. Internalizing them — rather than memorizing solutions — is what actually builds problem-solving ability over time.

ArraysHashMapBinary SearchCircular ArraysMediumLeetCodeJava
Queue Data Structure Complete Guide - Java Explained With All Operations

Queue Data Structure Complete Guide - Java Explained With All Operations

IntroductionIf you have been learning Data Structures and Algorithms, you have probably already spent time with arrays, linked lists, and stacks. Now it is time to meet one of the most important and widely used data structures in computer science — the Queue.Queue is not just a theoretical concept. It powers some of the most critical systems you use every day — from how your printer handles jobs, to how your CPU schedules tasks, to how Google Maps finds the shortest path between two locations. Understanding Queue deeply means understanding how real systems work.In this complete guide we will cover absolutely everything — what a Queue is, how it differs from a Stack, every type of Queue, all operations with code, Java implementations, time and space complexity, common interview questions, and the most important LeetCode problems that use Queue.What Is a Queue?A Queue is a linear data structure that follows the FIFO principle — First In First Out. This means the element that was added first is the one that gets removed first.Think of it exactly like a real-world queue (a line of people). The person who joined the line first gets served first. No cutting in line, no serving from the back — strict order from front to back.This is the fundamental difference between a Queue and a Stack:Stack → LIFO (Last In First Out) — like a stack of plates, you take from the topQueue → FIFO (First In First Out) — like a line of people, you serve from the frontReal Life Examples of QueueBefore writing a single line of code, let us understand where queues appear in real life. This will make every technical concept feel natural.Printer Queue — when you send multiple documents to print, they print in the order they were sent. The first document sent prints first.CPU Task Scheduling — your operating system manages running processes in a queue. Tasks get CPU time in the order they arrive (in basic scheduling).Customer Service Call Center — when you call a helpline and are put on hold, you are placed in a queue. The first caller on hold gets connected first.WhatsApp Messages — messages are delivered in the order they are sent. The first message sent is the first one received.BFS (Breadth First Search) — every time you use Google Maps or any navigation app to find the shortest path, it uses BFS internally which is entirely powered by a Queue.Ticket Booking Systems — online booking portals process requests in the order they arrive. First come first served.Queue Terminology — Key Terms You Must KnowBefore diving into code, let us get the vocabulary right:Front — the end from which elements are removed (dequeued). This is where the "first person in line" stands.Rear (or Back) — the end at which elements are added (enqueued). New arrivals join here.Enqueue — the operation of adding an element to the rear of the queue. Like joining the back of a line.Dequeue — the operation of removing an element from the front of the queue. Like the first person in line being served and leaving.Peek (or Front) — looking at the front element without removing it. Like seeing who is first in line without serving them yet.isEmpty — checking whether the queue has no elements.isFull — relevant for fixed-size queues, checking whether no more elements can be added.Types of QueuesThis is where most beginners get confused. There is not just one type of Queue — there are several variations each designed to solve specific problems.1. Simple Queue (Linear Queue)The most basic form. Elements enter from the rear and leave from the front. Strict FIFO, nothing fancy.Enqueue → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue rear frontProblem with Simple Queue: In array-based implementation, once elements are dequeued from the front, those slots cannot be reused even if there is space. This wastes memory. This is why Circular Queue was invented.2. Circular QueueIn a Circular Queue, the rear wraps around to the front when it reaches the end of the array. The last position connects back to the first, forming a circle. This solves the wasted space problem of simple queues. [1] [2] [3] / \ [6] [4] \ / [5] ← rearUsed in: CPU scheduling, memory management, traffic light systems, streaming buffers.3. Double Ended Queue (Deque)A Deque (pronounced "deck") allows insertion and deletion from both ends — front and rear. It is the most flexible queue type.Enqueue Front → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue FrontEnqueue Rear → [ 1 | 2 | 3 | 4 | 5 ] → Dequeue RearTwo subtypes:Input Restricted Deque — insertion only at rear, deletion from both endsOutput Restricted Deque — deletion only at front, insertion at both endsUsed in: browser history (back and forward), undo-redo operations, sliding window problems.4. Priority QueueElements are not served in FIFO order — instead each element has a priority and the element with the highest priority is served first regardless of when it was added.Think of an emergency room. A patient with a critical injury jumps ahead of someone with a minor cut even if they arrived later.Two types:Max Priority Queue — highest value = highest priorityMin Priority Queue — lowest value = highest priorityUsed in: Dijkstra's shortest path, Huffman encoding, A* search algorithm, task scheduling with priorities.5. Blocking QueueA thread-safe queue used in multi-threading. If the queue is empty, a thread trying to dequeue will wait (block) until an element is available. If the queue is full, a thread trying to enqueue will wait until space is available.Used in: Producer-Consumer problems, thread pool implementations, Java's java.util.concurrent package.Queue Operations and Time ComplexityEvery queue operation has a specific time complexity that you must know cold for interviews.OperationDescriptionTime ComplexityEnqueueAdd element to rearO(1)DequeueRemove element from frontO(1)Peek/FrontView front elementO(1)isEmptyCheck if queue is emptyO(1)SizeNumber of elementsO(1)SearchFind a specific elementO(n)Space Complexity: O(n) — where n is the number of elements stored.All core queue operations are O(1). This is what makes Queue so powerful — no matter how many elements are in the queue, adding and removing always takes constant time.Implementing Queue in Java — All WaysJava gives you multiple ways to use a Queue. Let us go through each one.Way 1: Using LinkedList (Most Common)LinkedList implements the Queue interface in Java. This is the most commonly used Queue implementation.import java.util.LinkedList;import java.util.Queue;Queue<Integer> queue = new LinkedList<>();// Enqueue — add to rearqueue.offer(10);queue.offer(20);queue.offer(30);// Peek — view front without removingSystem.out.println(queue.peek()); // 10// Dequeue — remove from frontSystem.out.println(queue.poll()); // 10System.out.println(queue.poll()); // 20// Check emptySystem.out.println(queue.isEmpty()); // false// SizeSystem.out.println(queue.size()); // 1offer() vs add() — both add to the queue. add() throws an exception if the queue is full (for bounded queues). offer() returns false instead. Always prefer offer().poll() vs remove() — both remove from front. remove() throws an exception if queue is empty. poll() returns null. Always prefer poll().peek() vs element() — both view the front. element() throws exception if empty. peek() returns null. Always prefer peek().Way 2: Using ArrayDeque (Fastest)ArrayDeque is faster than LinkedList for Queue operations because it uses a resizable array internally with no node allocation overhead.import java.util.ArrayDeque;import java.util.Queue;Queue<Integer> queue = new ArrayDeque<>();queue.offer(1);queue.offer(2);queue.offer(3);System.out.println(queue.peek()); // 1System.out.println(queue.poll()); // 1System.out.println(queue.size()); // 2When to use ArrayDeque over LinkedList? Use ArrayDeque whenever possible for Queue or Stack operations. It is faster because it avoids the overhead of node objects that LinkedList creates for every element. In competitive programming and interviews, ArrayDeque is the preferred choice.Way 3: Using Deque (Double Ended Queue)import java.util.ArrayDeque;import java.util.Deque;Deque<Integer> deque = new ArrayDeque<>();// Add to frontdeque.offerFirst(10);// Add to reardeque.offerLast(20);deque.offerLast(30);// Remove from frontSystem.out.println(deque.pollFirst()); // 10// Remove from rearSystem.out.println(deque.pollLast()); // 30// Peek front and rearSystem.out.println(deque.peekFirst()); // 20System.out.println(deque.peekLast()); // 20Way 4: Using PriorityQueueimport java.util.PriorityQueue;// Min Heap — smallest element has highest priorityPriorityQueue<Integer> minPQ = new PriorityQueue<>();minPQ.offer(30);minPQ.offer(10);minPQ.offer(20);System.out.println(minPQ.poll()); // 10 — smallest comes out first// Max Heap — largest element has highest priorityPriorityQueue<Integer> maxPQ = new PriorityQueue<>((a, b) -> b - a);maxPQ.offer(30);maxPQ.offer(10);maxPQ.offer(20);System.out.println(maxPQ.poll()); // 30 — largest comes out firstWay 5: Implementing Queue From Scratch Using ArrayUnderstanding the underlying implementation helps you in interviews when asked to build one from scratch.class MyQueue { private int[] arr; private int front; private int rear; private int size; private int capacity; public MyQueue(int capacity) { this.capacity = capacity; arr = new int[capacity]; front = 0; rear = -1; size = 0; } public void enqueue(int val) { if (size == capacity) { System.out.println("Queue is full!"); return; } rear = (rear + 1) % capacity; // circular wrapping arr[rear] = val; size++; } public int dequeue() { if (isEmpty()) { System.out.println("Queue is empty!"); return -1; } int val = arr[front]; front = (front + 1) % capacity; // circular wrapping size--; return val; } public int peek() { if (isEmpty()) return -1; return arr[front]; } public boolean isEmpty() { return size == 0; } public int size() { return size; }}Notice the % capacity in enqueue and dequeue — that is what makes it a Circular Queue. Without this, once the rear reaches the end of the array, you cannot add more even if front has moved forward and freed up space.Way 6: Implementing Queue Using Two StacksThis is a very popular interview question — implement a Queue using two stacks. The idea is to use one stack for enqueue and another for dequeue.class QueueUsingTwoStacks { Stack<Integer> s1 = new Stack<>(); // for enqueue Stack<Integer> s2 = new Stack<>(); // for dequeue public void enqueue(int val) { s1.push(val); // always push to s1 } public int dequeue() { if (s2.isEmpty()) { // transfer all elements from s1 to s2 // this reverses the order, giving FIFO behavior while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.pop(); } public int peek() { if (s2.isEmpty()) { while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.peek(); } public boolean isEmpty() { return s1.isEmpty() && s2.isEmpty(); }}Why does this work?When you transfer elements from s1 to s2, the order reverses. The element that was added first to s1 ends up on top of s2 — which means it gets dequeued first. FIFO achieved using two LIFOs!Amortized time complexity: Each element is pushed and popped at most twice (once in s1, once in s2). So dequeue is O(1) amortized even though individual calls might take O(n).This is LeetCode 232 — Implement Queue using Stacks.Queue vs Stack — Side by SideFeatureQueueStackPrincipleFIFO — First In First OutLIFO — Last In First OutInsert atRearTopRemove fromFrontTopReal lifeLine of peopleStack of platesJava classLinkedList, ArrayDequeStack, ArrayDequeMain useBFS, schedulingDFS, backtracking, parsingPeekFront elementTop elementBFS — The Most Important Application of QueueBreadth First Search (BFS) is the single most important algorithm that uses a Queue. Understanding BFS is why Queue matters so much in DSA.BFS explores a graph or tree level by level — all nodes at distance 1 first, then all at distance 2, and so on. A Queue naturally enforces this level-by-level behavior.public void bfs(int start, List<List<Integer>> graph) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[graph.size()]; queue.offer(start); visited[start] = true; while (!queue.isEmpty()) { int node = queue.poll(); // process front node System.out.print(node + " "); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); // add unvisited neighbors to rear } } }}Why Queue and not Stack for BFS? Queue ensures you process all neighbors of a node before going deeper. Stack would take you deep into one path first — that is DFS, not BFS. The FIFO property is what guarantees level-by-level exploration.BFS with Queue is used in:Shortest path in unweighted graphsLevel order traversal of treesFinding connected componentsWord ladder problemsRotten oranges, flood fill, and matrix BFS problemsLevel Order Traversal — BFS on TreesOne of the most common Queue problems in interviews is Level Order Traversal of a binary tree.public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> result = new ArrayList<>(); if (root == null) return result; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); while (!queue.isEmpty()) { int levelSize = queue.size(); // number of nodes at current level List<Integer> level = new ArrayList<>(); for (int i = 0; i < levelSize; i++) { TreeNode node = queue.poll(); level.add(node.val); if (node.left != null) queue.offer(node.left); if (node.right != null) queue.offer(node.right); } result.add(level); } return result;}The key trick here is using queue.size() at the start of each while loop iteration to know exactly how many nodes belong to the current level. Process exactly that many nodes, then move to the next level.This is LeetCode 102 — Binary Tree Level Order Traversal.Sliding Window Maximum — Monotonic DequeOne of the most impressive Queue applications is the Sliding Window Maximum problem using a Monotonic Deque. This is the queue equivalent of the Monotonic Stack pattern you saw in stack problems.The idea — maintain a deque that stores indices of elements in decreasing order. The front always holds the index of the maximum element in the current window.public int[] maxSlidingWindow(int[] nums, int k) { Deque<Integer> deque = new ArrayDeque<>(); // stores indices int[] result = new int[nums.length - k + 1]; int idx = 0; for (int i = 0; i < nums.length; i++) { // remove indices that are out of the current window while (!deque.isEmpty() && deque.peekFirst() < i - k + 1) { deque.pollFirst(); } // remove indices whose values are smaller than current // they can never be the maximum for any future window while (!deque.isEmpty() && nums[deque.peekLast()] < nums[i]) { deque.pollLast(); } deque.offerLast(i); // window is fully formed, record maximum (front of deque) if (i >= k - 1) { result[idx++] = nums[deque.peekFirst()]; } } return result;}This gives O(n) time for what would otherwise be an O(n×k) problem. This is LeetCode 239 — Sliding Window Maximum.Java Queue Interface — Complete Method ReferenceHere is every method you will ever need from Java's Queue and Deque interfaces:Queue Methods:offer(e) — add to rear, returns false if full (preferred over add) poll() — remove from front, returns null if empty (preferred over remove) peek() — view front without removing, returns null if empty (preferred over element) isEmpty() — returns true if no elements size() — returns number of elements contains(o) — returns true if element existsDeque Additional Methods:offerFirst(e) — add to front offerLast(e) — add to rear pollFirst() — remove from front pollLast() — remove from rear peekFirst() — view front peekLast() — view rearPriorityQueue Specific:offer(e) — add with natural ordering or custom comparator poll() — remove element with highest priority peek() — view highest priority element without removingCommon Interview Questions About QueueThese are the questions interviewers ask to test your understanding of queues conceptually — not just coding.Q1. What is the difference between Queue and Stack? Queue is FIFO — elements are removed in the order they were added. Stack is LIFO — the most recently added element is removed first. Queue removes from the front, Stack removes from the top.Q2. Why is ArrayDeque preferred over LinkedList for Queue in Java? ArrayDeque uses a resizable array internally and has better cache locality and no node allocation overhead. LinkedList creates a new node object for every element added, which means more garbage collection pressure. ArrayDeque is faster in practice for most Queue use cases.Q3. When would you use a PriorityQueue instead of a regular Queue? When the order of processing depends on priority rather than arrival order. For example in a hospital, critical patients are treated before minor cases regardless of when they arrived. Or in Dijkstra's algorithm, always processing the shortest known distance first.Q4. How is Queue used in BFS? BFS uses a Queue to explore nodes level by level. The starting node is enqueued first. Each time a node is dequeued, all its unvisited neighbors are enqueued. Since Queue is FIFO, all neighbors of a node are processed before going deeper — guaranteeing level-by-level exploration.Q5. What is the difference between poll() and remove() in Java Queue? Both remove the front element. remove() throws NoSuchElementException if the queue is empty. poll() returns null instead of throwing. Always use poll() for safer code.Q6. Can a Queue have duplicates? Yes. Queue does not have any restriction on duplicate values unlike Sets. The same value can appear multiple times in a Queue.Q7. What is a Blocking Queue and when is it used? A Blocking Queue is a thread-safe Queue used in multi-threaded applications. When a thread tries to dequeue from an empty queue, it blocks (waits) until an element is available. When a thread tries to enqueue into a full queue, it blocks until space is available. Used in Producer-Consumer patterns.Top LeetCode Problems on QueueHere are the most important LeetCode problems that use Queue — organized from beginner to advanced:Beginner Level:232. Implement Queue using Stacks — implement Queue with two stacks, classic interview question225. Implement Stack using Queues — reverse of 232, implement Stack using Queue933. Number of Recent Calls — sliding window with QueueIntermediate Level:102. Binary Tree Level Order Traversal — BFS on tree, must know107. Binary Tree Level Order Traversal II — same but bottom up994. Rotting Oranges — multi-source BFS on grid1091. Shortest Path in Binary Matrix — BFS shortest path542. 01 Matrix — multi-source BFS, distance to nearest 0127. Word Ladder — BFS on word graph, classicAdvanced Level:239. Sliding Window Maximum — monotonic deque, must know862. Shortest Subarray with Sum at Least K — monotonic deque with prefix sums407. Trapping Rain Water II — 3D BFS with priority queue787. Cheapest Flights Within K Stops — BFS with constraintsQueue Cheat Sheet — Everything at a GlanceCreate a Queue:Queue<Integer> q = new LinkedList<>(); // standardQueue<Integer> q = new ArrayDeque<>(); // faster, preferredDeque<Integer> dq = new ArrayDeque<>(); // double endedPriorityQueue<Integer> pq = new PriorityQueue<>(); // min heapPriorityQueue<Integer> pq = new PriorityQueue<>((a,b) -> b-a); // max heapCore Operations:q.offer(x); // enqueueq.poll(); // dequeueq.peek(); // front elementq.isEmpty(); // check emptyq.size(); // number of elementsDeque Operations:dq.offerFirst(x); // add to frontdq.offerLast(x); // add to reardq.pollFirst(); // remove from frontdq.pollLast(); // remove from reardq.peekFirst(); // view frontdq.peekLast(); // view rearBFS Template:Queue<Integer> queue = new LinkedList<>();queue.offer(start);visited[start] = true;while (!queue.isEmpty()) { int node = queue.poll(); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); } }}ConclusionQueue is one of those data structures that appears simple on the surface but has incredible depth once you start exploring its variations and applications. From the basic FIFO concept to Circular Queues, Deques, Priority Queues, Monotonic Deques, and BFS — each layer adds a new tool to your problem-solving arsenal.Here is the learning path to follow based on everything covered in this guide:Start with understanding FIFO vs LIFO and when each applies. Then get comfortable with Java's Queue interface — offer, poll, peek. Practice the BFS template until it feels automatic. Then move to Level Order Traversal problems. Once BFS clicks, tackle multi-source BFS problems like Rotting Oranges. Finally learn the Monotonic Deque pattern for sliding window problems.Master these and you will handle every Queue problem in any coding interview with confidence.

QueueData StructureJavaBFSDequePriority QueueCircular Queue
LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 94: Binary Tree Inorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 94 – Binary Tree Inorder Traversal is one of the most important beginner-friendly tree problems in Data Structures and Algorithms.This problem helps you understand:Binary tree traversalDepth First Search (DFS)RecursionStack-based traversalTree interview fundamentalsIt is commonly asked in coding interviews because tree traversal forms the foundation of many advanced tree problems.Problem Link🔗 ProblemLeetCode 94: Binary Tree Inorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the inorder traversal of its nodes' values.What is Inorder Traversal?In inorder traversal, we visit nodes in this order:Left → Root → RightExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Inorder TraversalStep-by-step:1 → 3 → 2Output:[1,3,2]Recursive Approach (Most Common)IntuitionIn inorder traversal:Traverse left subtreeVisit current nodeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal order:Left → Node → RightRecursive function:inorder(node.left)visit(node)inorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);list.add(root.val);solve(list, root.right);}public List<Integer> inorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Add:1Step 2Move right to:2Move left to:3Add:3Return back.Add:2Final Answer[1,3,2]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Inorder IntuitionThe recursive order is:Left → Node → RightSo iteratively:Keep pushing left nodes into stackProcess current nodeMove to right subtreeStack-Based Traversal LogicAlgorithmWhile current node exists OR stack is not empty:Push all left nodesPop top nodeAdd node valueMove to right subtreeJava Iterative Solutionclass Solution {public List<Integer> inorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();Stack<TreeNode> stack = new Stack<>();TreeNode curr = root;while(curr != null || !stack.isEmpty()) {while(curr != null) {stack.push(curr);curr = curr.left;}curr = stack.pop();ans.add(curr.val);curr = curr.right;}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Stack:[1]Step 2Pop:1Add:1Move right to:2Step 3Push:23Stack:[2,3]Step 4Pop:3Add:3Step 5Pop:2Add:2Final Answer[1,3,2]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to write and understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:In inorder traversal, we process nodes in Left → Root → Right order. Recursion naturally fits this traversal. For iterative traversal, we use a stack to simulate recursive calls.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct inorder:Left → Root → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Stack Handling ErrorsIn iterative traversal:Push all left nodes firstThen process nodeThen move rightFAQsQ1. Why is inorder traversal important?It is heavily used in:Binary Search TreesExpression treesTree reconstruction problemsQ2. What is the inorder traversal of a BST?It produces values in sorted order.Q3. Which approach is better for interviews?Recursive is easier.Iterative is preferred for deeper interview rounds.Q4. Can inorder traversal be done without stack or recursion?Yes.Using Morris Traversal with:O(1)space.Bonus: Morris Traversal (Advanced)Morris Traversal performs inorder traversal without recursion or stack.ComplexityTime ComplexityO(N)Space ComplexityO(1)This is an advanced interview optimization.ConclusionLeetCode 94 is one of the most fundamental tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key inorder pattern is:Left → Root → RightMastering this problem builds a strong foundation for advanced tree interview questions like:BST validationTree iteratorsTree reconstructionMorris traversalKth smallest in BST

LeetCodeBinary Tree Inorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 144: Binary Tree Preorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 144 – Binary Tree Preorder Traversal is one of the most important beginner-friendly tree traversal problems in Data Structures and Algorithms.This problem helps you understand:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPreorder traversal is widely used in:Tree copyingSerializationExpression treesDFS-based problemsHierarchical data processingIt is also one of the most commonly asked tree problems in coding interviews.Problem Link🔗 ProblemLeetCode 144: Binary Tree Preorder TraversalOfficial Problem:LeetCode Problem LinkProblem StatementGiven the root of a binary tree, return the preorder traversal of its nodes' values.What is Preorder Traversal?In preorder traversal, nodes are visited in this order:Root → Left → RightThe root node is processed first before traversing subtrees.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Preorder TraversalTraversal order:1 → 2 → 3Output:[1,2,3]Recursive Approach (Most Common)IntuitionIn preorder traversal:Visit current nodeTraverse left subtreeTraverse right subtreeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Root → Left → RightRecursive function:visit(node)preorder(node.left)preorder(node.right)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;list.add(root.val);solve(list, root.left);solve(list, root.right);}public List<Integer> preorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Add:1Move right to:2Step 2Add:2Move left to:3Step 3Add:3Final Answer[1,2,3]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use a stack to simulate recursion.Iterative Preorder IntuitionPreorder traversal order is:Root → Left → RightUsing a stack:Process current node immediatelyPush right child firstPush left child secondWhy?Because stacks follow:Last In First Out (LIFO)So left subtree gets processed first.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value.Push right child.Push left child.Repeat until stack becomes empty.Java Iterative Solutionclass Solution {public List<Integer> preorderTraversal(TreeNode root) {List<Integer> ans = new ArrayList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.add(node.val);if(node.right != null) {stack.push(node.right);}if(node.left != null) {stack.push(node.left);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add:[1]Push right child:2Step 3Pop:2Add:[1,2]Push left child:3Step 4Pop:3Add:[1,2,3]Final Answer[1,2,3]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Preorder traversal processes nodes in Root → Left → Right order. Recursion naturally handles this traversal. Iteratively, we use a stack and push the right child before the left child so the left subtree gets processed first.This demonstrates strong DFS and stack understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Left → Root → RightThat is inorder traversal.Correct preorder:Root → Left → Right2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Wrong Stack Push OrderFor iterative traversal:Push right firstPush left secondOtherwise traversal order becomes incorrect.FAQsQ1. Why is preorder traversal useful?It is heavily used in:Tree cloningSerializationDFS traversalExpression treesQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can preorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Preorder TraversalMorris traversal performs preorder traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 144 is one of the most fundamental binary tree traversal problems.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key preorder pattern is:Root → Left → RightMastering this traversal builds a strong foundation for advanced tree problems such as:Tree serializationDFS-based problemsTree reconstructionExpression treesMorris traversal

LeetCodeBinary Tree Preorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
Recursion in Java - Complete Guide With Examples and Practice Problems

Recursion in Java - Complete Guide With Examples and Practice Problems

IntroductionIf there is one topic in programming that confuses beginners more than anything else, it is recursion. Most people read the definition, nod their head, and then immediately freeze when they have to write recursive code themselves.The problem is not that recursion is genuinely hard. The problem is that most explanations start with code before building the right mental model. Once you have the right mental model, recursion clicks permanently and you start seeing it everywhere — in tree problems, graph problems, backtracking, dynamic programming, divide and conquer, and more.This guide covers everything from the ground up. What recursion is, how the call stack works, how to identify base cases and recursive cases, every type of recursion, common patterns, time and space complexity analysis, the most common mistakes, and the top LeetCode problems to practice.By the end of this article, recursion will not feel like magic anymore. It will feel like a natural tool you reach for confidently.What Is Recursion?Recursion is when a function calls itself to solve a smaller version of the same problem.That is the complete definition. But let us make it concrete.Imagine you want to count down from 5 to 1. One way is a loop. Another way is — print 5, then solve the exact same problem for counting down from 4 to 1. Then print 4, solve for 3. And so on until you reach the base — there is nothing left to count down.void countDown(int n) { if (n == 0) return; // stop here System.out.println(n); countDown(n - 1); // solve the smaller version}The function countDown calls itself with a smaller input each time. Eventually it reaches 0 and stops. That stopping condition is the most important part of any recursive function — the base case.The Two Parts Every Recursive Function Must HaveEvery correctly written recursive function has exactly two parts. Without both, the function either gives wrong answers or runs forever.Part 1: Base CaseThe base case is the condition under which the function stops calling itself and returns a direct answer. It is the smallest version of the problem that you can solve without any further recursion.Without a base case, recursion never stops and you get a StackOverflowError — Java's way of telling you the call stack ran out of memory.Part 2: Recursive CaseThe recursive case is where the function calls itself with a smaller or simpler input — moving closer to the base case with each call. If your recursive case does not make the problem smaller, you have an infinite loop.Think of it like a staircase. The base case is the ground floor. The recursive case is each step going down. Every step must genuinely bring you one level closer to the ground.How Recursion Works — The Call StackThis is the mental model that most explanations skip, and it is the reason recursion confuses people.Every time a function is called in Java, a new stack frame is created and pushed onto the call stack. This frame stores the function's local variables, parameters, and where to return to when the function finishes.When a recursive function calls itself, a new frame is pushed on top. When that call finishes, its frame is popped and execution returns to the previous frame.Let us trace countDown(3) through the call stack:countDown(3) called → frame pushed prints 3 calls countDown(2) → frame pushed prints 2 calls countDown(1) → frame pushed prints 1 calls countDown(0) → frame pushed n == 0, return → frame popped back in countDown(1), return → frame popped back in countDown(2), return → frame popped back in countDown(3), return → frame poppedOutput: 3, 2, 1The call stack grows as calls go deeper, then shrinks as calls return. This is why recursion uses O(n) space for n levels deep — each level occupies one stack frame in memory.Your First Real Recursive Function — FactorialFactorial is the classic first recursion example. n! = n × (n-1) × (n-2) × ... × 1Notice the pattern — n! = n × (n-1)!. The factorial of n is n times the factorial of n-1. That recursive structure makes it perfect for recursion.public int factorial(int n) { // base case if (n == 0 || n == 1) return 1; // recursive case return n * factorial(n - 1);}Dry Run — factorial(4)factorial(4)= 4 * factorial(3)= 4 * 3 * factorial(2)= 4 * 3 * 2 * factorial(1)= 4 * 3 * 2 * 1= 24The call stack builds up going in, then multiplications happen coming back out. This "coming back out" phase is called the return phase or unwinding of the stack.Time Complexity: O(n) — n recursive calls Space Complexity: O(n) — n frames on the call stackThe Two Phases of RecursionEvery recursive function has two phases and understanding both is critical.Phase 1: The Call Phase (Going In)This happens as the function keeps calling itself with smaller inputs. Things you do before the recursive call happen in this phase — in order from the outermost call to the innermost.Phase 2: The Return Phase (Coming Back Out)This happens as each call finishes and returns to its caller. Things you do after the recursive call happen in this phase — in reverse order, from the innermost call back to the outermost.This distinction explains why the output order can be surprising:void printBothPhases(int n) { if (n == 0) return; System.out.println("Going in: " + n); // call phase printBothPhases(n - 1); System.out.println("Coming out: " + n); // return phase}For printBothPhases(3):Going in: 3Going in: 2Going in: 1Coming out: 1Coming out: 2Coming out: 3This two-phase understanding is what makes problems like reversing a string or printing a linked list backwards via recursion feel natural.Types of RecursionRecursion is not one-size-fits-all. There are several distinct types and knowing which type applies to a problem shapes how you write the solution.1. Direct RecursionThe function calls itself directly. This is the most common type — what we have seen so far.void direct(int n) { if (n == 0) return; direct(n - 1); // calls itself}2. Indirect RecursionFunction A calls Function B which calls Function A. They form a cycle.void funcA(int n) { if (n <= 0) return; System.out.println("A: " + n); funcB(n - 1);}void funcB(int n) { if (n <= 0) return; System.out.println("B: " + n); funcA(n - 1);}Used in: state machines, mutual recursion in parsers, certain mathematical sequences.3. Tail RecursionThe recursive call is the last operation in the function. Nothing happens after the recursive call returns — no multiplication, no addition, nothing.// NOT tail recursive — multiplication happens after returnint factorial(int n) { if (n == 1) return 1; return n * factorial(n - 1); // multiply after return — not tail}// Tail recursive — recursive call is the last thingint factorialTail(int n, int accumulator) { if (n == 1) return accumulator; return factorialTail(n - 1, n * accumulator); // last operation}Why does tail recursion matter? In languages that support tail call optimization (like Scala, Kotlin, and many functional languages), tail recursive functions can be converted to iteration internally — no stack frame accumulation, O(1) space. Java does NOT perform tail call optimization, but understanding tail recursion is still important for interviews and functional programming concepts.4. Head RecursionThe recursive call happens first, before any other processing. All processing happens in the return phase.void headRecursion(int n) { if (n == 0) return; headRecursion(n - 1); // call first System.out.println(n); // process after}// Output: 1 2 3 4 5 (processes in reverse order of calls)5. Tree RecursionThe function makes more than one recursive call per invocation. This creates a tree of calls rather than a linear chain. Fibonacci is the classic example.int fibonacci(int n) { if (n <= 1) return n; return fibonacci(n - 1) + fibonacci(n - 2); // TWO recursive calls}The call tree for fibonacci(4): fib(4) / \ fib(3) fib(2) / \ / \ fib(2) fib(1) fib(1) fib(0) / \ fib(1) fib(0)Time Complexity: O(2ⁿ) — exponential! Each call spawns two more. Space Complexity: O(n) — maximum depth of the call treeThis is why memoization (caching results) is so important for tree recursion — it converts O(2ⁿ) to O(n) by never recomputing the same subproblem twice.6. Mutual RecursionA specific form of indirect recursion where two functions call each other alternately to solve a problem. Different from indirect recursion in that the mutual calls are the core mechanism of the solution.// Check if a number is even or odd using mutual recursionboolean isEven(int n) { if (n == 0) return true; return isOdd(n - 1);}boolean isOdd(int n) { if (n == 0) return false; return isEven(n - 1);}Common Recursion Patterns in DSAThese are the patterns you will see over and over in interview problems. Recognizing them is more important than memorizing solutions.Pattern 1: Linear Recursion (Do Something, Recurse on Rest)Process the current element, then recurse on the remaining problem.// Sum of arrayint arraySum(int[] arr, int index) { if (index == arr.length) return 0; // base case return arr[index] + arraySum(arr, index + 1); // current + rest}Pattern 2: Divide and Conquer (Split Into Two Halves)Split the problem into two halves, solve each recursively, combine results.// Merge Sortvoid mergeSort(int[] arr, int left, int right) { if (left >= right) return; // base case — single element int mid = (left + right) / 2; mergeSort(arr, left, mid); // sort left half mergeSort(arr, mid + 1, right); // sort right half merge(arr, left, mid, right); // combine}Pattern 3: Backtracking (Try, Recurse, Undo)Try a choice, recurse to explore it, undo the choice when backtracking.// Generate all subsetsvoid subsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { if (index == nums.length) { result.add(new ArrayList<>(current)); return; } // Choice 1: include nums[index] current.add(nums[index]); subsets(nums, index + 1, current, result); current.remove(current.size() - 1); // undo // Choice 2: exclude nums[index] subsets(nums, index + 1, current, result);}Pattern 4: Tree Recursion (Left, Right, Combine)Recurse on left subtree, recurse on right subtree, combine or process results.// Height of binary treeint height(TreeNode root) { if (root == null) return 0; // base case int leftHeight = height(root.left); // solve left int rightHeight = height(root.right); // solve right return 1 + Math.max(leftHeight, rightHeight); // combine}Pattern 5: Memoization (Cache Recursive Results)Store results of recursive calls so the same subproblem is never solved twice.Map<Integer, Integer> memo = new HashMap<>();int fibonacci(int n) { if (n <= 1) return n; if (memo.containsKey(n)) return memo.get(n); // return cached int result = fibonacci(n - 1) + fibonacci(n - 2); memo.put(n, result); // cache before returning return result;}This converts Fibonacci from O(2ⁿ) to O(n) time with O(n) space — a massive improvement.Recursion vs Iteration — When to Use WhichThis is one of the most common interview questions about recursion. Here is a clear breakdown:Use Recursion when:The problem has a naturally recursive structure (trees, graphs, divide and conquer)The solution is significantly cleaner and easier to understand recursivelyThe problem involves exploring multiple paths or choices (backtracking)The depth of recursion is manageable (not too deep to cause stack overflow)Use Iteration when:The problem is linear and a loop is equally clearMemory is a concern (iteration uses O(1) stack space vs O(n) for recursion)Performance is critical and function call overhead mattersJava's stack size limit could be hit (default around 500-1000 frames for deep recursion)The key rule: Every recursive solution can be converted to an iterative one (usually using an explicit stack). But recursive solutions for tree and graph problems are almost always cleaner to write and understand.Time and Space Complexity of Recursive FunctionsAnalyzing complexity for recursive functions requires a specific approach.The Recurrence Relation MethodExpress the time complexity as a recurrence relation and solve it.Factorial:T(n) = T(n-1) + O(1) = T(n-2) + O(1) + O(1) = T(1) + n×O(1) = O(n)Fibonacci (naive):T(n) = T(n-1) + T(n-2) + O(1) ≈ 2×T(n-1) = O(2ⁿ)Binary Search:T(n) = T(n/2) + O(1) = O(log n) [by Master Theorem]Merge Sort:T(n) = 2×T(n/2) + O(n) = O(n log n) [by Master Theorem]Space Complexity Rule for RecursionSpace complexity of a recursive function = maximum depth of the call stack × space per frameLinear recursion (factorial, sum): O(n) spaceBinary recursion (Fibonacci naive): O(n) space (maximum depth, not number of nodes)Divide and conquer (merge sort): O(log n) space (depth of recursion tree)Memoized Fibonacci: O(n) space (memo table + call stack)Classic Recursive Problems With SolutionsProblem 1: Reverse a StringString reverse(String s) { if (s.length() <= 1) return s; // base case // last char + reverse of everything before last char return s.charAt(s.length() - 1) + reverse(s.substring(0, s.length() - 1));}Dry run for "hello":reverse("hello") = 'o' + reverse("hell")reverse("hell") = 'l' + reverse("hel")reverse("hel") = 'l' + reverse("he")reverse("he") = 'e' + reverse("h")reverse("h") = "h"Unwinding: "h" → "he" → "leh" → "lleh" → "olleh" ✅Problem 2: Power Function (x^n)double power(double x, int n) { if (n == 0) return 1; // base case if (n < 0) return 1.0 / power(x, -n); // handle negative if (n % 2 == 0) { double half = power(x, n / 2); return half * half; // x^n = (x^(n/2))^2 } else { return x * power(x, n - 1); }}This is the fast power algorithm — O(log n) time instead of O(n).Problem 3: Fibonacci With Memoizationint[] memo = new int[100];Arrays.fill(memo, -1);int fib(int n) { if (n <= 1) return n; if (memo[n] != -1) return memo[n]; memo[n] = fib(n - 1) + fib(n - 2); return memo[n];}Time: O(n) — each value computed once Space: O(n) — memo array + call stackProblem 4: Tower of HanoiThe classic recursion teaching problem. Move n disks from source to destination using a helper rod.void hanoi(int n, char source, char destination, char helper) { if (n == 1) { System.out.println("Move disk 1 from " + source + " to " + destination); return; } // Move n-1 disks from source to helper hanoi(n - 1, source, helper, destination); // Move the largest disk from source to destination System.out.println("Move disk " + n + " from " + source + " to " + destination); // Move n-1 disks from helper to destination hanoi(n - 1, helper, destination, source);}Time Complexity: O(2ⁿ) — minimum moves required is 2ⁿ - 1 Space Complexity: O(n) — call stack depthProblem 5: Generate All Subsets (Power Set)void generateSubsets(int[] nums, int index, List<Integer> current, List<List<Integer>> result) { result.add(new ArrayList<>(current)); // add current subset for (int i = index; i < nums.length; i++) { current.add(nums[i]); // include generateSubsets(nums, i + 1, current, result); // recurse current.remove(current.size() - 1); // exclude (backtrack) }}For [1, 2, 3] — generates all 8 subsets: [], [1], [1,2], [1,2,3], [1,3], [2], [2,3], [3]Time: O(2ⁿ) — 2ⁿ subsets Space: O(n) — recursion depthProblem 6: Binary Search Recursivelyint binarySearch(int[] arr, int target, int left, int right) { if (left > right) return -1; // base case — not found int mid = left + (right - left) / 2; if (arr[mid] == target) return mid; else if (arr[mid] < target) return binarySearch(arr, target, mid + 1, right); else return binarySearch(arr, target, left, mid - 1);}Time: O(log n) — halving the search space each time Space: O(log n) — log n frames on the call stackRecursion on Trees — The Natural HabitatTrees are where recursion truly shines. Every tree problem becomes elegant with recursion because a tree is itself a recursive structure — each node's left and right children are trees themselves.// Maximum depth of binary treeint maxDepth(TreeNode root) { if (root == null) return 0; return 1 + Math.max(maxDepth(root.left), maxDepth(root.right));}// Check if tree is symmetricboolean isSymmetric(TreeNode left, TreeNode right) { if (left == null && right == null) return true; if (left == null || right == null) return false; return left.val == right.val && isSymmetric(left.left, right.right) && isSymmetric(left.right, right.left);}// Path sum — does any root-to-leaf path sum to target?boolean hasPathSum(TreeNode root, int target) { if (root == null) return false; if (root.left == null && root.right == null) return root.val == target; return hasPathSum(root.left, target - root.val) || hasPathSum(root.right, target - root.val);}Notice the pattern in all three — base case handles null, recursive case handles left and right subtrees, result combines both.How to Think About Any Recursive Problem — Step by StepThis is the framework you should apply to every new recursive problem you encounter:Step 1 — Identify the base case What is the smallest input where you know the answer directly without any recursion? For arrays it is usually empty array or single element. For trees it is null node. For numbers it is 0 or 1.Step 2 — Trust the recursive call Assume your function already works correctly for smaller inputs. Do not trace through the entire recursion mentally — just trust it. This is the Leap of Faith and it is what makes recursion feel natural.Step 3 — Express the current problem in terms of smaller problems How does the answer for size n relate to the answer for size n-1 (or n/2, or subtrees)? This relationship is your recursive case.Step 4 — Make sure each call moves toward the base case The input must become strictly smaller with each call. If it does not, you have infinite recursion.Step 5 — Write the base case first, then the recursive case Always. Writing the recursive case first leads to bugs because you have not defined when to stop.Common Mistakes and How to Avoid ThemMistake 1: Missing or wrong base case The most common mistake. Missing the base case causes StackOverflowError. Wrong base case causes wrong answers.Always ask — what is the simplest possible input, and what should the function return for it? Write that case first.Mistake 2: Not moving toward the base case If you call factorial(n) inside factorial(n) without reducing n, you loop forever. Every recursive call must make the problem strictly smaller.Mistake 3: Trusting your brain to trace deep recursion Do not try to trace 10 levels of recursion in your head. Trust the recursive call, verify the base case, and check that each call reduces the problem. That is all you need.Mistake 4: Forgetting to return the recursive result// WRONG — result is computed but not returnedint sum(int n) { if (n == 0) return 0; sum(n - 1) + n; // computed but discarded!}// CORRECTint sum(int n) { if (n == 0) return 0; return sum(n - 1) + n;}Mistake 5: Modifying shared state without backtracking In backtracking problems, if you add something to a list before a recursive call, you must remove it after the call returns. Forgetting to backtrack leads to incorrect results and is one of the trickiest bugs to find.Mistake 6: Recomputing the same subproblems Naive Fibonacci computes fib(3) multiple times when computing fib(5). Use memoization whenever you notice overlapping subproblems in your recursion tree.Top LeetCode Problems on RecursionThese are organized by pattern — work through them in this order for maximum learning:Pure Recursion Basics:509. Fibonacci Number — Easy — start here, implement with and without memoization344. Reverse String — Easy — recursion on arrays206. Reverse Linked List — Easy — recursion on linked list50. Pow(x, n) — Medium — fast power with recursionTree Recursion (Most Important):104. Maximum Depth of Binary Tree — Easy — simplest tree recursion112. Path Sum — Easy — decision recursion on tree101. Symmetric Tree — Easy — mutual recursion on tree110. Balanced Binary Tree — Easy — bottom-up recursion236. Lowest Common Ancestor of a Binary Tree — Medium — classic tree recursion124. Binary Tree Maximum Path Sum — Hard — advanced tree recursionDivide and Conquer:148. Sort List — Medium — merge sort on linked list240. Search a 2D Matrix II — Medium — divide and conquerBacktracking:78. Subsets — Medium — generate all subsets46. Permutations — Medium — generate all permutations77. Combinations — Medium — generate combinations79. Word Search — Medium — backtracking on grid51. N-Queens — Hard — classic backtrackingMemoization / Dynamic Programming:70. Climbing Stairs — Easy — Fibonacci variant with memoization322. Coin Change — Medium — recursion with memoization to DP139. Word Break — Medium — memoized recursionRecursion Cheat Sheet// Linear recursion templatereturnType solve(input) { if (baseCase) return directAnswer; // process current return solve(smallerInput);}// Tree recursion templatereturnType solve(TreeNode root) { if (root == null) return baseValue; returnType left = solve(root.left); returnType right = solve(root.right); return combine(left, right, root.val);}// Backtracking templatevoid backtrack(choices, current, result) { if (goalReached) { result.add(copy of current); return; } for (choice : choices) { make(choice); // add to current backtrack(...); // recurse undo(choice); // remove from current }}// Memoization templateMap<Input, Output> memo = new HashMap<>();returnType solve(input) { if (baseCase) return directAnswer; if (memo.containsKey(input)) return memo.get(input); returnType result = solve(smallerInput); memo.put(input, result); return result;}FAQs — People Also AskQ1. What is recursion in Java with a simple example? Recursion is when a function calls itself to solve a smaller version of the same problem. A simple example is factorial — factorial(5) = 5 × factorial(4) = 5 × 4 × factorial(3) and so on until factorial(1) returns 1 directly.Q2. What is the difference between recursion and iteration? Iteration uses loops (for, while) and runs in O(1) space. Recursion uses function calls and uses O(n) stack space for n levels deep. Recursion is often cleaner for tree and graph problems. Iteration is better when memory is a concern or the problem is inherently linear.Q3. What causes StackOverflowError in Java recursion? StackOverflowError happens when recursion goes too deep — too many frames accumulate on the call stack before any of them return. This is caused by missing base case, wrong base case, or input too large for Java's default stack size limit.Q4. What is the difference between recursion and dynamic programming? Recursion solves a problem by breaking it into subproblems. Dynamic programming is recursion plus memoization — storing results of subproblems so they are never computed twice. DP converts exponential recursive solutions into polynomial ones by eliminating redundant computation.Q5. What is tail recursion and does Java support tail call optimization? Tail recursion is when the recursive call is the absolute last operation in the function. Java does NOT support tail call optimization — Java always creates a new stack frame for each call even if it is tail recursive. Languages like Scala and Kotlin (on the JVM) do support it with the tailrec keyword.Q6. How do you convert recursion to iteration? Every recursive solution can be converted to iterative using an explicit stack data structure. The call stack's behavior is replicated manually — push the initial call, loop while stack is not empty, pop, process, and push sub-calls. Tree traversals are a common example of this conversion.ConclusionRecursion is not magic. It is a systematic way of solving problems by expressing them in terms of smaller versions of themselves. Once you internalize the two parts (base case and recursive case), understand the call stack mentally, and learn to trust the recursive call rather than trace it completely, everything clicks.The learning path from here is clear — start with simple problems like Fibonacci and array sum. Move to tree problems where recursion is most natural. Then tackle backtracking. Finally add memoization to bridge into dynamic programming.Every hour you spend understanding recursion deeply pays dividends across the entire rest of your DSA journey. Trees, graphs, divide and conquer, backtracking, dynamic programming — all of them build on this foundation.

RecursionJavaBase CaseCall StackBacktrackingDynamic Programming
LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

LeetCode 230: Kth Smallest Element in a BST – Java Recursive Inorder Traversal Solution

IntroductionLeetCode 230 – Kth Smallest Element in a BST is one of the most important Binary Search Tree interview problems.This question is popular because it tests:BST propertiesInorder traversalDFS recursionTree traversal optimizationRecursive state managementUnderstanding this problem properly builds a strong foundation for advanced BST problems.Problem Link🔗 https://leetcode.com/problems/kth-smallest-element-in-a-bst/Problem StatementGiven:Root of a Binary Search TreeInteger kReturn:The kth smallest value in the BSTThe indexing is:1-indexedExample 1Inputroot = [3,1,4,null,2]k = 1Output1ExplanationBST inorder traversal becomes:[1,2,3,4]1st smallest element is:1Example 2Inputroot = [5,3,6,2,4,null,null,1]k = 3Output3Key ObservationThe most important BST property:Inorder Traversal of BST gives sorted orderExample:5/ \3 6/ \2 4/1Inorder traversal:1 → 2 → 3 → 4 → 5 → 6So:kth smallest = kth node in inorder traversalIntuitionWe perform:Left → Root → RightWhile traversing:Keep counting visited nodesWhen count becomes kStore answerNo need to traverse entire tree after finding answer.Brute Force ApproachIdeaStore complete inorder traversal in listReturn:list.get(k - 1)Brute Force Java Solutionclass Solution {public void inorder(TreeNode root, List<Integer> list) {if(root == null) return;inorder(root.left, list);list.add(root.val);inorder(root.right, list);}public int kthSmallest(TreeNode root, int k) {List<Integer> list = new ArrayList<>();inorder(root, list);return list.get(k - 1);}}Complexity of Brute ForceTime ComplexityO(N)Space ComplexityO(N)Extra list storage required.Optimized Recursive ApproachIdeaInstead of storing entire traversal:Maintain counterStop when kth node is reachedThis saves unnecessary storage.Java Solutionclass Solution {int coun = 0;int ans = -1;public void inorder(TreeNode root, int k, List<Integer> lis) {if(root == null) return;inorder(root.left, k, lis);coun++;if(coun == k) {ans = root.val;return;}inorder(root.right, k, lis);}public int kthSmallest(TreeNode root, int k) {List<Integer> lis = new ArrayList<>();inorder(root, k, lis);return ans;}}Cleaner Optimized Versionclass Solution {int count = 0;int answer = -1;public void inorder(TreeNode root, int k) {if(root == null) return;inorder(root.left, k);count++;if(count == k) {answer = root.val;return;}inorder(root.right, k);}public int kthSmallest(TreeNode root, int k) {inorder(root, k);return answer;}}Why This WorksBST inorder traversal always visits nodes in:sorted ascending orderSo:1st visited node = smallest2nd visited node = second smallestkth visited node = kth smallestDry RunInputroot = [5,3,6,2,4,null,null,1]k = 3BST Structure5/ \3 6/ \2 4/1Inorder Traversal1 → 2 → 3 → 4 → 5 → 6Counter ProgressNodeCount112233At count = 3:answer = 3Final Output3Iterative Stack ApproachIdeaUse explicit stack instead of recursion.Iterative Java Solutionclass Solution {public int kthSmallest(TreeNode root, int k) {Stack<TreeNode> stack = new Stack<>();while(true) {while(root != null) {stack.push(root);root = root.left;}root = stack.pop();k--;if(k == 0) {return root.val;}root = root.right;}}}Time Complexity AnalysisOptimized RecursiveTime ComplexityO(H + k)Where:H = tree heightWe visit only required nodesWorst case:O(N)Space ComplexityO(H)Recursive stack space.Iterative ComplexityTime ComplexityO(H + k)Space ComplexityO(H)Stack space.Follow-Up OptimizationProblem Follow-UpWhat if BST changes frequently?Example:Insert operationsDelete operationsFrequent kth smallest queriesAdvanced OptimizationStore:size of subtreeinside every node.This allows:O(log N)kth smallest queries.This concept is used in:Order Statistic TreesAugmented BSTsIndexed TreesInterview ExplanationIn interviews, explain:Inorder traversal of a BST gives nodes in sorted order. Therefore, the kth visited node during inorder traversal is the kth smallest element.This demonstrates:BST understandingDFS recursionTree traversal masteryOptimization thinkingCommon Mistakes1. Forgetting BST PropertyThis solution works because BST inorder traversal is sorted.Not true for normal binary trees.2. Using Extra Array UnnecessarilyOptimized approach avoids storing entire traversal.3. Incorrect Counter PlacementCounter must increase:AFTER left traversalBEFORE right traversal4. Forgetting Early ReturnOnce kth element is found:answer should be stored immediatelyFAQsQ1. Why does inorder traversal work?Because BST inorder traversal produces sorted order.Q2. Can this be solved iteratively?Yes.Using stack-based inorder traversal.Q3. Why is BST important here?Without BST ordering property:kth smallest cannot be determined using inorderQ4. Is this frequently asked?Yes.It is one of the most common BST interview questions.ConclusionLeetCode 230 is an excellent BST problem for mastering:Inorder traversalBST propertiesDFS recursionStack traversalTree optimizationThe core insight is:Inorder traversal of a BST always produces sorted order.Once this concept becomes intuitive, many BST interview problems become much easier.

LeetCodeKth Smallest Element in BSTBinary Search TreeJavaInorder TraversalBSTMedium
Find All Numbers Disappeared in an Array

Find All Numbers Disappeared in an Array

LeetCode Problem 448Link of the Problem to try -: LinkGiven an array nums of n integers where nums[i] is in the range [1, n], return an array of all the integers in the range [1, n] that do not appear in nums. Example 1:Input: nums = [4,3,2,7,8,2,3,1]Output: [5,6]Example 2:Input: nums = [1,1]Output: [2] Constraints:n == nums.length1 <= n <= 1051 <= nums[i] <= nSolution:In this question as the question suggests we have to find the missing element from the array that is not in the array but comes in that range of 1 to array.length and we can solve this by creating an HashMap where we simply store all the elements and then run the loop again from 1 to array.length and then check is that element present if not then store it on our ArrayList and return it this is how we can solve this question easily in O(n) Time Complexity.Code: public List<Integer> findDisappearedNumbers(int[] nums) { HashMap<Integer,Integer> mp = new HashMap<>(); List<Integer> lis = new ArrayList<>(); for(int i =0;i<nums.length;i++){ mp.put(nums[i],0); } for(int i = 1;i<=nums.length;i++){ if(!mp.containsKey(i)){ lis.add(i); } } return lis; }

LeetCodeHashMapEasy
LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

LeetCode 22 Generate Parentheses | Backtracking Java Solution Explained

IntroductionThe Generate Parentheses problem is one of the most important and frequently asked backtracking questions in coding interviews.At first glance, it may look like a simple string generation problem—but the real challenge is to generate only valid (well-formed) parentheses combinations.This problem is a perfect example of:Constraint-based recursionBacktracking with conditionsDecision tree pruningIn this article, we’ll break down the intuition, understand the constraints, and implement a clean and efficient solution.🔗 Problem LinkLeetCode: Generate ParenthesesProblem StatementGiven n pairs of parentheses:👉 Generate all combinations of well-formed parenthesesExamplesExample 1Input:n = 3Output:["((()))","(()())","(())()","()(())","()()()"]Example 2Input:n = 1Output:["()"]Key InsightWe are not generating all possible strings—we are generating only valid parentheses.Rules of Valid ParenthesesNumber of ( must equal number of )At any point:closing brackets should never exceed opening bracketsIntuition (Decision Making)At every step, we have two choices:Add "(" OR Add ")"But we cannot always take both choices.Valid ConditionsWhen can we add "("?If open > 0When can we add ")"?If close > open👉 This ensures the string always remains valid.Decision Tree (n = 3)👉 You can add your tree diagram here for better visualization.Conceptual FlowStart: ""→ "(" → "(("→ "(((" → "((()"→ ...Invalid paths like ")(" are never explored because of constraints.Approach: Backtracking with ConstraintsIdeaKeep track of:Remaining open bracketsRemaining close bracketsBuild string step by stepOnly take valid decisionsJava Codeimport java.util.*;class Solution {// List to store all valid combinationsList<String> lis = new ArrayList<>();public void solve(int open, int close, String curr) {// Base case: no brackets leftif (open == 0 && close == 0) {lis.add(curr); // valid combinationreturn;}// Choice 1: Add opening bracket "("// Allowed only if we still have opening brackets leftif (open > 0) {solve(open - 1, close, curr + "(");}// Choice 2: Add closing bracket ")"// Allowed only if closing brackets > opening bracketsif (open < close) {solve(open, close - 1, curr + ")");}}public List<String> generateParenthesis(int n) {solve(n, n, ""); // start recursionreturn lis;}}Step-by-Step Execution (n = 2)Start: ""→ "("→ "(("→ "(())"→ "()"→ "()()"Complexity AnalysisTime Complexity: O(4ⁿ / √n) (Catalan Number)Space Complexity: O(n) recursion stackWhy Catalan Number?The number of valid parentheses combinations is:Cn = (1 / (n+1)) * (2n choose n)Why This Approach WorksIt avoids invalid combinations earlyUses constraints to prune recursion treeGenerates only valid resultsEfficient compared to brute force❌ Naive Approach (Why It Fails)Generate all combinations of ( and ):Total combinations = 2^(2n)Then filter valid ones👉 Very inefficient → TLEKey TakeawaysThis is a constraint-based recursion problemAlways:Add "(" if availableAdd ")" only if validBacktracking avoids invalid pathsImportant pattern for interviewsCommon Interview VariationsValid parentheses checkingLongest valid parenthesesRemove invalid parenthesesBalanced expressionsConclusionThe Generate Parentheses problem is a must-know backtracking problem. It teaches how to apply constraints during recursion to efficiently generate valid combinations.Once mastered, this pattern becomes extremely useful in solving many advanced recursion problems.Frequently Asked Questions (FAQs)1. Why can’t we add ")" anytime?Because it may create invalid sequences like ")(".2. What is the key trick?Ensure:close > open3. Is recursion the best approach?Yes, it is the most intuitive and efficient method.

MediumLeetCodeJavaRecursion
Reverse Vowels of a String – From Extra Space Approach to Two Pointer Optimization (LeetCode 345)

Reverse Vowels of a String – From Extra Space Approach to Two Pointer Optimization (LeetCode 345)

🔗 Problem LinkLeetCode 345 – Reverse Vowels of a String 👉 https://leetcode.com/problems/reverse-vowels-of-a-string/IntroductionThis problem is very similar to Reverse Only Letters, but with a small twist:Instead of reversing all letters, we only reverse the vowels.At first, we might think of extracting vowels, reversing them, and putting them back. That works — but it is not the most optimal approach.In this article, we’ll:Understand the brute-force style approach (your solution)Analyze its time complexityOptimize it using the Two Pointer patternCompare both approaches📌 Problem UnderstandingYou are given a string s.You must:Reverse only the vowelsKeep all other characters in the same positionVowels include:a, e, i, o, uA, E, I, O, UExample 1Input: "IceCreAm"Output: "AceCreIm"Vowels: ['I','e','e','A'] Reversed: ['A','e','e','I']Example 2Input: "leetcode"Output: "leotcede"🧠 Your First Approach – Extract, Reverse, ReplaceYour idea:Extract all vowels into a string.Store their indices.Reverse the vowel string.Replace vowels at stored indices.Let’s look at your code.💻 Your Code (Extract & Replace Method)class Solution { public String reverseVowels(String s) { String vow = ""; List<Integer> lis = new ArrayList<>(); HashMap<Integer,Character> mp = new HashMap<>(); for(int i =0;i<s.length();i++){ if(((s.charAt(i) == 'a') || (s.charAt(i) == 'e') || (s.charAt(i) == 'i') || (s.charAt(i) == 'o') || (s.charAt(i) == 'u') || (s.charAt(i) == 'A') || (s.charAt(i) == 'E') || (s.charAt(i) == 'I') || (s.charAt(i) == 'O') || (s.charAt(i) == 'U')) ){ vow += s.charAt(i); lis.add(i); } } String so = ""; for(int i = vow.length()-1; i >= 0; i--){ so += vow.charAt(i); } for(int i =0; i< lis.size();i++){ mp.put(lis.get(i), so.charAt(i)); } String ans = ""; for(int i =0 ; i< s.length();i++){ if(mp.containsKey(i)){ ans += mp.get(i); }else{ ans += s.charAt(i); } } return ans; }}🔍 How This WorksStep 1 – Extract VowelsStore:Vowel characters in vowTheir indices in lisStep 2 – Reverse the Vowel StringCreate new reversed string so.Step 3 – Map Indices to Reversed VowelsUse a HashMap to store:index → reversed vowelStep 4 – Build Final StringTraverse original string:If index in map → use reversed vowelElse → use original character⚠️ Problem with This ApproachAlthough correct, it has inefficiencies:String concatenation (+=) → O(n²) in worst caseExtra space used:Vowel stringList of indicesHashMapFinal answer stringTime Complexity: O(n²) (due to string concatenation) Space Complexity: O(n)We can do better.🚀 Optimized Approach – Two Pointers (Best Solution)Instead of extracting vowels separately, we can:Convert string into char arrayUse two pointersSwap vowels directlyThis avoids extra structures.💻 Optimized Two Pointer Solutionclass Solution { public String reverseVowels(String s) { int i = 0, j = s.length() - 1; char[] arr = s.toCharArray(); while(i < j){ if(!isVowel(arr[i])){ i++; } else if(!isVowel(arr[j])){ j--; } else{ char temp = arr[i]; arr[i] = arr[j]; arr[j] = temp; i++; j--; } } return new String(arr); } private boolean isVowel(char c){ return c=='a'||c=='e'||c=='i'||c=='o'||c=='u'|| c=='A'||c=='E'||c=='I'||c=='O'||c=='U'; }}🎯 Why This WorksWe:Move left pointer until vowel foundMove right pointer until vowel foundSwapContinueNo extra storage needed.⏱ Complexity ComparisonYour ApproachTime: O(n²) (string concatenation)Space: O(n)Two Pointer ApproachTime: O(n)Space: O(n) (char array)Much cleaner and faster.🔥 Key LearningThis problem reinforces:Two pointer patternIn-place modificationAvoiding unnecessary extra spaceRecognizing optimization opportunitiesWhenever you see:"Reverse something but keep other elements fixed"Think:👉 Two Pointers🏁 Final ThoughtsYour approach shows strong logical thinking:Extract → Reverse → ReplaceThat’s a valid way to solve it.But the optimized two-pointer approach is more interview-friendly.If you master this pattern, you can easily solve:Reverse Only LettersReverse StringValid PalindromeRemove Duplicates from Sorted Array

Two PointersString ManipulationHashMapLeetCodeEasy
Find All Duplicates in an Array

Find All Duplicates in an Array

LeetCode Problem 448 – Find All Numbers Disappeared in an ArrayProblem Link: LinkProblem StatementYou are given an array nums of length n, where each element nums[i] lies in the range [1, n]. Your task is to return all numbers in the range [1, n] that do not appear in the array.Example 1Inputnums = [4, 3, 2, 7, 8, 2, 3, 1]Output[5, 6]Example 2Inputnums = [1, 1]Output[2]Constraintsn == nums.length1 ≤ n ≤ 10⁵1 ≤ nums[i] ≤ nApproachThe goal is to identify numbers within the range 1 to n that are missing from the given array.One straightforward way to solve this problem is by using a HashMap to track the presence of each number:Traverse the array and store each element in a HashMap.Iterate through the range 1 to n.For each number, check whether it exists in the HashMap.If a number is not present, add it to the result list.This approach ensures that:Each element is processed only once.Lookup operations are efficient.Time and Space ComplexityTime Complexity: O(n)Space Complexity: O(n) (due to the HashMap)Solution Code (Java)public List<Integer> findDisappearedNumbers(int[] nums) { HashMap<Integer, Integer> map = new HashMap<>(); List<Integer> result = new ArrayList<>(); // Store all elements in the HashMap for (int num : nums) { map.put(num, 0); } // Check for missing numbers in the range [1, n] for (int i = 1; i <= nums.length; i++) { if (!map.containsKey(i)) { result.add(i); } } return result;}Final NotesWhile this solution is simple and easy to understand, it uses additional space.LeetCode also offers a constant space solution by modifying the input array in-place, which is worth exploring for optimization.

LeetCodeMediumHashMap
Sort a Stack Using Recursion - Java Solution Explained

Sort a Stack Using Recursion - Java Solution Explained

IntroductionSort a Stack is one of those problems that feels impossible at first — you only have access to the top of a stack, you cannot index into it, and the only tools you have are push, pop, and peek. How do you sort something with such limited access?The answer is recursion. And this problem is a perfect example of how recursion can do something elegant that feels like it should require much more complex logic.You can find this problem here — Sort a Stack — GeeksForGeeksThis article explains the complete intuition, both recursive functions in detail, a thorough dry run, all approaches, and complexity analysis.What Is the Problem Really Asking?You have a stack of integers. Sort it so that the smallest element is at the bottom and the largest element is at the top.Input: [41, 3, 32, 2, 11] (11 is at top)Output: [41, 32, 11, 3, 2] (2 is at top, 41 at bottom)Wait — if smallest is at bottom and largest at top, then popping gives you the smallest first. So the stack is sorted in ascending order from top to bottom when you pop.The constraints make this interesting — you can only use stack operations (push, pop, peek, isEmpty). No arrays, no sorting algorithms directly on the data, no random access.Real Life Analogy — Sorting a Stack of BooksImagine a stack of books of different thicknesses on your desk. You want the thinnest book on top and thickest at the bottom. But you can only take from the top.Here is what you do — pick up books one by one from the top and set them aside. Once you have removed enough, place each book back in its correct position. If the book you are placing is thicker than what is currently on top, slide the top books aside temporarily, place the thick book down, then put the others back.That is exactly what the recursive sort does — take elements out one by one, and insert each back into the correct position.The Core Idea — Two Recursive Functions Working TogetherThe solution uses two recursive functions that work hand in hand:sortStack(st) — removes elements one by one until the stack is empty, then inserts each back using insertinsert(st, temp) — inserts a single element into its correct sorted position in an already-sorted stackThink of it like this — sortStack is the manager that empties the stack recursively, and insert is the worker that places each element in the right position on the way back.Function 1: sortStack — The Main Recursive Driverpublic void sortStack(Stack<Integer> st) { // base case — empty or single element is already sorted if (st.empty() || st.size() == 1) return; // Step 1: remove the top element int temp = st.pop(); // Step 2: recursively sort the remaining stack sortStack(st); // Step 3: insert the removed element in correct position insert(st, temp);}How to Think About ThisThe leap of faith here — trust that sortStack correctly sorts whatever is below. After the recursive call, the remaining stack is perfectly sorted. Now your only job is to insert temp (the element you removed) into its correct position in that sorted stack.This is the classic "solve smaller, fix current" recursion pattern. Reduce the problem by one element, trust recursion for the rest, then fix the current element's position.Function 2: insert — Placing an Element in Sorted Positionvoid insert(Stack<Integer> st, int temp) { // base case 1: stack is empty — just push // base case 2: top element is smaller or equal — push on top if (st.empty() || st.peek() <= temp) { st.push(temp); return; } // top element is greater than temp // temp needs to go below the top element int val = st.pop(); // temporarily remove the top insert(st, temp); // try inserting temp deeper st.push(val); // restore the removed element on top}How to Think About ThisYou want to insert temp in sorted order. The stack is already sorted (largest on top). So:If the top is smaller than or equal to temp → temp belongs on top. Push it.If the top is greater than temp → temp needs to go below the top. So pop the top temporarily, try inserting temp deeper, then push the top back.This is the same "pop, recurse deeper, push back" pattern you saw in the Baseball Game problem — when you need to access elements below the top without permanent removal.Complete Solutionclass Solution { // insert temp into its correct position in sorted stack void insert(Stack<Integer> st, int temp) { if (st.empty() || st.peek() <= temp) { st.push(temp); return; } int val = st.pop(); insert(st, temp); st.push(val); } // sort the stack using recursion public void sortStack(Stack<Integer> st) { if (st.empty() || st.size() == 1) return; int temp = st.pop(); // remove top sortStack(st); // sort remaining insert(st, temp); // insert top in correct position }}Detailed Dry Run — st = [3, 2, 1] (1 at top)Let us trace every single call carefully.sortStack calls (going in):sortStack([3, 2, 1]) temp = 1, remaining = [3, 2] call sortStack([3, 2]) temp = 2, remaining = [3] call sortStack([3]) size == 1, return ← base case now insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 ← base case push val=3 back stack is now [2, 3] (3 on top) sortStack([3,2]) done → stack = [2, 3] now insert(st=[2,3], temp=1) peek=3 > 1, pop val=3 insert(st=[2], temp=1) peek=2 > 1, pop val=2 insert(st=[], temp=1) st empty, push 1 ← base case push val=2 back stack = [1, 2] push val=3 back stack = [1, 2, 3] (3 on top)sortStack done → stack = [1, 2, 3]✅ Final stack (3 on top, 1 at bottom): largest at top, smallest at bottom — correctly sorted!Detailed Dry Run — st = [41, 3, 32, 2, 11] (11 at top)Let us trace at a higher level to see the pattern:sortStack calls unwinding (popping phase):sortStack([41, 3, 32, 2, 11]) pop 11, sortStack([41, 3, 32, 2]) pop 2, sortStack([41, 3, 32]) pop 32, sortStack([41, 3]) pop 3, sortStack([41]) base case — return insert([41], 3) → [3, 41] (41 on top) insert([3, 41], 32) → [3, 32, 41] (41 on top) insert([3, 32, 41], 2) → [2, 3, 32, 41] (41 on top) insert([2, 3, 32, 41], 11) → [2, 3, 11, 32, 41] (41 on top)✅ Final: [2, 3, 11, 32, 41] with 41 at top, 2 at bottom — correct!Let us verify the insert([3, 32, 41], 2) step in detail since it involves multiple pops:insert(st=[3, 32, 41], temp=2) peek=41 > 2, pop val=41 insert(st=[3, 32], temp=2) peek=32 > 2, pop val=32 insert(st=[3], temp=2) peek=3 > 2, pop val=3 insert(st=[], temp=2) st empty, push 2 push val=3 back → [2, 3] push val=32 back → [2, 3, 32] push val=41 back → [2, 3, 32, 41]Beautiful chain of pops followed by a chain of pushes — recursion handling what would be very messy iterative logic.Approach 2: Using an Additional Stack (Iterative)If recursion is not allowed or you want an iterative solution, you can use a second stack.public void sortStack(Stack<Integer> st) { Stack<Integer> tempStack = new Stack<>(); while (!st.empty()) { int curr = st.pop(); // move elements from tempStack back to st // until we find the right position for curr while (!tempStack.empty() && tempStack.peek() > curr) { st.push(tempStack.pop()); } tempStack.push(curr); } // move everything back to original stack while (!tempStack.empty()) { st.push(tempStack.pop()); }}How This WorkstempStack is maintained in sorted order (smallest on top). For each element popped from st, we move elements from tempStack back to st until we find the right position, then push. At the end, transfer everything back.Time Complexity: O(n²) — same as recursive approach Space Complexity: O(n) — explicit extra stackApproach 3: Using Collections.sort (Cheat — Not Recommended)public void sortStack(Stack<Integer> st) { List<Integer> list = new ArrayList<>(st); Collections.sort(list); // ascending st.clear(); for (int num : list) { st.push(num); // smallest pushed first = smallest at bottom }}This gives the right answer but completely defeats the purpose of the problem. Never use this in an interview — it shows you do not understand the problem's intent.Time Complexity: O(n log n) Space Complexity: O(n)Approach ComparisonApproachTimeSpaceAllowed in InterviewCode ComplexityRecursive (Two Functions)O(n²)O(n)✅ Best answerMediumIterative (Two Stacks)O(n²)O(n)✅ Good alternativeMediumCollections.sortO(n log n)O(n)❌ Defeats purposeEasyTime and Space Complexity AnalysisRecursive ApproachTime Complexity: O(n²)For each of the n elements popped by sortStack, the insert function may traverse the entire stack to find the correct position — O(n) per insert. Total: O(n) × O(n) = O(n²).This is similar to insertion sort — and in fact, this recursive approach IS essentially insertion sort implemented on a stack using recursion.Space Complexity: O(n)No extra data structure is used. But the call stack holds up to n frames for sortStack and up to n additional frames for insert. In the worst case, total recursion depth is O(n) + O(n) = O(n) space.The Connection to Insertion SortIf you have studied sorting algorithms, this solution will look very familiar. It is Insertion Sort implemented recursively on a stack:sortStack is like the outer loop — take one element at a timeinsert is like the inner loop — find the correct position by comparing and shiftingThe key difference from array-based insertion sort is that "shifting" in an array is done by moving elements right. Here, "shifting" is done by temporarily popping elements off the stack, inserting at the right depth, then pushing back. Recursion handles the "shift" naturally.Common Mistakes to AvoidWrong base case in insert The base case is st.empty() || st.peek() <= temp. Both conditions are needed. Without st.empty(), you call peek() on an empty stack and get an exception. Without st.peek() <= temp, you never stop even when you find the right position.Using < instead of <= in insert Using strictly less than means equal elements get treated as "wrong position" and cause unnecessary recursion. Using <= correctly handles duplicates — equal elements stay in their current relative order.Calling sortStack instead of insert inside insert insert should only call itself recursively. Calling sortStack inside insert re-sorts an already-sorted stack — completely wrong and causes incorrect results.Not pushing val back after the recursive insert call This is the most common bug. After insert(st, temp) places temp in the correct position, you must push val back on top. Forgetting this loses elements from the stack permanently.FAQs — People Also AskQ1. How do you sort a stack without using extra space in Java? Using recursion — the call stack itself serves as temporary storage. sortStack removes elements one by one and insert places each back in its correct sorted position. No explicit extra data structure is needed, but O(n) implicit call stack space is used.Q2. What is the time complexity of sorting a stack using recursion? O(n²) in all cases — for each of the n elements, the insert function traverses up to n elements to find the correct position. This is equivalent to insertion sort applied to a stack.Q3. Can you sort a stack without recursion? Yes — using a second auxiliary stack. Pop elements from the original stack one by one and insert each into the correct position in the second stack by temporarily moving elements back. Transfer everything back to the original stack at the end.Q4. Why does the insert function need to push val back after the recursive call? Because the goal of insert is to place temp in the correct position WITHOUT losing any existing elements. When we pop val temporarily to go deeper, we must restore it after temp has been placed. Not restoring it means permanently losing that element from the stack.Q5. Is sorting a stack asked in coding interviews? Yes, it appears frequently at companies like Amazon, Adobe, and in platforms like GeeksForGeeks and InterviewBit. It tests whether you understand recursion deeply enough to use it as a mechanism for reordering — not just for computation.Similar Problems to Practice NextDelete Middle Element of a Stack — use same recursive pop-recurse-push patternReverse a Stack — very similar recursive approach, great warmup84. Largest Rectangle in Histogram — advanced stack problem946. Validate Stack Sequences — stack simulation150. Evaluate Reverse Polish Notation — stack with operationsConclusionSort a Stack Using Recursion is a beautiful problem that demonstrates the true power of recursion — using the call stack itself as temporary storage to perform operations that would otherwise require extra data structures.The key insight is splitting the problem into two clean responsibilities. sortStack handles one job — peel elements off one by one until the base case, then trigger insert on the way back up. insert handles one job — place a single element into its correct position in an already-sorted stack by temporarily moving larger elements aside.Once you see those two responsibilities clearly, the code almost writes itself. And once this pattern clicks, it directly prepares you for more advanced recursive problems like reversing a stack, deleting the middle element, and even understanding how recursive backtracking works at a deeper level.

StackRecursionJavaGeeksForGeeksMedium
LeetCode 2033: Minimum Operations to Make a Uni-Value Grid | Java Solution Explained (Median Approach)

LeetCode 2033: Minimum Operations to Make a Uni-Value Grid | Java Solution Explained (Median Approach)

IntroductionIn this problem, we are given a 2D grid and an integer x.We can perform one operation where we either:Add x to any grid elementSubtract x from any grid elementOur goal is to make all elements in the grid equal using the minimum number of operations.If making all values equal is not possible, we return -1.This problem may initially look like a matrix manipulation question, but the actual logic is based on:Array transformationMedian propertyGreedy optimization# Problem LinkProblem StatementYou are given:A 2D integer grid of size m × nAn integer xYou can perform operations where you add or subtract x from any cell.A grid becomes uni-value when all elements become equal.Return the minimum number of operations needed.If impossible, return -1.ExampleExample 1Input:grid = [[2,4],[6,8]]x = 2Output:4Explanation:We can make every element equal to 4.2 → 4 (1 operation)6 → 4 (1 operation)8 → 4 (2 operations)Total = 4 operations.Key ObservationBefore solving the problem, we must understand one important rule.If we can add or subtract only x, then:All numbers must belong to the same remainder group when divided by x.Meaning:value % x must be same for every elementWhy?Because if two numbers have different remainders, they can never become equal using only +x or -x operations.IntuitionWe need to convert all numbers into a single target value.But what target value gives minimum operations?The answer is:MedianFor minimizing total absolute distance, median gives the optimal answer.Since every operation changes value by x, we can:Flatten grid into a listSort the listPick median as targetCalculate operations requiredWhy Median Works?Median minimizes:Sum of absolute differencesFor example:Numbers = [1, 2, 3, 10]If target = 2|1-2| + |2-2| + |3-2| + |10-2| = 10If target = 5|1-5| + |2-5| + |3-5| + |10-5| = 14Median gives minimum total distance.Approach 1: Brute ForceWe can try every possible number as target.For each target:Calculate operations requiredStore minimum answerTime ComplexityO(N²)Where N = total grid elementsThis is slow for large constraints.Approach 2: Optimal Median ApproachThis is the best approach.StepsStep 1: Flatten GridConvert 2D grid into 1D array.Step 2: Sort ArraySorting helps us find median.Step 3: Check ValidityAll values must have same remainder when divided by x.value % x must matchOtherwise return -1.Step 4: Pick MedianMedian minimizes operations.Step 5: Count OperationsFor every element:operations += abs(value - median) / xJava Solutionclass Solution {public int minOperations(int[][] grid, int x) {List<Integer> lis = new ArrayList<>();for (int i = 0; i < grid.length; i++) {for (int j = 0; j < grid[0].length; j++) {lis.add(grid[i][j]);}}Collections.sort(lis);int mid = lis.size() / 2;int remainder = lis.get(0) % x;for (int value : lis) {if (value % x != remainder) {return -1;}}int ans = 0;for (int value : lis) {int diff = Math.abs(lis.get(mid) - value);ans += diff / x;}return ans;}}Code ExplanationStep 1: Flatten Matrixlis.add(grid[i][j]);We convert grid into list.Step 2: Sort ListCollections.sort(lis);Sorting allows median selection.Step 3: Check Possibilityif(value % x != remainder)If remainders differ, answer becomes impossible.Step 4: Select Medianint mid = lis.size()/2;Median becomes target value.Step 5: Calculate Operationsans += diff/x;Difference divided by x gives operations.Dry RunInput:grid = [[2,4],[6,8]]x = 2Flatten:[2,4,6,8]Sort:[2,4,6,8]Median:6Operations:2 → 6 = 2 operations4 → 6 = 1 operation6 → 6 = 0 operation8 → 6 = 1 operationTotal:4 operationsTime ComplexityFlatten GridO(N)SortingO(N log N)Traverse ArrayO(N)Total ComplexityO(N log N)Where:N = m × nSpace ComplexityWe store all elements in list.O(N)Common Mistakes1. Forgetting Mod CheckMany people directly calculate operations.But without checking:value % xanswer may become invalid.2. Choosing Average Instead of MedianAverage does not minimize absolute distance.Median is required.3. Not Sorting Before Finding MedianMedian requires sorted array.4. Forgetting Division by xOperations are not direct difference.Correct formula:abs(target - value) / xEdge CasesCase 1All values already equal.Answer = 0Case 2Different modulo values.Return -1Case 3Single cell grid.No operation neededFAQsQ1. Why do we use median?Median minimizes total absolute difference.Q2. Why not average?Average minimizes squared distance, not absolute operations.Q3. Why modulo condition is important?Because we can only move by multiples of x.Q4. Can we solve without sorting?Sorting is easiest way to get median.Alternative median-finding algorithms exist but are unnecessary here.Interview InsightInterviewers ask this problem to test:Greedy thinkingMedian propertyMathematical observationArray flatteningOptimization logicConclusionLeetCode 2033 is a great problem that combines math with greedy logic.The most important learning points are:Flatten the gridValidate modulo conditionUse median as targetCalculate operations using difference divided by xThis approach is optimal and easy to implement.Once you understand why median works, this problem becomes very straightforward.

ArraySortingMathMedianMediumMatrixGridLeetCodeJava
Inorder Successor in BST – Java Optimized BST Solution with Dry Run

Inorder Successor in BST – Java Optimized BST Solution with Dry Run

IntroductionThe Inorder Successor in BST problem is one of the most important Binary Search Tree interview questions asked in coding interviews and online coding platforms like GeeksforGeeks.This problem tests your understanding of:Binary Search Tree propertiesInorder traversalRecursive searchingTree optimization techniquesSuccessor logic in BSTUnderstanding this problem properly helps in solving many advanced BST questions efficiently.Problem Link🔗 GeeksforGeeks – Inorder Successor in BSTProblem StatementGiven:A Binary Search TreeA reference node kFind the:Inorder Successorof that node.What is Inorder Successor?The inorder successor of a node is:The next greater node in the inorder traversal of the BST.Example 1Inputroot = [2,1,3]k = 2Inorder Traversal1 2 3Output3Example 2Inputroot = [20,8,22,4,12,null,null,null,null,10,14]k = 8Inorder Traversal4 8 10 12 14 20 22Output10Key BST ObservationIn a BST:Left subtree -> smaller valuesRight subtree -> greater valuesThe inorder traversal of BST is always:Sorted orderThis property helps us optimize the search.IntuitionSuppose:k = 8and current node is:20Since:20 > 8this node can potentially be the inorder successor.But there may exist a smaller valid successor in the left subtree.So:Store current node as possible answerMove leftBrute Force ApproachIdeaPerform inorder traversalStore traversal in listFind node kReturn next elementBrute Force Java Solutionclass Solution { List<Integer> inorder = new ArrayList<>(); void traverse(Node root) { if(root == null) return; traverse(root.left); inorder.add(root.data); traverse(root.right); } public int inOrderSuccessor(Node root, Node k) { traverse(root); for(int i = 0; i < inorder.size() - 1; i++) { if(inorder.get(i) == k.data) { return inorder.get(i + 1); } } return -1; }}Brute Force ComplexityTime ComplexityO(N)Space ComplexityO(N)because of traversal list.Optimized BST ApproachInstead of traversing the entire tree:Use BST propertiesReduce unnecessary traversalSearch efficientlyOptimized Java Solutionclass Solution { int c = -1; int solve(Node root, Node x, int c) { if(root == null) return c; if(root.data > x.data) { c = root.data; return solve(root.left, x, c); } else { return solve(root.right, x, c); } } public int inOrderSuccessor(Node root, Node k) { return solve(root, k, c); }}How This Solution WorksWhenever:root.data > k.datathe current node becomes a possible successor candidate.But there may exist a smaller valid successor in the left subtree.So:Store current nodeMove leftWhy Move Right Otherwise?If:root.data <= k.datathen current node cannot be successor.Move right to search for larger values.Dry RunInput 20 / \ 8 22 / \ 4 12 / \ 10 14k = 8Step 1Current node:20Since:20 > 8possible successor:20Move left.Step 2Current node:8Since:8 <= 8Move right.Step 3Current node:12Since:12 > 8update successor:12Move left.Step 4Current node:10Since:10 > 8update successor:10Move left.Step 5Node becomes null.Return:10Final Answer10Alternative Inorder Traversal ApproachAnother common approach:Perform inorder traversalTrack previous nodeWhen previous node becomes k, current node is successorAlternative Recursive Solutionclass Solution { Node prev = null; Node succ = null; void solve(Node root, Node k) { if(root == null || succ != null) return; solve(root.left, k); if(prev != null && prev.data == k.data) { succ = root; } prev = root; solve(root.right, k); } public int inOrderSuccessor(Node root, Node k) { solve(root, k); return succ != null ? succ.data : -1; }}Time Complexity AnalysisOptimized BST SolutionBest CaseO(log N)Balanced BST.Worst CaseO(N)Skewed BST.Space ComplexityRecursive StackO(H)where:H = height of treeInterview ExplanationIn interviews explain:Whenever we encounter a node greater than k, it becomes a possible inorder successor candidate. Then we move left to search for a smaller valid successor.This demonstrates:BST optimization understandingRecursive traversal logicEfficient searching skillsCommon Mistakes1. Traversing Entire Tree UnnecessarilyBST property already reduces search space.2. Returning First Greater NodeNeed the:smallest greater nodenot any greater node.3. Forgetting Candidate UpdateAlways update candidate before moving left.4. Confusing Floor/Ceil LogicSuccessor logic is different from:FloorCeilPredecessorFAQsQ1. What is inorder successor?The next greater node in inorder traversal.Q2. Why BST helps optimization?BST ordering allows skipping unnecessary branches.Q3. Can inorder successor be absent?Yes.If node is largest element, answer is:-1Q4. Can this be solved iteratively?Yes.Iterative solution is also common in interviews.Related BST ProblemsPractice these next:Search in BSTCeil in BSTFloor in BSTValidate BSTLowest Common Ancestor in BSTKth Smallest Element in BSTConclusionInorder Successor in BST is a very important interview problem because it teaches:BST optimizationRecursive searchingSuccessor logicTree traversal efficiencyThe key idea is:Whenever a node is greater than k, it becomes a possible successor candidate, but a smaller valid successor may still exist in the left subtree.Mastering this logic makes advanced BST problems significantly easier.

BSTGFGTreeBinary Search TreeJavaTree TraversalRecursionEasy
LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

LeetCode 784 Letter Case Permutation | Recursion & Backtracking Java Solution

IntroductionThe Letter Case Permutation problem is a classic example of recursion and backtracking, often asked in coding interviews and frequently searched by learners preparing for platforms like LeetCode.This problem helps in understanding:Decision-making at each stepRecursive branchingString manipulationIn this article, we’ll break down the intuition, visualize the decision process using your decision tree, and implement an efficient Java solution.🔗 Problem LinkLeetCode: Letter Case PermutationProblem StatementGiven a string s, you can transform each alphabet character into:LowercaseUppercaseDigits remain unchanged.👉 Return all possible strings formed by these transformations.ExamplesExample 1Input:s = "a1b2"Output:["a1b2","a1B2","A1b2","A1B2"]Example 2Input:s = "3z4"Output:["3z4","3Z4"]Key InsightAt each character:If it's a digit → only one choiceIf it's a letter → two choices:lowercase OR uppercaseSo total combinations:2^(number of letters)Intuition (Using Your Decision Tree)For input: "a1b2"Start from index 0: "" / \ "a" "A" | | "a1" "A1" / \ / \ "a1b" "a1B" "A1b" "A1B" | | | | "a1b2" "a1B2" "A1b2" "A1B2"Understanding the TreeAt 'a' → branch into 'a' and 'A''1' → no branching (digit)'b' → again branching'2' → no branching📌 Leaf nodes = final answersApproach: Recursion + BacktrackingIdeaTraverse the string character by characterIf digit → move forwardIf letter → branch into:lowercaseuppercaseJava Codeimport java.util.*;class Solution { // List to store all results List<String> lis = new ArrayList<>(); public void solve(String s, int ind, String ans) { // Base case: reached end of string if (ind == s.length()) { lis.add(ans); // store generated string return; } char ch = s.charAt(ind); // If character is a digit → only one option if (ch >= '0' && ch <= '9') { solve(s, ind + 1, ans + ch); } else { // Choice 1: convert to lowercase solve(s, ind + 1, ans + Character.toLowerCase(ch)); // Choice 2: convert to uppercase solve(s, ind + 1, ans + Character.toUpperCase(ch)); } } public List<String> letterCasePermutation(String s) { solve(s, 0, ""); // start recursion return lis; }}Step-by-Step ExecutionFor "a1b2":Start → ""'a' → "a", "A"'1' → "a1", "A1"'b' → "a1b", "a1B", "A1b", "A1B"'2' → final stringsComplexity AnalysisTime Complexity: O(2^n)(n = number of letters)Space Complexity: O(2^n)(for storing results)Why This Approach WorksRecursion explores all possibilitiesEach letter creates a branching pointDigits pass through unchangedBacktracking ensures all combinations are generatedKey TakeawaysThis is a binary decision recursion problemLetters → 2 choicesDigits → 1 choiceDecision tree directly maps to recursionPattern similar to:SubsetsPermutations with conditionsWhen This Problem Is AskedCommon in:Coding interviewsRecursion/backtracking roundsString manipulation problemsConclusionThe Letter Case Permutation problem is a perfect example of how recursion can be used to explore all possible combinations efficiently.Once the decision tree is clear, the implementation becomes straightforward. This pattern is widely used in many advanced problems, making it essential to master.Frequently Asked Questions (FAQs)1. Why don’t digits create branches?Because they have only one valid form.2. What is the main concept used?Recursion with decision-making (backtracking).3. Can this be solved iteratively?Yes, using BFS or iterative expansion, but recursion is more intuitive.

LeetCodeMediumJavaRecursion
LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

LeetCode 145: Binary Tree Postorder Traversal – Java Recursive & Iterative Solution Explained

IntroductionLeetCode 145 – Binary Tree Postorder Traversal is one of the most important tree traversal problems for beginners learning Data Structures and Algorithms.This problem teaches:Binary Tree TraversalDepth First Search (DFS)RecursionStack-based traversalTree traversal patternsPostorder traversal is extremely useful in advanced tree problems such as:Tree deletionExpression tree evaluationBottom-up computationsDynamic programming on treesProblem Link🔗 https://leetcode.com/problems/binary-tree-postorder-traversal/Problem StatementGiven the root of a binary tree, return the postorder traversal of its nodes' values.What is Postorder Traversal?In postorder traversal, nodes are visited in this order:Left → Right → RootUnlike preorder or inorder traversal, the root node is processed at the end.ExampleInputroot = [1,null,2,3]Tree Structure:1\2/3Postorder TraversalTraversal order:3 → 2 → 1Output:[3,2,1]Recursive Approach (Most Common)IntuitionIn postorder traversal:Traverse left subtreeTraverse right subtreeVisit current nodeThis naturally fits recursion because trees themselves are recursive structures.Recursive DFS VisualizationTraversal pattern:Left → Right → RootRecursive function:postorder(node.left)postorder(node.right)visit(node)Java Recursive Solution/*** Definition for a binary tree node.* public class TreeNode {* int val;* TreeNode left;* TreeNode right;* }*/class Solution {public void solve(List<Integer> list, TreeNode root) {if(root == null) return;solve(list, root.left);solve(list, root.right);list.add(root.val);}public List<Integer> postorderTraversal(TreeNode root) {List<Integer> list = new ArrayList<>();solve(list, root);return list;}}Dry Run – Recursive ApproachTree:1\2/3Step 1Start at:1Move left:nullReturn back.Step 2Move right to:2Move left to:3Left and right of 3 are null.Add:3Step 3Return to:2Add:2Step 4Return to:1Add:1Final Answer[3,2,1]Time Complexity – RecursiveTime ComplexityO(N)Every node is visited once.Space ComplexityO(H)Where:H = height of the treeRecursive call stack uses extra spaceWorst case:O(N)for skewed trees.Iterative Approach (Interview Follow-Up)The follow-up asks:Can you solve it iteratively?Yes.We use stacks to simulate recursion.Iterative Postorder IntuitionPostorder traversal order is:Left → Right → RootOne common trick is:Traverse in modified preorder:Root → Right → LeftReverse the result.After reversing, we get:Left → Right → Rootwhich is postorder traversal.Stack-Based Iterative LogicAlgorithmPush root into stack.Pop node.Add node value to answer.Push left child.Push right child.Reverse final answer.Java Iterative Solutionclass Solution {public List<Integer> postorderTraversal(TreeNode root) {LinkedList<Integer> ans = new LinkedList<>();if(root == null) return ans;Stack<TreeNode> stack = new Stack<>();stack.push(root);while(!stack.isEmpty()) {TreeNode node = stack.pop();ans.addFirst(node.val);if(node.left != null) {stack.push(node.left);}if(node.right != null) {stack.push(node.right);}}return ans;}}Dry Run – Iterative ApproachTree:1\2/3Step 1Push:1Step 2Pop:1Add at front:[1]Push right child:2Step 3Pop:2Add at front:[2,1]Push left child:3Step 4Pop:3Add at front:[3,2,1]Final Answer[3,2,1]Comparison of ApproachesApproachAdvantagesDisadvantagesRecursiveEasy to understandUses recursion stackIterativeBetter interview practiceSlightly harder logicInterview ExplanationIn interviews, explain:Postorder traversal processes nodes in Left → Right → Root order. Recursion naturally handles this traversal. Iteratively, we simulate recursion using a stack and reverse traversal order.This demonstrates strong tree traversal understanding.Common Mistakes1. Wrong Traversal OrderIncorrect:Root → Left → RightThat is preorder traversal.Correct postorder:Left → Right → Root2. Forgetting Null Base CaseAlways check:if(root == null) return;3. Incorrect Stack Push OrderFor iterative solution:Push left firstPush right secondbecause we reverse the result later.FAQsQ1. Why is postorder traversal useful?It is used in:Tree deletionExpression tree evaluationBottom-up dynamic programmingCalculating subtree informationQ2. Which approach is preferred in interviews?Recursive is simpler.Iterative is often asked as a follow-up.Q3. Can postorder traversal be done without stack or recursion?Yes.Using Morris Traversal.Q4. What is the difference between preorder, inorder, and postorder?TraversalOrderPreorderRoot → Left → RightInorderLeft → Root → RightPostorderLeft → Right → RootBonus: Morris Postorder TraversalMorris traversal performs tree traversal using:O(1)extra space.This is considered an advanced interview topic.ConclusionLeetCode 145 is an excellent beginner-friendly tree traversal problem.It teaches:DFS traversalRecursionStack simulationBinary tree fundamentalsThe key postorder pattern is:Left → Right → RootMastering this traversal helps in solving many advanced tree problems such as:Tree DPTree deletionExpression evaluationSubtree calculationsAdvanced DFS problems

LeetCodeBinary Tree Postorder TraversalBinary TreeTree TraversalJavaDFSStackRecursionEasy
Ai Assistant Kas