Search Blogs

Showing results for "Sliding Window"

Found 14 results

Maximum Average Subarray I β€” Efficient Solution Using Sliding Window (LeetCode 643)

Maximum Average Subarray I β€” Efficient Solution Using Sliding Window (LeetCode 643)

IntroductionLeetCode Problem 643: Maximum Average Subarray I is a classic problem that tests understanding of arrays and the sliding window technique.The task is simple in description but requires optimization to work efficiently for large inputs.We are given:An integer array numsAn integer kWe must find a contiguous subarray of length k that has the maximum average value, and return that average.If you want to try solving the problem yourself before reading further, you can attempt it here:πŸ‘‰ Try the problem on LeetCode: https://leetcode.com/problems/maximum-average-subarray-i/Problem UnderstandingA brute-force solution would compute the sum for every subarray of length k and track the maximum average. However, recalculating sums repeatedly results in O(n Γ— k) time complexity, which becomes inefficient for large arrays.Instead, we can use the sliding window technique to optimize the process.Key Idea: Sliding WindowInstead of recomputing sums:Compute the sum of the first window of size k.Slide the window forward by:Adding the next elementRemoving the element leaving the windowUpdate the maximum average at each step.This reduces time complexity to O(n).ApproachMaintain two pointers representing the window.Keep adding elements until window size becomes k.Compute average and update maximum.Slide the window by removing the left element.Continue until the end of the array.Implementation (Java)class Solution { public double findMaxAverage(int[] nums, int k) { double ans = Integer.MIN_VALUE; int i = 0; int j = 0; int sum = 0; while (j < nums.length) { sum += nums[j]; if (j - i + 1 < k) { j++; } else { ans = Math.max(ans, (double) sum / k); sum -= nums[i]; i++; j++; } } return ans; }}Dry Run ExampleInput:nums = [1,12,-5,-6,50,3], k = 4Windows examined:[1,12,-5,-6] β†’ avg = 0.5[12,-5,-6,50] β†’ avg = 12.75 (maximum)[-5,-6,50,3] β†’ avg = 10.5Maximum average = 12.75Complexity AnalysisTime Complexity: O(n) Each element enters and leaves the window once.Space Complexity: O(1) No extra space is used apart from variables.Edge Cases ConsideredSingle element array (k = 1)All negative numbersLarge input sizeLarge positive or negative valuesWhy Sliding Window MattersSliding window is a crucial technique used in many interview problems:Subarray sum problemsLongest substring problemsFixed or variable window size optimizationsMastering this pattern greatly improves coding interview performance.ConclusionThis problem demonstrates how recognizing patterns like sliding window can transform a slow brute-force solution into an efficient one.If you are preparing for coding interviews, mastering sliding window problems is essential since they appear frequently.

LeetCodeSliding WindowEasy
Count Subarrays of Size K with Average β‰₯ Threshold β€” Sliding Window Solution (LeetCode 1343)

Count Subarrays of Size K with Average β‰₯ Threshold β€” Sliding Window Solution (LeetCode 1343)

IntroductionLeetCode 1343: Number of Sub-arrays of Size K and Average Greater than or Equal to Threshold is another excellent problem to practice the sliding window technique.The goal is not just to compute values but to count how many subarrays satisfy a given condition efficiently.You are given:An integer array arrAn integer k representing subarray sizeA threshold valueYou must return the number of subarrays of size k whose average is greater than or equal to the threshold.If you'd like to try solving the problem first, you can attempt it here:πŸ‘‰ Try the problem on LeetCode:https://leetcode.com/problems/number-of-sub-arrays-of-size-k-and-average-greater-than-or-equal-to-threshold/Problem UnderstandingA direct approach would calculate the average for every subarray of size k. However, recomputing sums repeatedly leads to unnecessary work.To optimize, we use a sliding window, allowing us to reuse previous computations and move efficiently across the array.Key Idea: Sliding Window OptimizationInstead of calculating sums repeatedly:Maintain the sum of the current window.Slide the window by:Adding the next elementRemoving the element leaving the windowCheck if the average satisfies the threshold.Count valid windows.This ensures each element is processed only once.ApproachMaintain two pointers to represent the window.Add elements until window size reaches k.Check if average meets the threshold.Move the window forward.Count valid subarrays.An important optimization: instead of computing average each time, we can compare the sum with threshold * k. However, your current implementation using division also works correctly.Implementation (Java)class Solution { public int numOfSubarrays(int[] arr, int k, int t) { int curr = 0; int i = 0; int j = 0; int co = 0; while (j < arr.length) { curr += arr[j]; if (j - i + 1 < k) { j++; } else { if (j - i + 1 == k) { if (curr / k >= t) { co++; } curr -= arr[i]; i++; j++; } } } return co; }}Dry Run ExampleInput:arr = [2,2,2,2,5,5,5,8], k = 3, threshold = 4Valid subarrays:[2,5,5] β†’ avg = 4[5,5,5] β†’ avg = 5[5,5,8] β†’ avg = 6Total valid subarrays = 3Complexity AnalysisTime Complexity: O(n)Each element enters and leaves the window once.Space Complexity: O(1)Only constant extra variables are used.Edge Cases ConsideredThreshold equals zeroMinimum array lengthLarge array sizesNon-integer averagesAll elements smaller than thresholdSliding Window Pattern ImportanceThis problem reinforces the sliding window pattern, which appears frequently in:Fixed-size window problemsMaximum or minimum subarray problemsCounting valid segmentsString window problemsMastering this pattern helps solve many interview questions efficiently.ConclusionThis problem is a strong example of turning a potentially expensive brute-force approach into an efficient linear solution using sliding window.Once you recognize this pattern, many array and string problems become significantly easier to solve.

LeetCodeSliding WindowMedium
Longest Subarray of 1's After Deleting One Element – Sliding Window Approach

Longest Subarray of 1's After Deleting One Element – Sliding Window Approach

IntroductionLeetCode 1493: Longest Subarray of 1's After Deleting One Element is a neat sliding window problem that tests your ability to dynamically adjust a window while handling a constraint: deleting exactly one element.The task is to find the longest subarray of 1's you can get after deleting one element from the array.This problem is an excellent example of how sliding window with zero counting can convert a potentially brute-force solution into an O(n) linear solution.If you’d like to try solving the problem first, you can attempt it here:Try the problem on LeetCode:https://leetcode.com/problems/longest-subarray-of-1s-after-deleting-one-element/Problem UnderstandingYou are given:A binary array nums containing only 0’s and 1’sYou must delete exactly one elementYour task: Return the length of the longest non-empty subarray of 1’s after deleting one element.Examples:Input: nums = [1,1,0,1]Output: 3Explanation: Delete element at index 2 β†’ [1,1,1]. Longest subarray of 1's = 3.Input: nums = [0,1,1,1,0,1,1,0,1]Output: 5Explanation: Delete element at index 4 β†’ [0,1,1,1,1,1,0,1]. Longest subarray of 1's = 5.Input: nums = [1,1,1]Output: 2Explanation: Must delete one element β†’ longest subarray = 2.A naive approach would try removing each element and scanning for the longest subarray β†’Time Complexity: O(nΒ²) β†’ too slow for nums.length up to 10⁡Inefficient for large arraysKey Idea: Sliding Window with At Most One ZeroNotice the following:Deleting one element is equivalent to allowing at most one zero in the subarrayWe can use a sliding window [i, j] and a counter z for zeros in the windowExpand j while z <= 1If z > 1, shrink the window from the left until z <= 1The length of the window (j - i) gives the maximum length of consecutive 1’s after deleting one elementIntuition:Only one zero is allowed in the window because deleting that zero would turn the window into all 1'sThis converts the problem into a linear sliding window problem with zero countingApproach (Step-by-Step)Initialize i = 0, j = 0 for window pointersInitialize z = 0 β†’ number of zeros in current windowInitialize co = 0 β†’ maximum length of valid subarrayIterate j over nums:If nums[j] == 0, increment zCheck z:If z <= 1: window is valid β†’ update co = max(co, j - i)If z > 1: shrink window from i until z <= 1Continue expanding the windowReturn co as the maximum length after deleting one elementOptimization:Only need one zero counter and window pointersAvoid recomputing subarray lengths repeatedlyImplementation (Java)class Solution {public int longestSubarray(int[] nums) {int i = 0, j = 0; // window pointersint co = 0; // max lengthint z = 0; // count of zeros in windowwhile (j < nums.length) {if (nums[j] == 0) {z++; // increment zero count}if (z <= 1) {co = Math.max(co, j - i); // valid windowj++;} else {// shrink window until at most one zerowhile (z > 1) {if (nums[i] == 0) {z--;}i++;}co = Math.max(co, j - i);j++;}}return co;}}Dry Run ExampleInput:nums = [1,1,0,1]Execution:Window [i, j]Zeros zValid?Max length co[0,0] β†’ [1]0Yes0[0,1] β†’ [1,1]0Yes1[0,2] β†’ [1,1,0]1Yes2[0,3] β†’ [1,1,0,1]1Yes3Output:3Complexity AnalysisTime Complexity: O(n) β†’ Each element is visited at most twice (i and j)Space Complexity: O(1) β†’ Only counters and pointers usedEdge Cases ConsideredArray of all 1’s β†’ must delete one β†’ max length = n - 1Array of all 0’s β†’ return 0Single element arrays β†’ return 0 (because deletion required)Zeros at the start/end of array β†’ handled by sliding windowSliding Window Pattern ImportanceThis problem is a great example of sliding window with limited violations:Maintain a window satisfying a constraint (at most one zero)Expand/shrink dynamicallyCompute max length without scanning all subarraysIt’s directly related to problems like:Max consecutive ones with k flipsLongest substring with at most k distinct charactersSubarray problems with limited replacementsConclusionBy tracking zeros with a sliding window, we efficiently find the longest subarray of 1’s after deleting one element in O(n) time.This pattern is reusable in many binary array and string problems, making it a must-know technique for coding interviews.

SlidingWindowBinaryArrayLeetCodeMedium
Longest Repeating Character Replacement – Sliding Window Explained (LeetCode 424)

Longest Repeating Character Replacement – Sliding Window Explained (LeetCode 424)

πŸ”— Problem LinkLeetCode 424 – Longest Repeating Character ReplacementπŸ‘‰ https://leetcode.com/problems/longest-repeating-character-replacement/IntroductionWhen I first looked at this problem, it didn’t immediately feel like a typical sliding window question. It talks about replacing characters, not finding substrings directly.But the moment you carefully read:"Return the length of the longest substring containing the same letter after at most k replacements."That’s when the pattern becomes clear.This is a variable-size sliding window problem where we try to maintain a valid window under a certain condition.In this blog, I’ll explain:The intuition behind the problemWhy sliding window worksThe key tricky conditionStep-by-step explanation of the codeTime and space complexityπŸ“Œ Problem UnderstandingWe are allowed to:Pick any character in the stringReplace it with any uppercase letterPerform at most k replacementsWe need to find the maximum length substring that can become all the same character after at most k changes.🧠 Key ObservationIn any window (substring):To make all characters the same, we need to:Keep the most frequent characterReplace all other charactersSo the number of replacements required is:Window Size - Maximum Frequency Character in that WindowIf that value is ≀ k, then the window is valid.This is the most important insight in the entire problem.πŸš€ Why Sliding Window?We are asked for:Longest substringUnder a constraintWith dynamic window expansionThat is a clear sign of the sliding window pattern.We use:i β†’ left pointerj β†’ right pointerHashMap β†’ to track character frequenciesπŸ’» Your Codeclass Solution {public int characterReplacement(String s, int k) {HashMap<Character,Integer> mp = new HashMap<>();int i= 0;int j =0;int co =0;while(j < s.length()){mp.put(s.charAt(j),mp.getOrDefault(s.charAt(j),0)+1);int maxfreq = 0;for(int a : mp.values()){maxfreq = Math.max(maxfreq,a);}while((j - i +1)-maxfreq > k){ // Tricky partmp.put(s.charAt(i),mp.get(s.charAt(i))-1);if(mp.get(s.charAt(i)) == 0){mp.remove(s.charAt(i));}i++;}co = Math.max(co,j-i+1);j++;}return co;}}πŸ” Step-by-Step Explanation1️⃣ Expanding the Windowmp.put(s.charAt(j), mp.getOrDefault(s.charAt(j), 0) + 1);We add the current character into the frequency map.2️⃣ Finding Maximum Frequencyint maxfreq = 0;for(int a : mp.values()){maxfreq = Math.max(maxfreq,a);}We calculate the highest frequency character inside the window.Why?Because that is the character we will keep.All others will be replaced.3️⃣ The Most Important Condition (Tricky Part)while((j - i +1)-maxfreq > k)Let’s break this:j - i + 1 β†’ Window sizemaxfreq β†’ Count of most frequent characterwindowSize - maxfreq β†’ Replacements neededIf replacements needed > k β†’ window is invalidSo we shrink from left.4️⃣ Shrinking the Windowmp.put(s.charAt(i), mp.get(s.charAt(i)) - 1);if(mp.get(s.charAt(i)) == 0){mp.remove(s.charAt(i));}i++;We remove left character and move i forward.5️⃣ Updating Maximum Lengthco = Math.max(co, j - i + 1);We update our answer whenever the window is valid.🎯 Why This WorksWe always maintain:(window size - most frequent character count) <= kThat guarantees:We can convert the entire window into one repeating character using at most k replacements.⏱ Time and Space ComplexityTime Complexity: O(26 * n) β‰ˆ O(n)For each character, we scan at most 26 letters.Since there are only uppercase letters, this is effectively linear.Space Complexity: O(26)At most 26 uppercase characters stored.πŸ”₯ Important Optimization InsightYour solution recalculates maxfreq every time using a loop.A common optimization is:Maintain a global maxfreqUpdate only when expanding windowDo not recalculate during shrinkingThat reduces unnecessary scanning.But your solution is completely correct and efficient.🏁 Final ThoughtsThis problem teaches:Sliding Window with conditionFrequency trackingWindow validation logicThinking in terms of "how many changes needed"The key formula to remember:window size - max frequency <= kIf you truly understand this condition, you unlock many similar problems like:Longest Substring with K ReplacementsMax Consecutive Ones IIIFruit Into Baskets

Sliding WindowLeetCodeTwo PointersHashMapMedium
Fruit Into Baskets – Sliding Window with Two Types

Fruit Into Baskets – Sliding Window with Two Types

IntroductionLeetCode 904: Fruit Into Baskets is a classic sliding window problem that tests your ability to track a limited number of distinct elements in a subarray.The problem can be rephrased as:Find the longest subarray containing at most 2 distinct types of elements.This is a great example of using HashMap + sliding window to efficiently track counts of elements while expanding and shrinking the window.If you’d like to try solving the problem first, you can attempt it here:Try the problem on LeetCode:https://leetcode.com/problems/fruit-into-baskets/Problem UnderstandingYou are given:An array fruits where fruits[i] represents the type of fruit from tree iTwo baskets, each can hold only one type of fruitRules:Start at any tree and move only to the rightPick exactly one fruit from each tree while movingStop when a tree’s fruit cannot fit in your basketsGoal: Return the maximum number of fruits you can pick.Examples:Input: fruits = [1,2,1]Output: 3Explanation: Pick all fruits [1,2,1].Input: fruits = [0,1,2,2]Output: 3Explanation: Best subarray [1,2,2].Input: fruits = [1,2,3,2,2]Output: 4Explanation: Best subarray [2,3,2,2].A naive approach would check all subarrays, count distinct fruits, and pick the max β†’Time Complexity: O(nΒ²) β†’ too slow for fruits.length up to 10⁡Key Idea: Sliding Window with At Most Two TypesInstead of brute-force:Track the number of each fruit type in the current window using a HashMapUse two pointers i and j for the windowExpand j by adding fruits[j] to the mapIf the number of distinct types mp.size() exceeds 2:Shrink the window from the left (i) until mp.size() <= 2The window length j - i + 1 gives the max fruits collected so farIntuition:Only two baskets β†’ window can contain at most 2 distinct fruitsThe sliding window efficiently finds the longest subarray with ≀ 2 distinct elementsApproach (Step-by-Step)Initialize i = 0, j = 0 for window pointersInitialize HashMap mp to store fruit countsInitialize co = 0 β†’ maximum fruits collectedIterate j over fruits:Add fruits[j] to the mapCheck mp.size():If ≀ 2 β†’ update co = max(co, j - i + 1)If > 2 β†’ shrink window from i until mp.size() <= 2Continue expanding the windowReturn co as the maximum fruits collectedOptimization:HashMap keeps track of counts β†’ no need to scan subarray repeatedlySliding window ensures linear traversalImplementation (Java)class Solution {public int totalFruit(int[] nums) {HashMap<Integer,Integer> mp = new HashMap<>();int i = 0, j = 0; // window pointersint co = 0; // max fruits collectedwhile (j < nums.length) {// Add current fruit to mapmp.put(nums[j], mp.getOrDefault(nums[j], 0) + 1);if (mp.size() <= 2) {co = Math.max(co, j - i + 1); // valid windowj++;} else {// Shrink window until at most 2 types of fruitswhile (mp.size() > 2) {mp.put(nums[i], mp.get(nums[i]) - 1);if (mp.get(nums[i]) == 0) {mp.remove(nums[i]);}i++;}co = Math.max(co, j - i + 1);j++;}}return co;}}Dry Run ExampleInput:fruits = [1,2,3,2,2]Execution:Window [i, j]Fruit counts mpDistinct TypesValid?Max co[0,0] β†’ [1]{1:1}1Yes1[0,1] β†’ [1,2]{1:1,2:1}2Yes2[0,2] β†’ [1,2,3]{1:1,2:1,3:1}3No β†’ shrink2[1,2] β†’ [2,3]{2:1,3:1}2Yes2[1,3] β†’ [2,3,2]{2:2,3:1}2Yes3[1,4] β†’ [2,3,2,2]{2:3,3:1}2Yes4Output:4Complexity AnalysisTime Complexity: O(n) β†’ Each element is added and removed at most onceSpace Complexity: O(1) β†’ HashMap stores at most 2 types of fruitsEdge Cases ConsideredArray with ≀ 2 types β†’ entire array can be pickedArray with all same type β†’ window length = array lengthZeros or non-continuous fruit types β†’ handled by sliding windowLarge arrays up to 10⁡ elements β†’ O(n) solution works efficientlySliding Window Pattern ImportanceThis problem demonstrates the sliding window + frequency map pattern:Track limited number of distinct elementsExpand/shrink window dynamicallyEfficiently compute max subarray length with constraintsIt’s directly related to problems like:Max consecutive ones with flipsLongest substring with k distinct charactersFruit collection / subarray problems with type limitsConclusionBy tracking fruit counts with a HashMap in a sliding window, we efficiently find the maximum fruits collectible in O(n) time.Mastering this pattern allows solving many array and string problems with constraints on distinct elements in a linear and elegant way.

SlidingWindowHashMapLeetCodeMedium
Max Consecutive Ones III – Sliding Window with Limited Flips

Max Consecutive Ones III – Sliding Window with Limited Flips

IntroductionLeetCode 1004: Max Consecutive Ones III is a classic sliding window problem that challenges your understanding of arrays, window manipulation, and frequency counting.The goal is to find the longest subarray of consecutive 1's in a binary array if you are allowed to flip at most K zeros to 1’s.This problem is an excellent example of transforming a brute-force solution into a linear-time efficient approach using the sliding window pattern.If you’d like to try solving the problem first, you can attempt it here: Try the problem on LeetCode: https://leetcode.com/problems/max-consecutive-ones-iii/Problem UnderstandingYou are given:A binary array nums containing only 0's and 1'sAn integer k representing the maximum number of zeros you can flipYou need to return the length of the longest contiguous subarray of 1's after flipping at most k zeros.Examples:Input: nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Output: 6Explanation: Flip two zeros to get [1,1,1,0,0,1,1,1,1,1,1].Longest consecutive ones = 6.Input: nums = [0,0,1,1,0,0,1,1,1,0,1,1,0,0,0,1,1,1,1], k = 3Output: 10Explanation: Flip three zeros to get longest consecutive ones of length 10.A naive approach would check every possible subarray, flip zeros, and count consecutive ones:Time Complexity: O(nΒ²) β†’ too slow for large arraysInefficient for constraints up to 10⁡ elementsKey Idea: Sliding Window with Zero CountInstead of brute-force, notice that:We only care about how many zeros are in the current windowWe can maintain a sliding window [i, j]Keep a counter z for zeros in the windowExpand the window by moving jIf z exceeds k, shrink the window from the left by moving i and decrementing z for each zero removedIntuition:The window always contains at most k zerosThe length of the window gives the maximum consecutive ones achievable with flipsThis allows linear traversal of the array with O(1) space, making it optimal.Approach (Step-by-Step)Initialize pointers: i = 0, j = 0Initialize z = 0 (zeros count in current window) and co = 0 (max length)Iterate j from 0 to nums.length - 1:If nums[j] == 0, increment zCheck z:If z <= k: window is valid β†’ update co = max(co, j - i + 1)Else: shrink window by moving i until z <= k, decrement z for zeros leaving windowContinue expanding window with jReturn co as the maximum consecutive onesOptimization:Only need one variable for zeros countAvoids recomputing sums or scanning subarrays repeatedlyImplementation (Java)class Solution { public int longestOnes(int[] nums, int k) { int co = 0; // maximum length of valid window int i = 0, j = 0; // window pointers int z = 0; // count of zeros in current window while (j < nums.length) { if (nums[j] == 0) { z++; // increment zeros count } if (z <= k) { co = Math.max(co, j - i + 1); // valid window j++; } else { // shrink window until zeros <= k while (z > k) { if (nums[i] == 0) { z--; } i++; } co = Math.max(co, j - i + 1); j++; } } return co; }}Dry Run ExampleInput:nums = [1,1,1,0,0,0,1,1,1,1,0], k = 2Execution:Window [i, j]Zeros zValid?Max length co[0,0] β†’ [1]0Yes1[0,2] β†’ [1,1,1]0Yes3[0,3] β†’ [1,1,1,0]1Yes4[0,4] β†’ [1,1,1,0,0]2Yes5[0,5] β†’ [1,1,1,0,0,0]3No β†’ shrink i5[3,8] β†’ [0,0,1,1,1,1]2Yes6Output:6Complexity AnalysisTime Complexity: O(n) β†’ Each element is visited at most twice (once when j moves, once when i moves)Space Complexity: O(1) β†’ Only counters and pointers usedEdge Cases Consideredk = 0 β†’ cannot flip any zeros, just count consecutive onesArray with all 1’s β†’ return full lengthArray with all 0’s β†’ return min(k, length)Single element arrays β†’ works correctlySliding Window Pattern ImportanceThis problem is a perfect example of the sliding window pattern:Use a window to track a condition (max zeros allowed)Expand and shrink dynamically based on constraintsEfficiently computes maximum/minimum contiguous subarray lengthsIt also demonstrates counting with limited violations – a key interview concept.ConclusionBy tracking zeros with a sliding window, we convert a naive O(nΒ²) problem into O(n) linear time.Understanding this pattern allows you to solve:Max consecutive ones/zeros problemsLongest substring/subarray with constraintsSubarray problems with limited replacements or violationsOnce mastered, this approach applies to many binary array and string problems efficiently.

SlidingWindowBinaryArrayLeetCodeMedium
Length of Longest Subarray With At Most K Frequency – Sliding Window Approach

Length of Longest Subarray With At Most K Frequency – Sliding Window Approach

IntroductionLeetCode 2958: Length of Longest Subarray With at Most K Frequency is an excellent problem to understand how sliding window with frequency counting works in arrays with duplicates.The problem asks us to find the longest contiguous subarray such that no element occurs more than K times.If you’d like to try solving the problem first, you can attempt it here:Try the problem on LeetCode:https://leetcode.com/problems/length-of-longest-subarray-with-at-most-k-frequency/Problem UnderstandingYou are given:An integer array numsAn integer kA good subarray is defined as a subarray where the frequency of each element is ≀ k.Goal: Return the length of the longest good subarray.Examples:Input: nums = [1,2,3,1,2,3,1,2], k = 2Output: 6Explanation: Longest good subarray = [1,2,3,1,2,3]Input: nums = [1,2,1,2,1,2,1,2], k = 1Output: 2Explanation: Longest good subarray = [1,2]Input: nums = [5,5,5,5,5,5,5], k = 4Output: 4Explanation: Longest good subarray = [5,5,5,5]A naive approach would check all subarrays and count frequencies β†’Time Complexity: O(nΒ²) β†’ too slow for nums.length up to 10⁡Key Idea: Sliding Window with Frequency MapInstead of brute-force:Use a sliding window [i, j] to track the current subarrayUse a HashMap mp to store the frequency of each element in the windowExpand j by adding nums[j] to the mapIf mp.get(nums[j]) > k, shrink the window from the left (i) until mp.get(nums[j]) <= kAt each step, update the maximum length of the valid windowIntuition:We allow each element to appear at most K timesBy shrinking the window whenever a frequency exceeds k, we always maintain a valid subarraySliding window ensures linear traversalApproach (Step-by-Step)Initialize i = 0, j = 0 β†’ window pointersInitialize co = 0 β†’ maximum lengthInitialize HashMap mp to store frequencies of elements in the windowIterate j from 0 to nums.length - 1:Increment frequency of nums[j] in mpWhile mp.get(nums[j]) > k:Shrink window from the left by decrementing mp[nums[i]] and incrementing iUpdate co = max(co, j - i + 1)Return co as the length of the longest good subarrayImplementation (Java)class Solution {public int maxSubarrayLength(int[] nums, int k) {int i = 0, j = 0; // window pointersint co = 0; // max length of good subarrayHashMap<Integer, Integer> mp = new HashMap<>(); // frequency mapwhile (j < nums.length) {mp.put(nums[j], mp.getOrDefault(nums[j], 0) + 1);// Shrink window until all frequencies <= kwhile (mp.get(nums[j]) > k) {mp.put(nums[i], mp.get(nums[i]) - 1);i++;}co = Math.max(co, j - i + 1);j++;}return co;}}Dry Run ExampleInput:nums = [1,2,3,1,2,3,1,2], k = 2Execution:Window [i, j]Frequency Map mpValid?Max length co[0,0] β†’ [1]{1:1}Yes1[0,1] β†’ [1,2]{1:1,2:1}Yes2[0,2] β†’ [1,2,3]{1:1,2:1,3:1}Yes3[0,3] β†’ [1,2,3,1]{1:2,2:1,3:1}Yes4[0,4] β†’ [1,2,3,1,2]{1:2,2:2,3:1}Yes5[0,5] β†’ [1,2,3,1,2,3]{1:2,2:2,3:2}Yes6[0,6] β†’ [1,2,3,1,2,3,1]{1:3,2:2,3:2}No β†’ shrink6Output:6Complexity AnalysisTime Complexity: O(n) β†’ Each element enters and leaves the window at most onceSpace Complexity: O(n) β†’ HashMap stores frequencies of elements in the window (worst-case all distinct)Edge Cases ConsideredAll elements occur ≀ k β†’ entire array is validAll elements occur > k β†’ max subarray length = kSingle-element arrays β†’ return 1 if k β‰₯ 1Large arrays up to 10⁡ elements β†’ O(n) solution works efficientlySliding Window Pattern ImportanceThis problem demonstrates sliding window with frequency map, useful for:Subarrays with frequency constraintsLongest subarray with limited duplicatesSimilar to "max consecutive ones with flips" and "fruit into baskets"By mastering this approach, you can efficiently solve many array and subarray problems with constraints.ConclusionUsing HashMap + sliding window, we reduce a naive O(nΒ²) approach to O(n) while keeping the solution intuitive and easy to implement.Understanding this pattern allows solving complex frequency-constrained subarray problems efficiently in interviews.

SlidingWindowHashMapLeetCodeMedium
Longest Substring with K Unique Characters – Efficient Sliding Window Solution

Longest Substring with K Unique Characters – Efficient Sliding Window Solution

IntroductionFinding substrings with unique characters is a common problem in string manipulation and interview questions.GFG’s Longest Substring with K Unique Characters problem challenges you to find the length of the longest substring containing exactly K distinct characters.The focus is not just on brute-force solutions, but on using sliding window with a HashMap to efficiently track character frequencies and window boundaries.If you’d like to try solving the problem first, you can attempt it here: Try the problem on GeeksforGeeks: https://leetcode.com/problems/max-consecutive-ones-iii/Problem UnderstandingYou are given:A string s of lowercase lettersAn integer kYour task: Return the length of the longest substring containing exactly k distinct characters.Examples:Input: s = "aabacbebebe", k = 3Output: 7Explanation: "cbebebe" is the longest substring with 3 distinct characters.Input: s = "aaaa", k = 2Output: -1Explanation: No substring contains exactly 2 distinct characters.Input: s = "aabaaab", k = 2Output: 7Explanation: "aabaaab" has exactly 2 unique characters.A naive approach would try all possible substrings, count unique characters, and track the max length.Time Complexity: O(nΒ²)Inefficient for large stringsKey Idea: Sliding Window + HashMapInstead of recomputing the unique characters for every substring:Use a HashMap to store character frequencies in the current windowUse two pointers (i and j) to maintain the windowExpand the window by moving j and add characters to the mapShrink the window from the left when the number of unique characters exceeds kUpdate the max length whenever the window has exactly k unique charactersThis ensures each character is processed only once, giving a linear solution.Approach (Step-by-Step)Initialize a HashMap mp to store character countsUse two pointers i (window start) and j (window end)Iterate over the string with jAdd s[j] to the map and update its countCheck the map size:If size < k β†’ move j forwardIf size == k β†’ update max length, move j forwardIf size > k β†’ shrink window from i until map size <= kAfter iterating, return max (or -1 if no valid substring exists)Optimization:Using a HashMap avoids recalculating the number of unique characters for every substringSliding window ensures O(n) complexityImplementation (Java)class Solution {public int longestKSubstr(String s, int k) {HashMap<Character,Integer> mp = new HashMap<>();int i = 0, j = 0;int max = -1;while (j < s.length()) {// Add current character to mapmp.put(s.charAt(j), mp.getOrDefault(s.charAt(j), 0) + 1);if (mp.size() < k) {j++;}else if (mp.size() == k) {// Update max length when exactly k unique charactersmax = Math.max(max, j - i + 1);j++;}else {// Shrink window until map size <= kwhile (mp.size() > k) {mp.put(s.charAt(i), mp.get(s.charAt(i)) - 1);if (mp.get(s.charAt(i)) == 0) {mp.remove(s.charAt(i));}i++;}max = Math.max(max, j - i + 1);j++;}}return max;}}Dry Run ExampleInput:s = "aabacbebebe", k = 3Execution:Window [0-4] = "aaba" β†’ unique = 2 β†’ continueWindow [1-6] = "abacb" β†’ unique = 3 β†’ max = 5Window [4-10] = "cbebebe" β†’ unique = 3 β†’ max = 7Output:7Complexity AnalysisTime Complexity: O(n) β†’ Each character enters and leaves the window onceSpace Complexity: O(k) β†’ HashMap stores at most k unique charactersEdge Cases Consideredk greater than number of unique characters β†’ return -1Entire string has exactly k unique charactersString with repeated characters onlyMinimum string length (1)Sliding Window Pattern ImportanceThis problem reinforces a common sliding window + hashmap pattern used in:Longest substring problems with constraintsCounting substrings with exactly K conditionsOptimizing brute-force approaches to linear solutionsConclusionBy combining sliding window with HashMap frequency tracking, we reduce an O(nΒ²) problem to O(n).Once you master this approach, many string and substring problems with constraints on unique characters become much easier to solve efficiently.

SlidingWindowHashMapStringsGFG
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(nΒ²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
Queue Data Structure Complete Guide - Java Explained With All Operations

Queue Data Structure Complete Guide - Java Explained With All Operations

IntroductionIf you have been learning Data Structures and Algorithms, you have probably already spent time with arrays, linked lists, and stacks. Now it is time to meet one of the most important and widely used data structures in computer science β€” the Queue.Queue is not just a theoretical concept. It powers some of the most critical systems you use every day β€” from how your printer handles jobs, to how your CPU schedules tasks, to how Google Maps finds the shortest path between two locations. Understanding Queue deeply means understanding how real systems work.In this complete guide we will cover absolutely everything β€” what a Queue is, how it differs from a Stack, every type of Queue, all operations with code, Java implementations, time and space complexity, common interview questions, and the most important LeetCode problems that use Queue.What Is a Queue?A Queue is a linear data structure that follows the FIFO principle β€” First In First Out. This means the element that was added first is the one that gets removed first.Think of it exactly like a real-world queue (a line of people). The person who joined the line first gets served first. No cutting in line, no serving from the back β€” strict order from front to back.This is the fundamental difference between a Queue and a Stack:Stack β†’ LIFO (Last In First Out) β€” like a stack of plates, you take from the topQueue β†’ FIFO (First In First Out) β€” like a line of people, you serve from the frontReal Life Examples of QueueBefore writing a single line of code, let us understand where queues appear in real life. This will make every technical concept feel natural.Printer Queue β€” when you send multiple documents to print, they print in the order they were sent. The first document sent prints first.CPU Task Scheduling β€” your operating system manages running processes in a queue. Tasks get CPU time in the order they arrive (in basic scheduling).Customer Service Call Center β€” when you call a helpline and are put on hold, you are placed in a queue. The first caller on hold gets connected first.WhatsApp Messages β€” messages are delivered in the order they are sent. The first message sent is the first one received.BFS (Breadth First Search) β€” every time you use Google Maps or any navigation app to find the shortest path, it uses BFS internally which is entirely powered by a Queue.Ticket Booking Systems β€” online booking portals process requests in the order they arrive. First come first served.Queue Terminology β€” Key Terms You Must KnowBefore diving into code, let us get the vocabulary right:Front β€” the end from which elements are removed (dequeued). This is where the "first person in line" stands.Rear (or Back) β€” the end at which elements are added (enqueued). New arrivals join here.Enqueue β€” the operation of adding an element to the rear of the queue. Like joining the back of a line.Dequeue β€” the operation of removing an element from the front of the queue. Like the first person in line being served and leaving.Peek (or Front) β€” looking at the front element without removing it. Like seeing who is first in line without serving them yet.isEmpty β€” checking whether the queue has no elements.isFull β€” relevant for fixed-size queues, checking whether no more elements can be added.Types of QueuesThis is where most beginners get confused. There is not just one type of Queue β€” there are several variations each designed to solve specific problems.1. Simple Queue (Linear Queue)The most basic form. Elements enter from the rear and leave from the front. Strict FIFO, nothing fancy.Enqueue β†’ [ 1 | 2 | 3 | 4 | 5 ] β†’ Dequeue rear frontProblem with Simple Queue: In array-based implementation, once elements are dequeued from the front, those slots cannot be reused even if there is space. This wastes memory. This is why Circular Queue was invented.2. Circular QueueIn a Circular Queue, the rear wraps around to the front when it reaches the end of the array. The last position connects back to the first, forming a circle. This solves the wasted space problem of simple queues. [1] [2] [3] / \ [6] [4] \ / [5] ← rearUsed in: CPU scheduling, memory management, traffic light systems, streaming buffers.3. Double Ended Queue (Deque)A Deque (pronounced "deck") allows insertion and deletion from both ends β€” front and rear. It is the most flexible queue type.Enqueue Front β†’ [ 1 | 2 | 3 | 4 | 5 ] β†’ Dequeue FrontEnqueue Rear β†’ [ 1 | 2 | 3 | 4 | 5 ] β†’ Dequeue RearTwo subtypes:Input Restricted Deque β€” insertion only at rear, deletion from both endsOutput Restricted Deque β€” deletion only at front, insertion at both endsUsed in: browser history (back and forward), undo-redo operations, sliding window problems.4. Priority QueueElements are not served in FIFO order β€” instead each element has a priority and the element with the highest priority is served first regardless of when it was added.Think of an emergency room. A patient with a critical injury jumps ahead of someone with a minor cut even if they arrived later.Two types:Max Priority Queue β€” highest value = highest priorityMin Priority Queue β€” lowest value = highest priorityUsed in: Dijkstra's shortest path, Huffman encoding, A* search algorithm, task scheduling with priorities.5. Blocking QueueA thread-safe queue used in multi-threading. If the queue is empty, a thread trying to dequeue will wait (block) until an element is available. If the queue is full, a thread trying to enqueue will wait until space is available.Used in: Producer-Consumer problems, thread pool implementations, Java's java.util.concurrent package.Queue Operations and Time ComplexityEvery queue operation has a specific time complexity that you must know cold for interviews.OperationDescriptionTime ComplexityEnqueueAdd element to rearO(1)DequeueRemove element from frontO(1)Peek/FrontView front elementO(1)isEmptyCheck if queue is emptyO(1)SizeNumber of elementsO(1)SearchFind a specific elementO(n)Space Complexity: O(n) β€” where n is the number of elements stored.All core queue operations are O(1). This is what makes Queue so powerful β€” no matter how many elements are in the queue, adding and removing always takes constant time.Implementing Queue in Java β€” All WaysJava gives you multiple ways to use a Queue. Let us go through each one.Way 1: Using LinkedList (Most Common)LinkedList implements the Queue interface in Java. This is the most commonly used Queue implementation.import java.util.LinkedList;import java.util.Queue;Queue<Integer> queue = new LinkedList<>();// Enqueue β€” add to rearqueue.offer(10);queue.offer(20);queue.offer(30);// Peek β€” view front without removingSystem.out.println(queue.peek()); // 10// Dequeue β€” remove from frontSystem.out.println(queue.poll()); // 10System.out.println(queue.poll()); // 20// Check emptySystem.out.println(queue.isEmpty()); // false// SizeSystem.out.println(queue.size()); // 1offer() vs add() β€” both add to the queue. add() throws an exception if the queue is full (for bounded queues). offer() returns false instead. Always prefer offer().poll() vs remove() β€” both remove from front. remove() throws an exception if queue is empty. poll() returns null. Always prefer poll().peek() vs element() β€” both view the front. element() throws exception if empty. peek() returns null. Always prefer peek().Way 2: Using ArrayDeque (Fastest)ArrayDeque is faster than LinkedList for Queue operations because it uses a resizable array internally with no node allocation overhead.import java.util.ArrayDeque;import java.util.Queue;Queue<Integer> queue = new ArrayDeque<>();queue.offer(1);queue.offer(2);queue.offer(3);System.out.println(queue.peek()); // 1System.out.println(queue.poll()); // 1System.out.println(queue.size()); // 2When to use ArrayDeque over LinkedList? Use ArrayDeque whenever possible for Queue or Stack operations. It is faster because it avoids the overhead of node objects that LinkedList creates for every element. In competitive programming and interviews, ArrayDeque is the preferred choice.Way 3: Using Deque (Double Ended Queue)import java.util.ArrayDeque;import java.util.Deque;Deque<Integer> deque = new ArrayDeque<>();// Add to frontdeque.offerFirst(10);// Add to reardeque.offerLast(20);deque.offerLast(30);// Remove from frontSystem.out.println(deque.pollFirst()); // 10// Remove from rearSystem.out.println(deque.pollLast()); // 30// Peek front and rearSystem.out.println(deque.peekFirst()); // 20System.out.println(deque.peekLast()); // 20Way 4: Using PriorityQueueimport java.util.PriorityQueue;// Min Heap β€” smallest element has highest priorityPriorityQueue<Integer> minPQ = new PriorityQueue<>();minPQ.offer(30);minPQ.offer(10);minPQ.offer(20);System.out.println(minPQ.poll()); // 10 β€” smallest comes out first// Max Heap β€” largest element has highest priorityPriorityQueue<Integer> maxPQ = new PriorityQueue<>((a, b) -> b - a);maxPQ.offer(30);maxPQ.offer(10);maxPQ.offer(20);System.out.println(maxPQ.poll()); // 30 β€” largest comes out firstWay 5: Implementing Queue From Scratch Using ArrayUnderstanding the underlying implementation helps you in interviews when asked to build one from scratch.class MyQueue { private int[] arr; private int front; private int rear; private int size; private int capacity; public MyQueue(int capacity) { this.capacity = capacity; arr = new int[capacity]; front = 0; rear = -1; size = 0; } public void enqueue(int val) { if (size == capacity) { System.out.println("Queue is full!"); return; } rear = (rear + 1) % capacity; // circular wrapping arr[rear] = val; size++; } public int dequeue() { if (isEmpty()) { System.out.println("Queue is empty!"); return -1; } int val = arr[front]; front = (front + 1) % capacity; // circular wrapping size--; return val; } public int peek() { if (isEmpty()) return -1; return arr[front]; } public boolean isEmpty() { return size == 0; } public int size() { return size; }}Notice the % capacity in enqueue and dequeue β€” that is what makes it a Circular Queue. Without this, once the rear reaches the end of the array, you cannot add more even if front has moved forward and freed up space.Way 6: Implementing Queue Using Two StacksThis is a very popular interview question β€” implement a Queue using two stacks. The idea is to use one stack for enqueue and another for dequeue.class QueueUsingTwoStacks { Stack<Integer> s1 = new Stack<>(); // for enqueue Stack<Integer> s2 = new Stack<>(); // for dequeue public void enqueue(int val) { s1.push(val); // always push to s1 } public int dequeue() { if (s2.isEmpty()) { // transfer all elements from s1 to s2 // this reverses the order, giving FIFO behavior while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.pop(); } public int peek() { if (s2.isEmpty()) { while (!s1.isEmpty()) { s2.push(s1.pop()); } } return s2.peek(); } public boolean isEmpty() { return s1.isEmpty() && s2.isEmpty(); }}Why does this work?When you transfer elements from s1 to s2, the order reverses. The element that was added first to s1 ends up on top of s2 β€” which means it gets dequeued first. FIFO achieved using two LIFOs!Amortized time complexity: Each element is pushed and popped at most twice (once in s1, once in s2). So dequeue is O(1) amortized even though individual calls might take O(n).This is LeetCode 232 β€” Implement Queue using Stacks.Queue vs Stack β€” Side by SideFeatureQueueStackPrincipleFIFO β€” First In First OutLIFO β€” Last In First OutInsert atRearTopRemove fromFrontTopReal lifeLine of peopleStack of platesJava classLinkedList, ArrayDequeStack, ArrayDequeMain useBFS, schedulingDFS, backtracking, parsingPeekFront elementTop elementBFS β€” The Most Important Application of QueueBreadth First Search (BFS) is the single most important algorithm that uses a Queue. Understanding BFS is why Queue matters so much in DSA.BFS explores a graph or tree level by level β€” all nodes at distance 1 first, then all at distance 2, and so on. A Queue naturally enforces this level-by-level behavior.public void bfs(int start, List<List<Integer>> graph) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[graph.size()]; queue.offer(start); visited[start] = true; while (!queue.isEmpty()) { int node = queue.poll(); // process front node System.out.print(node + " "); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); // add unvisited neighbors to rear } } }}Why Queue and not Stack for BFS? Queue ensures you process all neighbors of a node before going deeper. Stack would take you deep into one path first β€” that is DFS, not BFS. The FIFO property is what guarantees level-by-level exploration.BFS with Queue is used in:Shortest path in unweighted graphsLevel order traversal of treesFinding connected componentsWord ladder problemsRotten oranges, flood fill, and matrix BFS problemsLevel Order Traversal β€” BFS on TreesOne of the most common Queue problems in interviews is Level Order Traversal of a binary tree.public List<List<Integer>> levelOrder(TreeNode root) { List<List<Integer>> result = new ArrayList<>(); if (root == null) return result; Queue<TreeNode> queue = new LinkedList<>(); queue.offer(root); while (!queue.isEmpty()) { int levelSize = queue.size(); // number of nodes at current level List<Integer> level = new ArrayList<>(); for (int i = 0; i < levelSize; i++) { TreeNode node = queue.poll(); level.add(node.val); if (node.left != null) queue.offer(node.left); if (node.right != null) queue.offer(node.right); } result.add(level); } return result;}The key trick here is using queue.size() at the start of each while loop iteration to know exactly how many nodes belong to the current level. Process exactly that many nodes, then move to the next level.This is LeetCode 102 β€” Binary Tree Level Order Traversal.Sliding Window Maximum β€” Monotonic DequeOne of the most impressive Queue applications is the Sliding Window Maximum problem using a Monotonic Deque. This is the queue equivalent of the Monotonic Stack pattern you saw in stack problems.The idea β€” maintain a deque that stores indices of elements in decreasing order. The front always holds the index of the maximum element in the current window.public int[] maxSlidingWindow(int[] nums, int k) { Deque<Integer> deque = new ArrayDeque<>(); // stores indices int[] result = new int[nums.length - k + 1]; int idx = 0; for (int i = 0; i < nums.length; i++) { // remove indices that are out of the current window while (!deque.isEmpty() && deque.peekFirst() < i - k + 1) { deque.pollFirst(); } // remove indices whose values are smaller than current // they can never be the maximum for any future window while (!deque.isEmpty() && nums[deque.peekLast()] < nums[i]) { deque.pollLast(); } deque.offerLast(i); // window is fully formed, record maximum (front of deque) if (i >= k - 1) { result[idx++] = nums[deque.peekFirst()]; } } return result;}This gives O(n) time for what would otherwise be an O(nΓ—k) problem. This is LeetCode 239 β€” Sliding Window Maximum.Java Queue Interface β€” Complete Method ReferenceHere is every method you will ever need from Java's Queue and Deque interfaces:Queue Methods:offer(e) β€” add to rear, returns false if full (preferred over add) poll() β€” remove from front, returns null if empty (preferred over remove) peek() β€” view front without removing, returns null if empty (preferred over element) isEmpty() β€” returns true if no elements size() β€” returns number of elements contains(o) β€” returns true if element existsDeque Additional Methods:offerFirst(e) β€” add to front offerLast(e) β€” add to rear pollFirst() β€” remove from front pollLast() β€” remove from rear peekFirst() β€” view front peekLast() β€” view rearPriorityQueue Specific:offer(e) β€” add with natural ordering or custom comparator poll() β€” remove element with highest priority peek() β€” view highest priority element without removingCommon Interview Questions About QueueThese are the questions interviewers ask to test your understanding of queues conceptually β€” not just coding.Q1. What is the difference between Queue and Stack? Queue is FIFO β€” elements are removed in the order they were added. Stack is LIFO β€” the most recently added element is removed first. Queue removes from the front, Stack removes from the top.Q2. Why is ArrayDeque preferred over LinkedList for Queue in Java? ArrayDeque uses a resizable array internally and has better cache locality and no node allocation overhead. LinkedList creates a new node object for every element added, which means more garbage collection pressure. ArrayDeque is faster in practice for most Queue use cases.Q3. When would you use a PriorityQueue instead of a regular Queue? When the order of processing depends on priority rather than arrival order. For example in a hospital, critical patients are treated before minor cases regardless of when they arrived. Or in Dijkstra's algorithm, always processing the shortest known distance first.Q4. How is Queue used in BFS? BFS uses a Queue to explore nodes level by level. The starting node is enqueued first. Each time a node is dequeued, all its unvisited neighbors are enqueued. Since Queue is FIFO, all neighbors of a node are processed before going deeper β€” guaranteeing level-by-level exploration.Q5. What is the difference between poll() and remove() in Java Queue? Both remove the front element. remove() throws NoSuchElementException if the queue is empty. poll() returns null instead of throwing. Always use poll() for safer code.Q6. Can a Queue have duplicates? Yes. Queue does not have any restriction on duplicate values unlike Sets. The same value can appear multiple times in a Queue.Q7. What is a Blocking Queue and when is it used? A Blocking Queue is a thread-safe Queue used in multi-threaded applications. When a thread tries to dequeue from an empty queue, it blocks (waits) until an element is available. When a thread tries to enqueue into a full queue, it blocks until space is available. Used in Producer-Consumer patterns.Top LeetCode Problems on QueueHere are the most important LeetCode problems that use Queue β€” organized from beginner to advanced:Beginner Level:232. Implement Queue using Stacks β€” implement Queue with two stacks, classic interview question225. Implement Stack using Queues β€” reverse of 232, implement Stack using Queue933. Number of Recent Calls β€” sliding window with QueueIntermediate Level:102. Binary Tree Level Order Traversal β€” BFS on tree, must know107. Binary Tree Level Order Traversal II β€” same but bottom up994. Rotting Oranges β€” multi-source BFS on grid1091. Shortest Path in Binary Matrix β€” BFS shortest path542. 01 Matrix β€” multi-source BFS, distance to nearest 0127. Word Ladder β€” BFS on word graph, classicAdvanced Level:239. Sliding Window Maximum β€” monotonic deque, must know862. Shortest Subarray with Sum at Least K β€” monotonic deque with prefix sums407. Trapping Rain Water II β€” 3D BFS with priority queue787. Cheapest Flights Within K Stops β€” BFS with constraintsQueue Cheat Sheet β€” Everything at a GlanceCreate a Queue:Queue<Integer> q = new LinkedList<>(); // standardQueue<Integer> q = new ArrayDeque<>(); // faster, preferredDeque<Integer> dq = new ArrayDeque<>(); // double endedPriorityQueue<Integer> pq = new PriorityQueue<>(); // min heapPriorityQueue<Integer> pq = new PriorityQueue<>((a,b) -> b-a); // max heapCore Operations:q.offer(x); // enqueueq.poll(); // dequeueq.peek(); // front elementq.isEmpty(); // check emptyq.size(); // number of elementsDeque Operations:dq.offerFirst(x); // add to frontdq.offerLast(x); // add to reardq.pollFirst(); // remove from frontdq.pollLast(); // remove from reardq.peekFirst(); // view frontdq.peekLast(); // view rearBFS Template:Queue<Integer> queue = new LinkedList<>();queue.offer(start);visited[start] = true;while (!queue.isEmpty()) { int node = queue.poll(); for (int neighbor : graph.get(node)) { if (!visited[neighbor]) { visited[neighbor] = true; queue.offer(neighbor); } }}ConclusionQueue is one of those data structures that appears simple on the surface but has incredible depth once you start exploring its variations and applications. From the basic FIFO concept to Circular Queues, Deques, Priority Queues, Monotonic Deques, and BFS β€” each layer adds a new tool to your problem-solving arsenal.Here is the learning path to follow based on everything covered in this guide:Start with understanding FIFO vs LIFO and when each applies. Then get comfortable with Java's Queue interface β€” offer, poll, peek. Practice the BFS template until it feels automatic. Then move to Level Order Traversal problems. Once BFS clicks, tackle multi-source BFS problems like Rotting Oranges. Finally learn the Monotonic Deque pattern for sliding window problems.Master these and you will handle every Queue problem in any coding interview with confidence.

QueueData StructureJavaBFSDequePriority QueueCircular Queue
LeetCode 3689: Maximum Total Subarray Value I – Java Greedy Solution Explained

LeetCode 3689: Maximum Total Subarray Value I – Java Greedy Solution Explained

IntroductionLeetCode 3689, β€œMaximum Total Subarray Value I”, is an interesting medium-level array problem that focuses on maximizing the total value of selected subarrays. The challenge introduces an important observation-based greedy approach that simplifies the problem significantly.In this article, we will break down the problem statement, understand the intuition behind the solution, analyze the Java code step-by-step, and discuss the time and space complexity.Problem StatementTry this problem here :- Maximum Total Subarray Value IYou are given:An integer array numsAn integer kYou must choose exactly k non-empty subarrays from the array.The value of a subarray is defined as:Value = Maximum Element βˆ’ Minimum ElementThe goal is to maximize the total value of all chosen subarrays.ExampleExample 1Input:nums = [1,3,2]k = 2Output:4Explanation:Subarray [1,3] β†’ 3 - 1 = 2Subarray [1,3,2] β†’ 3 - 1 = 2Total = 2 + 2 = 4Example 2Input:nums = [4,2,5,1]k = 3Output:12Explanation:The maximum possible subarray value is:5 - 1 = 4Choose this optimal subarray 3 times:4 + 4 + 4 = 12Key ObservationThe problem allows:Overlapping subarraysReusing the same exact subarray multiple timesThis changes everything.To maximize the total value:Find the maximum possible subarray value.Reuse that same subarray exactly k times.Now the question becomes:What is the maximum possible value of any subarray?Since a subarray’s value is:max(subarray) - min(subarray)The largest possible value is simply:global maximum element - global minimum elementSo the final answer becomes:(maxElement - minElement) * kJava Solutionclass Solution { public long maxTotalValue(int[] nums, int k) { long min = Long.MAX_VALUE; long max = Long.MIN_VALUE; long ans = 0; for(int i = 0; i < nums.length; i++) { min = Math.min(min, nums[i]); max = Math.max(max, nums[i]); } ans = max - min; return ans * k; }}Step-by-Step Dry RunInputnums = [4,2,5,1]k = 3Step 1: Find Minimum and MaximumTraverse the array:ElementCurrent MinCurrent Max444224525115Final:min = 1max = 5Step 2: Calculate Maximum Subarray Value5 - 1 = 4Step 3: Multiply by k4 * 3 = 12Final Answer:12Why This Greedy Approach WorksThe problem explicitly allows selecting:The same subarray multiple timesOverlapping subarraysSo once we identify the subarray with the highest possible value, there is no reason to choose anything else.The optimal strategy is:Choose the best subarray repeatedly k timesThis reduces the entire problem to finding:Maximum element - Minimum elementTime ComplexityTime ComplexityO(n)We traverse the array only once.Space ComplexityO(1)Only a few variables are used.Interview InsightsThis problem tests:Observation skillsGreedy thinkingAbility to simplify constraintsUnderstanding of problem flexibilityMany developers initially overcomplicate the problem using sliding window or dynamic programming approaches. However, the key insight is realizing that repeated subarrays are allowed.Final ThoughtsLeetCode 3689 is a great example of how carefully reading constraints can dramatically simplify a problem.Instead of generating all subarrays, the optimal solution comes from a simple mathematical observation:Maximum Total Value = (Global Max βˆ’ Global Min) Γ— kThis leads to an elegant and highly efficient O(n) solution.If you are preparing for coding interviews, this problem is an excellent exercise in greedy optimization and pattern recognition.

LeetCodeJavaMediumSubarray
Check if All Characters Have Equal Number of Occurrences – Frequency Map Approach (LeetCode 1941)

Check if All Characters Have Equal Number of Occurrences – Frequency Map Approach (LeetCode 1941)

πŸ”— Problem LinkLeetCode 1941 – Check if All Characters Have Equal Number of Occurrences πŸ‘‰ https://leetcode.com/problems/check-if-all-characters-have-equal-number-of-occurrences/IntroductionThis is one of those problems that looks very simple at first glance β€” and it actually is β€” but it helps strengthen your understanding of frequency counting using HashMap.The problem asks us to determine whether all characters in a string occur the same number of times.No sliding window. No binary search. Just clean frequency logic.But even simple problems help build strong foundations.πŸ“Œ Problem UnderstandingA string is considered "good" if:Every character that appears in the stringAppears the same number of timesIf even one character has a different frequency β†’ return false.Example 1Input: s = "abacbc"Output: trueCharacter counts:a β†’ 2b β†’ 2c β†’ 2All equal β†’ βœ” trueExample 2Input: s = "aaabb"Output: falseCharacter counts:a β†’ 3b β†’ 2Not equal β†’ ✘ false🧠 Approach & IntuitionWhen I saw this problem, my thinking was:Count the frequency of every character.Compare all frequencies.If all are equal β†’ return true.The important part is choosing a reference frequency and comparing everything against it.πŸ’» Your Codeclass Solution { public boolean areOccurrencesEqual(String s) { HashMap<Character,Integer> mp = new HashMap<>(); int ref =0; char c = s.charAt(0); for(int i =0 ; i< s.length();i++){ if(c == s.charAt(i)){ ref++; } mp.put(s.charAt(i),mp.getOrDefault(s.charAt(i),0)+1); } for(int a:mp.values()){ if(ref != a){ return false; } } return true; }}πŸ” Step-by-Step Explanation1️⃣ Initialize HashMapHashMap<Character,Integer> mp = new HashMap<>();This stores frequency of each character.2️⃣ Choose Reference Characterchar c = s.charAt(0);int ref = 0;You use the first character as a reference.Then count how many times it appears while also building the frequency map.3️⃣ Build Frequency Mapmp.put(s.charAt(i), mp.getOrDefault(s.charAt(i), 0) + 1);This line increases count for each character.4️⃣ Compare Frequenciesfor(int a : mp.values()){ if(ref != a){ return false; }}If any frequency differs from the reference count β†’ return false.Otherwise β†’ true.⏱ Time and Space ComplexityTime Complexity: O(n)One loop to count frequenciesOne loop over at most 26 charactersSpace Complexity: O(26) β‰ˆ O(1)Only lowercase English letters are allowed.πŸ”₯ Small Optimization IdeaYour solution works perfectly.However, we can simplify it slightly:Instead of separately counting the reference frequency, we can:First build the entire frequency map.Take the frequency of the first character from the map.Compare all values with it.Cleaner Versionclass Solution { public boolean areOccurrencesEqual(String s) { HashMap<Character,Integer> mp = new HashMap<>(); for(char ch : s.toCharArray()){ mp.put(ch, mp.getOrDefault(ch, 0) + 1); } int ref = mp.get(s.charAt(0)); for(int freq : mp.values()){ if(freq != ref){ return false; } } return true; }}Same logic β€” slightly cleaner structure.🎯 Key Learning from This ProblemThis problem reinforces:Frequency counting using HashMapUsing a reference value for comparisonClean loop logicEarly return for optimizationEven though it is an easy problem, it builds the base for harder problems like:Valid AnagramGroup AnagramsFirst Unique CharacterRansom Note🏁 Final ThoughtsProblems like this are not about complexity.They are about:Writing clean logicHandling frequency maps properlyThinking clearly about conditionsMastering easy problems makes medium and hard problems much easier later.

HashMapStringFrequency CountLeetCodeEasy
LeetCode 121 β€” Best Time to Buy and Sell Stock I | Two Pointer / Sliding Window Explained

LeetCode 121 β€” Best Time to Buy and Sell Stock I | Two Pointer / Sliding Window Explained

πŸš€ Try This Problem First!Before reading the solution, attempt it yourself on LeetCode β€” you'll retain the concept far better.πŸ”— Problem Link: https://leetcode.com/problems/best-time-to-buy-and-sell-stock/Understanding the ProblemYou are given an array prices where prices[i] is the stock price on day i. You can buy on one day and sell on a later day. You want to maximize your profit.Goal: Return the maximum profit possible. If no profit can be made, return 0.Key Rules:You must buy before you sell β€” no going back in time.You can only make one transaction (one buy, one sell).If prices only go down, profit is impossible β€” return 0.Constraints:1 ≀ prices.length ≀ 10⁡0 ≀ prices[i] ≀ 10⁴Understanding the Problem With a Real-World AnalogyImagine you're watching a stock ticker for a week. You want to pick the single best day to buy and a later day to sell. You can't predict the future β€” you just have historical prices. The question is: looking back at all the prices, what was the best single buy-sell pair you could have chosen?Key Observation (Before Writing a Single Line of Code)The profit on any given pair of days is:profit = prices[sell_day] - prices[buy_day]To maximize profit, for every potential sell day, we want the lowest possible buy price seen so far to the left of it. This is the core insight that drives the efficient solution.If at any point the current price is lower than our tracked minimum, there is no point keeping the old minimum β€” the new one is strictly better for any future sell day.Intuition β€” The Two Pointer ApproachWe use two pointers i (buy pointer) and j (sell pointer), both starting at the beginning with i = 0 and j = 1.At every step we ask: is prices[j] greater than prices[i]?If yes β†’ this is a profitable pair. Compute the profit and update the maximum if it's better.If no β†’ prices[j] is cheaper than prices[i]. There's no reason to keep i where it is β€” any future sell day would be better served by buying at j instead. So we move i to j.Either way, j always moves forward by 1 until it reaches the end of the array.Why Moving i to j is CorrectThis is the most important conceptual point. When prices[j] < prices[i], you might wonder β€” why not just skip j and move on? Why move i?Because for any future day k > j, the profit buying at j is:prices[k] - prices[j]And the profit buying at i is:prices[k] - prices[i]Since prices[j] < prices[i], buying at j will always give a higher or equal profit for the same sell day k. So we update i = j β€” there is no scenario where keeping the old i is better.Dry Run β€” Example 1 (Step by Step)Input: prices = [7, 1, 5, 3, 6, 4]We start with i = 0, j = 1, maxP = 0.Step 1: i = 0, j = 1 β†’ prices[i] = 7, prices[j] = 17 > 1 β†’ prices[j] is cheaper. Move i to j. i = 1, j moves to 2. maxP = 0.Step 2: i = 1, j = 2 β†’ prices[i] = 1, prices[j] = 51 < 5 β†’ Profitable! profit = 5 - 1 = 4. 4 > 0 β†’ update maxP = 4. j moves to 3.Step 3: i = 1, j = 3 β†’ prices[i] = 1, prices[j] = 31 < 3 β†’ Profitable! profit = 3 - 1 = 2. 2 < 4 β†’ maxP stays 4. j moves to 4.Step 4: i = 1, j = 4 β†’ prices[i] = 1, prices[j] = 61 < 6 β†’ Profitable! profit = 6 - 1 = 5. 5 > 4 β†’ update maxP = 5. j moves to 5.Step 5: i = 1, j = 5 β†’ prices[i] = 1, prices[j] = 41 < 4 β†’ Profitable! profit = 4 - 1 = 3. 3 < 5 β†’ maxP stays 5. j moves to 6. j = 6 = prices.length β†’ loop ends.Output: maxP = 5 βœ… (Buy at day 2 price=1, sell at day 5 price=6)Dry Run β€” Example 2 (Step by Step)Input: prices = [7, 6, 4, 3, 1]We start with i = 0, j = 1, maxP = 0.Step 1: i = 0, j = 1 β†’ prices[i] = 7, prices[j] = 67 > 6 β†’ Move i to j. i = 1, j moves to 2. maxP = 0.Step 2: i = 1, j = 2 β†’ prices[i] = 6, prices[j] = 46 > 4 β†’ Move i to j. i = 2, j moves to 3. maxP = 0.Step 3: i = 2, j = 3 β†’ prices[i] = 4, prices[j] = 34 > 3 β†’ Move i to j. i = 3, j moves to 4. maxP = 0.Step 4: i = 3, j = 4 β†’ prices[i] = 3, prices[j] = 13 > 1 β†’ Move i to j. i = 4, j moves to 5. j = 5 = prices.length β†’ loop ends.Output: maxP = 0 βœ… (Prices only went down, no profitable transaction exists)The Code β€” Implementationclass Solution {public int maxProfit(int[] prices) {int i = 0; // Buy pointer β€” points to the current minimum price dayint j = 1; // Sell pointer β€” scans forward through the arrayint maxP = 0; // Tracks the maximum profit seen so far// j scans from day 1 to the end of the arraywhile (i < j && j < prices.length) {if (prices[i] > prices[j]) {// prices[j] is cheaper than current buy price// Move buy pointer to j β€” buying here is strictly better// for any future sell dayi = j;} else {// prices[j] > prices[i] β€” this is a profitable pair// Calculate profit and update maxP if it's the best so farint profit = prices[j] - prices[i];if (profit > maxP) {maxP = profit;}}// Always move the sell pointer forwardj++;}// If no profitable transaction was found, maxP remains 0return maxP;}}Code Walkthrough β€” Step by StepInitialization: i = 0 acts as our buy day pointer (always pointing to the lowest price seen so far). j = 1 is our sell day pointer scanning forward. maxP = 0 is our answer β€” defaulting to 0 handles the case where no profit is possible.The loop condition: i < j ensures we never sell before buying. j < prices.length ensures we don't go out of bounds.When prices[i] > prices[j]: The current sell day price is cheaper than our buy day. We update i = j, because buying at j dominates buying at i for all future sell days.When prices[j] >= prices[i]: We have a potential profit. We compute it and update maxP if it beats the current best.j always increments: Regardless of which branch we take, j++ moves the sell pointer forward every iteration β€” this is what drives the loop to completion.Common Mistakes to AvoidNot returning 0 for no-profit cases: If prices are strictly decreasing, maxP never gets updated and stays 0. The initialization maxP = 0 handles this correctly β€” never initialize it to a negative number.Using a nested loop (brute force): A common first instinct is two nested loops checking every pair. That is O(NΒ²) and will TLE on large inputs. The two pointer approach solves it in O(N).Thinking you need to sort: Sorting destroys the order of days, which is fundamental to the problem. Never sort the prices array here.Moving i forward by 1 instead of to j: When prices[j] < prices[i], some people write i++ instead of i = j. This is wrong β€” you might miss the new minimum entirely and waste iterations.Complexity AnalysisTime Complexity: O(N) The j pointer traverses the array exactly once from index 1 to the end. The i pointer only moves forward and never exceeds j. So the entire algorithm is a single linear pass β€” O(N).Space Complexity: O(1) No extra arrays, maps, or stacks are used. Only three integer variables β€” i, j, and maxP.Alternative Way to Think About It (Min Tracking)Some people write this problem using a minPrice variable instead of two pointers. Both approaches are equivalent β€” the two pointer framing is slightly more intuitive visually, but here is the min-tracking version for reference:int minPrice = Integer.MAX_VALUE;int maxProfit = 0;for (int price : prices) {if (price < minPrice) {minPrice = price;} else if (price - minPrice > maxProfit) {maxProfit = price - minPrice;}}return maxProfit;The logic is the same β€” always track the cheapest buy day seen so far, and for each day compute what profit would look like if you sold today.Similar Problems (Build on This Foundation)LeetCode 122 β€” Best Time to Buy and Sell Stock II (multiple transactions allowed) [ Blog is also avaliable on this - Read Now ]LeetCode 123 β€” Best Time to Buy and Sell Stock III (at most 2 transactions) [ Blog is also avaliable on this - Read Now ]LeetCode 188 β€” Best Time to Buy and Sell Stock IV (at most k transactions)LeetCode 309 β€” Best Time to Buy and Sell Stock with CooldownLeetCode 714 β€” Best Time to Buy and Sell Stock with Transaction FeeLeetCode 121 is the foundation. Master this one deeply before moving to the others β€” they all build on the same core idea.Key Takeawaysβœ… For every potential sell day, the best buy day is always the minimum price seen to its left β€” this drives the whole approach.βœ… When the sell pointer finds a cheaper price than the buy pointer, always move the buy pointer there β€” it strictly dominates the old buy day for all future sells.βœ… Initialize maxP = 0 so that no-profit scenarios (prices only going down) are handled automatically.βœ… The two pointer approach solves this in a single linear pass β€” O(N) time and O(1) space.βœ… j always increments every iteration β€” i only moves when a cheaper price is found.Happy Coding! If this clicked for you, the entire Stock series on LeetCode will feel much more approachable.

LeetCodeTwo PointersEasyJavaDSA
LeetCode 1855 Maximum Distance Between Pair of Values | Two Pointer Java Solution

LeetCode 1855 Maximum Distance Between Pair of Values | Two Pointer Java Solution

IntroductionLeetCode 1855 – Maximum Distance Between a Pair of Values is a classic problem that beautifully demonstrates the power of the Two Pointer technique on sorted (non-increasing) arrays.At first glance, it may feel like a brute-force problemβ€”but using the right observation, it can be solved efficiently in O(n) time.In this article, we will cover:Problem intuitionWhy brute force failsOptimized two-pointer approach (your solution)Alternative approachesTime complexity analysisπŸ”— Problem LinkLeetCode: Maximum Distance Between a Pair of ValuesProblem StatementYou are given two non-increasing arrays:nums1nums2A pair (i, j) is valid if:i <= jnums1[i] <= nums2[j]πŸ‘‰ Distance = j - iReturn the maximum distance among all valid pairs.ExamplesExample 1Input:nums1 = [55,30,5,4,2]nums2 = [100,20,10,10,5]Output:2Key InsightThe most important observation:Both arrays are NON-INCREASINGπŸ‘‰ This allows us to use two pointers efficiently instead of brute force.❌ Naive Approach (Brute Force)IdeaTry all (i, j) pairsCheck conditionsTrack maximumComplexityTime: O(n Γ— m) βŒπŸ‘‰ This will cause TLE for large inputs (up to 10⁡)βœ… Optimized Approach: Two PointersIntuitionUse two pointers:i β†’ nums1j β†’ nums2We try to:Expand j as far as possibleMove i only when necessaryKey LogicIf nums1[i] <= nums2[j] β†’ valid β†’ increase jElse β†’ move i forwardJava Codeclass Solution { public int maxDistance(int[] nums1, int[] nums2) { int i = 0; // pointer for nums1 int j = 0; // pointer for nums2 int max = Integer.MIN_VALUE; // Traverse both arrays while (i < nums1.length && j < nums2.length) { // Valid pair condition if (nums1[i] <= nums2[j] && i <= j) { // Update maximum distance max = Math.max(max, j - i); // Try to expand distance by moving j j++; } else if (nums1[i] >= nums2[j]) { // nums1[i] is too large β†’ move i forward i++; } else { // Just move j forward j++; } } // If no valid pair found, return 0 return max == Integer.MIN_VALUE ? 0 : max; }}Step-by-Step Dry RunInput:nums1 = [55,30,5,4,2]nums2 = [100,20,10,10,5]Execution:(0,0) β†’ valid β†’ distance = 0Move j β†’ (0,1) β†’ invalid β†’ move iContinue...Final best pair:(i = 2, j = 4) β†’ distance = 2Why This WorksArrays are sorted (non-increasing)Moving j increases distanceMoving i helps find valid pairsπŸ‘‰ No need to re-check previous elementsComplexity AnalysisTime ComplexityO(n + m)Each pointer moves at most once through the array.Space ComplexityO(1) (no extra space used)Alternative Approach: Binary SearchIdeaFor each i in nums1:Use binary search in nums2Find farthest j such that:nums2[j] >= nums1[i]ComplexityO(n log m)Code (Binary Search Approach)class Solution { public int maxDistance(int[] nums1, int[] nums2) { int max = 0; for (int i = 0; i < nums1.length; i++) { int left = i, right = nums2.length - 1; while (left <= right) { int mid = left + (right - left) / 2; if (nums2[mid] >= nums1[i]) { max = Math.max(max, mid - i); left = mid + 1; } else { right = mid - 1; } } } return max; }}Two Pointer vs Binary SearchApproachTimeSpaceTwo PointerO(n + m) βœ…O(1)Binary SearchO(n log m)O(1)πŸ‘‰ Two pointer is optimal hereKey TakeawaysUse two pointers when arrays are sortedAlways look for monotonic propertiesAvoid brute force when constraints are largeGreedy pointer movement can optimize drasticallyCommon Interview PatternsThis problem is related to:Two pointer problemsSliding windowBinary search on arraysGreedy expansionConclusionThe Maximum Distance Between a Pair of Values problem is a great example of how recognizing array properties can drastically simplify the solution.By using the two-pointer technique, we reduce complexity from O(nΒ²) to O(n)β€”a massive improvement.Frequently Asked Questions (FAQs)1. Why do we use two pointers?Because arrays are sorted, allowing linear traversal.2. Why not brute force?It is too slow for large inputs (10⁡).3. What is the best approach?πŸ‘‰ Two-pointer approach

MediumLeetCodeJavaArrayBinary SearchTwo Pointer
Ai Assistant Kas