Search Blogs

Showing results for "HashSet"

Found 8 results

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium

Intersection of Two Arrays

LeetCode Problem 349Link of the Problem to try -: LinkGiven two integer arrays nums1 and nums2, return an array of their intersection. Each element in the result must be unique and you may return the result in any order. Example 1:Input: nums1 = [1,2,2,1], nums2 = [2,2]Output: [2]Example 2:Input: nums1 = [4,9,5], nums2 = [9,4,9,8,4]Output: [9,4]Explanation: [4,9] is also accepted. Constraints:1 <= nums1.length, nums2.length <= 10000 <= nums1[i], nums2[i] <= 1000Solution: Using HashMap and HashSet for IntersectionCore Objective: The primary goal of this problem is to identify common elements between two arrays and return them as a unique set. To achieve this efficiently, we utilize a combination of a HashMap for quick lookup and a HashSet to handle uniqueness in the result.Logic & Implementation:Populate Lookup Table: We begin by iterating through the first array (nums1) and storing its elements in a HashMap. This allows us to verify the existence of any number in $O(1)$ average time.Identify Intersection: Next, we iterate through the second array (nums2). For each element, we check if it exists within our HashMap.Handle Uniqueness: If a match is found, we add the element to a HashSet. This is a crucial step because the problem requires the output to contain unique elements, even if a common number appears multiple times in the input arrays.Final Conversion: Since the required return type is an array, we determine the size of our HashSet to initialize the result array. Using a for-each loop, we transfer the values from the Set into the array and return it as the final answer.Code Implementation:public int[] intersection(int[] nums1, int[] nums2) { // HashMap to store elements from the first array for lookup HashMap<Integer, Integer> mp = new HashMap<>(); // HashSet to store unique common elements HashSet<Integer> ms = new HashSet<>(); // Populate the map with elements from nums1 for (int i = 0; i < nums1.length; i++) { if (mp.containsKey(nums1[i])) { continue; } mp.put(nums1[i], i); } // Check for common elements in nums2 for (int i = 0; i < nums2.length; i++) { if (mp.containsKey(nums2[i])) { ms.add(nums2[i]); // HashSet ensures duplicates are not added } } // Convert the HashSet to the final integer array int[] ans = new int[ms.size()]; int co = 0; for (int i : ms) { ans[co] = i; co++; } return ans;}

LeetCodeArrayEasyHashMap

Contains Duplicate

LeetCode Problem 217Link of the Problem to try -: LinkGiven an integer array nums, return true if any value appears at least twice in the array, and return false if every element is distinct.Example 1:Input: nums = [1,2,3,1]Output: trueExplanation:The element 1 occurs at the indices 0 and 3.Example 2:Input: nums = [1,2,3,4]Output: falseExplanation:All elements are distinct.Example 3:Input: nums = [1,1,1,3,3,4,3,2,4,2]Output: trueConstraints:1 <= nums.length <= 105-109 <= nums[i] <= 109Solution:1. The HashMap ApproachUsing a HashMap is a highly effective way to track occurrences. Although we are only checking for the existence of a value, the HashMap logic allows us to store the element as a "Key" and its frequency as a "Value."Logic:Iterate through the nums array.Before inserting an element, check if the HashMap already contains that key.If it exists, you've found your duplicate—return true.Otherwise, put the value into the map and continue.Code:public boolean containsDuplicate(int[] nums) {HashMap<Integer, Integer> map = new HashMap<>();for (int i = 0; i < nums.length; i++) {// Check if the current number is already a key in our mapif (map.containsKey(nums[i])) {return true;}// Map the number to its count (1)map.put(nums[i], 1);}return false;}2. The HashSet Approach (Optimized for Storage)While similar to the HashMap, the HashSet is often more appropriate for this specific problem because we only care if a number exists, not how many times it appears or what its index is.Logic:We initialize an empty HashSet.As we loop through the array, we check ms.contains(nums[i]).If the set already has the number, it's a duplicate.This approach is preferred over HashMap for this problem because it uses less memory and has cleaner syntax.Code:public boolean containsDuplicate(int[] nums) {HashSet<Integer> ms = new HashSet<>();for (int i = 0; i < nums.length; i++) {if (ms.contains(nums[i])) {return true;}ms.add(nums[i]);}return false;}3. The Sorting & Two-Pointer ApproachIf you want to avoid using extra memory (like a Set or Map), you can use the Two-Pointer method combined with Sorting.Logic:First, we sort the array. This ensures that any duplicate values are placed next to each other.We use two pointers: j (the previous element) and i (the current element).By moving these pointers across the array, we compare the values. If nums[i] == nums[j], a duplicate exists.Code:public boolean containsDuplicate(int[] nums) {// Step 1: Sort the arrayArrays.sort(nums);// Step 2: Use two pointers to compare adjacent elementsint j = 0;for (int i = 1; i < nums.length; i++) {if (nums[i] == nums[j]) {return true; // Duplicate found}j++; // Move the previous pointer forward}return false;}Performance SummaryApproachTime ComplexitySpace ComplexityRecommendationHashSetO(n)O(n)Best Overall – Fastest performance.HashMapO(n)O(n)Good, but HashSet is cleaner for this use case.Two PointerO(n \log n)O(1)Best for Memory – Use if space is limited.Final ThoughtsChoosing the right approach depends on whether you want to prioritize speed (HashSet) or memory efficiency (Two-Pointer). For most coding interviews, the HashSet solution is the "Gold Standard" due to its linear time complexity.

LeetCodeEasyHashMap

Unique Number of Occurrences

LeetCode Problem 1207Link of the Problem to try -: LinkGiven an array of integers arr, return true if the number of occurrences of each value in the array is unique or false otherwise.Example 1:Input: arr = [1,2,2,1,1,3]Output: trueExplanation: The value 1 has 3 occurrences, 2 has 2 and 3 has 1. No two values have the same number of occurrences.Example 2:Input: arr = [1,2]Output: falseExample 3:Input: arr = [-3,0,1,-3,1,1,1,-3,10,0]Output: trueConstraints:1 <= arr.length <= 1000-1000 <= arr[i] <= 1000Solution:It is a little bit tricky question as it says you have to return true if the elements frequency contained by the array is distinct and no frequency is same if it is then return true otherwise false. So for solving this we can use HashMap to make frequency of each element then we will create a Set and store all the values of HashMap elements in the Set and then we will simply compare sizes of both Map and Set as we know that if each element frequency is unique then the sizes are same otherwise size are not same and that is a key point to solve this question very easily.Code:HashMap<Integer,Integer> mp = new HashMap<>();Set<Integer> ms = new HashSet<>();for(int i=0;i<arr.length;i++){mp.put(arr[i],mp.getOrDefault(arr[i],0)+1);}for(int u:mp.values()){ms.add(u);}if(ms.size() == mp.size()){return true;}else{return false;}

LeetCodeHashMapHashSet

LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

Try the ProblemYou can solve the problem here:https://leetcode.com/problems/find-unique-binary-string/Problem DescriptionYou are given an array nums containing n unique binary strings, where each string has length n.Your task is to return any binary string of length n that does not appear in the array.Important ConditionsEach string consists only of '0' and '1'.Every string in the array is unique.The output must be a binary string of length n.If multiple valid answers exist, any one of them is acceptable.ExamplesExample 1Inputnums = ["01","10"]Output"11"ExplanationPossible binary strings of length 2:00011011Since "01" and "10" are already present, valid answers could be:00 or 11Example 2Inputnums = ["00","01"]Output"11"Another valid output could be:10Example 3Inputnums = ["111","011","001"]Output101Other valid answers include:000010100110Constraintsn == nums.length1 <= n <= 16nums[i].length == nnums[i] consists only of '0' and '1'All strings in nums are uniqueImportant ObservationThe total number of binary strings of length n is:2^nBut the array contains only:n stringsSince 2^n grows very quickly and n ≤ 16, there are many possible binary strings missing from the array. Our goal is simply to construct one of those missing strings.Thinking About the ProblemBefore jumping into coding, it's useful to think about different strategies that could help us generate a binary string that does not appear in the array.Possible Ways to Think About the ProblemWhen approaching this problem, several ideas may come to mind:Generate all possible binary strings of length n and check which one is missing.Store all strings in a HashSet or HashMap and construct a candidate string to verify whether it exists.Manipulate existing strings by flipping bits to create new combinations.Use a mathematical trick that guarantees the new string is different from every string in the list.Each of these approaches leads to a different solution strategy.In this article, we will walk through these approaches and understand how they work.Approach 1: Brute Force – Generate All Binary StringsIdeaThe simplest idea is to generate every possible binary string of length n and check whether it exists in the given array.Since there are:2^n possible binary stringsWe can generate them one by one and return the first string that does not appear in nums.StepsConvert numbers from 0 to (2^n - 1) into binary strings.Pad the binary string with leading zeros so its length becomes n.Check if that string exists in the array.If not, return it.Time ComplexityO(2^n * n)This works because n is at most 16, but it is still not the most elegant approach.Approach 2: HashMap + Bit Flipping (My Approach)IdeaWhile solving this problem, another idea is to store all given binary strings inside a HashMap for quick lookup.Then we can try to construct a new binary string by flipping bits from the existing strings.The intuition is simple:If the current character is '0', change it to '1'.If the current character is '1', change it to '0'.By flipping bits at different positions, we attempt to build a new binary combination.Once the string is constructed, we check whether it already exists in the map.If the generated string does not exist, we return it as our answer.Java Implementation (My Solution)class Solution { public String findDifferentBinaryString(String[] nums) { int len = nums[0].length(); // HashMap to store all given binary strings HashMap<String, Integer> mp = new HashMap<>(); for(int i = 0; i < nums.length; i++){ mp.put(nums[i], i); } int cou = 0; String ans = ""; for(int i = 0; i < nums.length; i++){ if(cou < len){ // Flip the current bit if(nums[i].charAt(cou) == '0'){ ans += '1'; cou++; } else{ ans += '0'; cou++; } }else{ // If generated string does not exist in map if(!mp.containsKey(ans)){ return ans; } // Reset and try building again ans = ""; cou = 0; } } return ans; }}Time ComplexityO(n²)Because we iterate through the array and perform string operations.Space ComplexityO(n)For storing the strings in the HashMap.Approach 3: Cantor’s Diagonalization (Optimal Solution)IdeaA clever mathematical observation allows us to construct a string that must differ from every string in the array.We build a new string such that:The first character differs from the first string.The second character differs from the second string.The third character differs from the third string.And so on.By ensuring that the generated string differs from each string at least at one position, it is guaranteed not to exist in the array.This technique is known as Cantor’s Diagonalization.Java Implementationclass Solution { public String findDifferentBinaryString(String[] nums) { int n = nums.length; StringBuilder result = new StringBuilder(); for(int i = 0; i < n; i++){ // Flip the diagonal bit if(nums[i].charAt(i) == '0'){ result.append('1'); } else{ result.append('0'); } } return result.toString(); }}Time ComplexityO(n)We only traverse the array once.Space ComplexityO(n)For storing the resulting string.Comparison of ApproachesApproachTime ComplexitySpace ComplexityNotesBrute ForceO(2^n * n)O(n)Simple but inefficientHashMap + Bit FlippingO(n²)O(n)Constructive approachCantor DiagonalizationO(n)O(n)Optimal and elegantKey TakeawaysThis problem highlights an interesting concept in algorithm design:Sometimes the best solution is not searching for the answer but constructing one directly.By understanding the structure of the input, we can generate a result that is guaranteed to be unique.ConclusionThe Find Unique Binary String problem can be solved using multiple strategies, ranging from brute force enumeration to clever mathematical construction.While brute force works due to the small constraint (n ≤ 16), more elegant solutions exist. Using hashing or constructive approaches improves efficiency and demonstrates deeper algorithmic thinking.Among all approaches, the Cantor Diagonalization technique provides the most efficient and mathematically guaranteed solution.Understanding problems like this helps strengthen skills in string manipulation, hashing, and constructive algorithms, which are commonly tested in coding interviews.

Binary StringsHashingCantor DiagonalizationLeetCodeMedium

Find Length of Loop in Linked List — Complete Guide with Intuition, Dry Run & Floyd’s Cycle Algorithm

🔗 Try This ProblemPractice here:GeeksforGeeks link📌 Problem OverviewYou are given the head of a singly linked list.Your task is:Detect whether a loop (cycle) existsIf a loop exists → return the length of the loopIf no loop exists → return 0🧠 Understanding the ProblemA loop in a linked list means:👉 A node’s next pointer is pointing to a previous node, forming a cycle.Example1 → 2 → 3 → 4 → 5↑ ↓← ← ← ←Here:Loop starts at node 3Loop nodes = 3 → 4 → 5Loop length = 3💡 Intuition — How to Think About This ProblemThere are two main challenges:🔹 1. Detect if a loop exists🔹 2. Find the length of that loop🤔 Brute Force ThinkingStore visited nodes in a HashSetIf node repeats → loop detected✔ Works❌ Extra space O(n)🚀 Optimized Thinking (Floyd’s Cycle Detection)We use:Slow pointer → moves 1 stepFast pointer → moves 2 steps🧠 Key Idea👉 If a loop exists:Fast pointer will eventually meet slow pointer👉 If no loop:Fast pointer reaches null🎥 Visual Intuition & Dry Run⚙️ Optimized Approach (Step-by-Step)Step 1: Detect LoopInitialize:slow = headfast = headMove:slow → 1 stepfast → 2 stepsIf:slow == fast → loop existsStep 2: Find Length of LoopOnce loop is detected:Keep one pointer fixedMove another pointer until it comes backCount stepsWhy This Works?Because:Inside a loop, traversal becomes circularSo eventually, we will return to the same node🧪 Dry Run (Manual Understanding)Example:Loop: 3 → 4 → 5 → 3Step 1: Detect LoopSlow and fast meet inside loopStep 2: Count Loop LengthStart from meeting point:Move one pointer:3 → 4 → 5 → 3Count = 3💻 Code (Java)class Solution {public int lengthOfLoop(Node head) {Node slow = head;Node fast = head;// Step 1: Detect loopwhile(fast != null && fast.next != null){slow = slow.next;fast = fast.next.next;if(fast == slow){// Step 2: Count loop lengthint length = 1;Node temp = slow.next;while(temp != slow){temp = temp.next;length++;}return length;}}return 0; // No loop}}⏱️ Complexity AnalysisTypeValueTime ComplexityO(n)Space ComplexityO(1)🔍 Deep Insight — Why Fast Meets Slow?Fast moves twice as fast as slowInside a loop → paths become circularDifference in speed guarantees collision👉 This is a mathematical certainty in cyclic structures⚠️ Edge CasesNo loop → return 0Single node loop → return 1Large loop → still works efficiently🧩 Key TakeawaysFloyd’s Cycle Detection is powerfulLoop detection + loop length can be done in one traversalNo extra space needed🏁 Final ThoughtsThis problem is a classic linked list concept and very important for interviews.👉 Once you master this:Detect cycleFind loop lengthFind loop starting nodeAll become easier.

GeeksforGeeksLinkedListMediumFast and Slow Pointer

Intersection of Two Arrays II

LeetCode Problem 350Link of the Problem to try -: LinkGiven two integer arrays nums1 and nums2, return an array of their intersection. Each element in the result must appear as many times as it shows in both arrays and you may return the result in any order. Example 1:Input: nums1 = [1,2,2,1], nums2 = [2,2]Output: [2,2]Example 2:Input: nums1 = [4,9,5], nums2 = [9,4,9,8,4]Output: [4,9]Explanation: [9,4] is also accepted. Constraints:1 <= nums1.length, nums2.length <= 10000 <= nums1[i], nums2[i] <= 1000Solution:In this question we can build a frequency HashMap of each element and then add into the array as per it's frequency is that is a very important thing in this question to do.For creating frequency we will use getOrDefault() method in HashMap that is very useful for creating frequency as this method returns the value of that key if that key is not exist then whatever value we give that value is considered as default value for us.So, back to question here we simply create a map creating frequency of each element and if the element came again we simply increase the frequency of it then we create a ArrayList because we don't know about the size of array here so we use ArrayList after this we will iterate again on the second array and try to find that element in the map also we check it's frequency should be more than 0 and we add in the List also we decreasing the frequency of the element in the loop.At last we simply take all the elements of ArrayList and put into a array of size of that ArrayList because our questions want's ans in array that's why we have to do this step otherwise our ans is in the ArrayList and this is how we find duplicates of the number of times that element appears in both array.Code: public int[] intersect(int[] nums1, int[] nums2) { HashMap<Integer, Integer> mp = new HashMap<>(); for (int i = 0; i < nums1.length; i++) { // If you are not interested in writing getOrDefault then you can write via if statement as well // int cou =1; // if(mp.containsKey(nums1[i])){ // // int nu = mp.get(nums1[i]); // mp.put(nums1[i],mp.get(nums1[i])+1); // continue; // } // mp.put(nums1[i],cou); // Another way mp.put(nums1[i], mp.getOrDefault(nums1[i], 0) + 1); } List<Integer> lis = new ArrayList<>(); for (int i = 0; i < nums2.length; i++) { if (mp.containsKey(nums2[i]) && mp.get(nums2[i]) > 0) { lis.add(nums2[i]); } mp.put(nums2[i], mp.getOrDefault(nums2[i], 0) - 1); } int[] ans = new int[lis.size()]; for (int i = 0; i < ans.length; i++) { ans[i] = lis.get(i); } return ans; }

LeetcodeEasyHashMapHashSet